Prosecution Insights
Last updated: October 04, 2026
Application No. 17/911,409

BIO-BASED NYLON PRECURSORS HAVING REDUCED ORGANIC AND INORGANIC IMPURITIES

Final Rejection §102§103§112
Filed
Sep 13, 2022
Priority
Mar 14, 2020 — CN PCT/CN2020/079405 +1 more
Examiner
RAMIREZ, DELIA M
Art Unit
1652
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Mojia Biotech Ltd.
OA Round
2 (Final)
65%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 65% — above average
65%
Career Allowance Rate
557 granted / 855 resolved
+5.1% vs TC avg
Strong +56% interview lift
Without
With
+56.3%
Interview Lift
resolved cases with interview
Typical timeline
2y 9m
Avg Prosecution
52 currently pending
Career history
902
Total Applications
across all art units

Statute-Specific Performance

§101
7.0%
-33.0% vs TC avg
§103
21.9%
-18.1% vs TC avg
§102
19.5%
-20.5% vs TC avg
§112
37.9%
-2.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 855 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Status of the Application Claims 33-37, 39-52 are pending. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment of claims 33, 35, 37, 41-42, 45, 47-49, and cancellation of claim 38 as submitted in a communication filed on 4/29/2026 is acknowledged. Applicant elected with traverse Group III, claims 34-40, 42-52, drawn in part to a process for producing a cadaverine dicarboxylate salt, wherein the process comprises culturing microorganisms in a modified medium that lacks non-essential ions, and wherein the cadaverine dicarboxylate salt is crystalized by adding isopropanol, and further elected a dicarboxylic acid of 6 carbons and sulfate as an inorganic ion, as indicated in a communication filed on 9/23/2025. Claim 41 is withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 9/23/2025. Claims 33 (linking claim), 34-37, 39-40, 42-52 are at issue and will be examined to the extent they encompass the elected invention. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Rejections and/or objections not reiterated from previous office actions are hereby withdrawn. Claim Objections Claim 45 is objected to due to the recitation of “… crystallizing cadaverine dicarboxylate salt …”. To enhance clarity and to be consistent with commonly used claim language, the term should be amended to recite “..crystallizing the cadaverine dicarboxylate salt …”. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) or Second Paragraph (pre-AIA ) Claims 33-37, 39-40, 42-52 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Claim 33 (claims 34-37, 39-40, 42-52 dependent thereon) is indefinite in the recitation of “equal or excess molar equivalents of dicarboxylic acid to….wherein the equal or excess molar equivalents of dicarboxylic acid is with respect to the lysine…” for the following reasons. As known in the art, the term “molar equivalent” refers to the ratio of moles of a reactant to moles of another reactant in a given chemical reaction. In the case of the reaction of dicarboxylic acid such as adipic acid with lysine to produce a lysine dicarboxylic acid, one would need one mole of dicarboxylic acid and two moles of lysine. Therefore, one mole of dicarboxylic acid is the molar equivalent of 2 moles of lysine for that reaction. Applicant states in the response of 4/29/2026 that the application defines “equivalent” based on a simple molar ratio of dicarboxylic acid to lysine such that 1 equivalent is a ratio of 1:1. However, it is noted that the Examiner has not found any definition of the term “molar equivalent” in the specification, let alone the definition indicated in the response of 4/29/2026. Therefore, in the absence of a clear definition of the intended meaning of the term “molar equivalent” and the fact that this term has a totally different meaning in the art, it is unclear as to what is encompassed by the term “molar equivalents”. For examination purposes, no patentable weight will be given to the term. Correction is required. Claim 33 (claims 34-37, 39-40, 42-52 dependent thereon) is indefinite in the recitation of “reduced inorganic ion content as compared to a lysine inorganic salt stream obtained by a corresponding process in which an inorganic anion selected… is substituted for the dicarboxylate anion in the buffering system” for the following reasons. The term “a corresponding process in which an inorganic anion selected….is substituted for the dicarboxylate anion in the buffering system” encompasses a genus of processes. Therefore, the basis of comparison is variable, making the determination as to what is encompassed or excluded impossible. A lysine dicarboxylate stream can have a reduced inorganic ion content if the comparison is made with process A in which inorganic anion W is replaced with dicarboxylate anion X, and at the same time not have a reduced inorganic ion content if the comparison is made with process B in which inorganic anion Y is replaced with dicarboxylate anion Z. For examination purposes, no patentable weight will be given to the term “the lysine dicarboxylate salt stream having reduced inorganic ion content as compared….in the buffering system”. Correction is required. Claim 33 (claims 34-37, 39-40, 42-52 dependent thereon) is indefinite in the recitation of “…(d) while maintaining the pH of the lysine dicarboxylate salt stream at a level sufficient for said reaction to occur by adding the ammonium dicarboxylate buffering system to said lysine…stream” for the following reasons. There is no antecedent basis for the ammonium dicarboxylate buffering system. While step (a) states that the culture medium is required to comprise an ammonium dicarboxylate buffering system, it is unclear if step (d) requires the same ammonium dicarboxylate buffering system that is mentioned in step (a). For examination purposes, no patentable weight will be given to the term “by adding the ammonium ….salt solution”. Correction is required. Claim 45 is indefinite in the recitation of “…adding a sufficient volume of an alcohol solvent to the solution to increase the yield of cadaverine dicarboxylate salt crystals recovered by at least 20% as compared to a corresponding crystallization process lacking addition of the alcohol solvent” for the following reasons. The term “a corresponding crystallization process lacking addition of the organic solvent” encompasses a genus of crystallization processes. Therefore, the basis of comparison is variable, making the determination as to what is encompassed or excluded impossible. The yield of cadaverine dicarboxylate salt crystals recovered can be at least 20% when compared to crystallization process A and not be at least 20% if compared to crystallization process B. For examination purposes, no patentable weight will be given to the term “by adding a sufficient….to increase the yield of cadaverine…..of the organic solvent”. Correction is required. When amending the claims, applicant is advised to carefully review all examined claims and make the necessary changes to ensure proper antecedent basis and dependency. Claim Rejections - 35 USC § 112(a) or First Paragraph (pre-AIA ) Claims 33-37, 39-40, 42-47, 49-52 remain rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims 33-37, 39-40, 42-47, 49-52 remain rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a process that requires the conversion of lysine dicarboxylate into cadaverine dicarboxylate by using the protein of SEQ ID NO: 2, does not reasonably provide enablement for a process that requires the conversion of lysine dicarboxylate into cadaverine dicarboxylate by using any enzyme that catalyzes the conversion of lysine dicarboxylate into cadaverine dicarboxylate. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. These rejections have been discussed at length in the prior Office action. They are maintained for the reasons of record and those set forth below. Applicant argues that none of the prior art references cited by the Examiner as evidence that SEQ ID NO: 2 cannot be representative of the claimed genus relates to lysine decarboxylases. Applicant states that as evidenced by Iizuka et al., enzymes suitable for the decarboxylation step were well established in the art and that one of skill in the art would have understood that any suitable enzyme having lysine decarboxylase activity could be used in that step. Applicant’s arguments have been fully considered but not deemed persuasive to overcome the instant rejections. The Examiner acknowledges the teachings of Iizuka et al. as well as those of the prior art. However, the Examiner disagrees with Applicant’s contention that the entire scope of the claims is adequately described or fully enabled by the teachings of the specification and/or the prior art. With regard to the argument that the teachings of Stefanick et al., Witkowski et al., Tang et al., Sadowski et al. and Singh et al. are not representative of lysine decarboxylases, it is noted that these references were cited to show that (a) the art teaches several examples of how even highly structurally homologous polypeptides can have different enzymatic activities, and (b) determining function based solely on structural homology is highly unpredictable. While it is agreed that the specification discloses 1 lysine decarboxylase and the prior art discloses a limited number of enzymes having lysine decarboxylase activity, the issue is whether the entire genus of enzymes which are essential to carry out the claimed invention is adequately described and enabled. While Iizuka et al. refers to lysine decarboxylases as enzymes that are needed for their method and that these enzymes could be derived from certain microorganisms, Iizuka et al. do not disclose the structure of any lysine decarboxylase from these microorganisms beyond the E. coli lysine decarboxylase. It is reiterated herein that the claims require a genus of enzymes that can catalyze a decarboxylation reaction, including a genus of lysine decarboxylases having any structure, to produce cadaverine dicarboxylate. As previously indicated, the specification fails to disclose the structural elements required in any enzyme that can catalyze a decarboxylation reaction or any lysine decarboxylase, nor does it teach which structural elements of the protein of SEQ ID NO: 2 are required in any enzyme that can catalyze a decarboxylation reaction or in a lysine decarboxylase. No disclosure of a structure/function correlation has been provided which would allow one of skill in the art to recognize which proteins or variants of the polypeptide of SEQ ID NO: 2 have lysine decarboxylase activity. In the absence of (i) a rational and predictable scheme for selecting those proteins most likely to have the desired functional features, and/or (ii) a correlation between structure and lysine decarboxylase activity, one of skill in the art would have to test an essentially infinite number of proteins to determine which ones have the desired functional characteristics. This is not routine experimentation. Therefore, contrary to Applicant’s assertions, the full scope of the claims is not adequately described or enabled. Claim Rejections - 35 USC § 102 (AIA ) Claims 33-35, 37, 39-40, 42, 45-52 remain rejected under 35 U.S.C. 102(a)(1) as being anticipated by Mimizuka et al. (JP-2009-207495A published 9/17/2009; cited in the IDS) as evidenced by Laskey et al. (GenBank accession number CP043193, 8/29/2019). This rejection has been discussed at length in the prior Office action. It is maintained for the reasons of record and those set forth below. Applicant argues that Mimizuka et al. do not disclose or suggest a process wherein an equal or excess molar equivalent of dicarboxylic acid is added to the fermentation broth to obtain lysine dicarboxylate salt crystals. Applicant argues that the amount of dicarboxylic acid taught by Mimizuka et al. is less than the lysine amount added. Applicant states that the present application defines “equivalent” based on a simpler molar ratio of dicarboxylic acid to lysine which is 1:1. Applicant also states that claim 33 has been amended to specify that the equal or excess molar equivalents of dicarboxylic acid is with respect to the lysine in the fermentation broth. Applicant’s arguments have been fully considered but not deemed to persuasive to overcome the instant rejection. As indicated above, the term “molar equivalents” has been found indefinite for the reasons extensively discussed above and has not been given any patentable weight. See Claim Rejections - 35 USC § 112(b) or Second Paragraph (pre-AIA ) for claim interpretation. Therefore, as interpreted, the claims simply require adding dicarboxylic acid to the fermentation broth to obtain lysine dicarboxylate salt crystals. It is also noted that Mimizuka et al. also teach that the molar ratio of lysine to dicarboxylic acid is not limited. Furthermore, Mimizuka et al. teach the E. coli lysine decarboxylase encoded by the cadA gene (page 12, paragraph [0101]), which is the kdc gene of claim 48 as evidenced by Laskey et al. and the specification. As indicated in the specification, the E. coli kdc gene has SEQ ID NO: 1. Laskey et al. teach that nucleotides 4181859- 4184006 of E. coli chromosomal DNA comprise the coding region of the lysine decarboxylase encoded by the cadA gene as indicated by the arrows. The E. coli cadA gene of Laskey et al. comprises SEQ ID NO: 1 as shown in the alignment below. Therefore, for the reasons of record and those set forth above, the teachings of Mimizuka et al. anticipate the instant claims as written/interpreted. Query = SEQ ID NO: 1 Sbjct = Escherichia coli O16:H48 strain PG20180063 chromosome, complete genome, Sequence ID: CP043193 Score Expect Identities Gaps Strand 3967 bits(2148) 0.0 2148/2148(100%) 0/2148(0%) Plus/Plus Query 1 ATGAACGTTATTGCAATATTGAATCACATGGGGGTTTATTTTAAAGAAGAACCCATCCGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4181859 ATGAACGTTATTGCAATATTGAATCACATGGGGGTTTATTTTAAAGAAGAACCCATCCGT 4181918 Query 61 GAACTTCATCGCGCGCTTGAACGTCTGAACTTCCAGATTGTTTACCCGAACGACCGTGAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4181919 GAACTTCATCGCGCGCTTGAACGTCTGAACTTCCAGATTGTTTACCCGAACGACCGTGAC 4181978 Query 121 GACTTATTAAAACTGATCGAAAACAATGCGCGTCTGTGCGGCGTTATTTTTGACTGGGAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4181979 GACTTATTAAAACTGATCGAAAACAATGCGCGTCTGTGCGGCGTTATTTTTGACTGGGAT 4182038 Query 181 AAATATAATCTCGAGCTGTGCGAAGAAATTAGCAAAATGAACGAGAACCTGCCGTTGTAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182039 AAATATAATCTCGAGCTGTGCGAAGAAATTAGCAAAATGAACGAGAACCTGCCGTTGTAC 4182098 Query 241 GCGTTCGCTAATACGTATTCCACTCTCGATGTAAGCCTGAATGACCTGCGTTTACAGATT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182099 GCGTTCGCTAATACGTATTCCACTCTCGATGTAAGCCTGAATGACCTGCGTTTACAGATT 4182158 Query 301 AGCTTCTTTGAATATGCGCTGGGTGCTGCTGAAGATATTGCTAATAAGATCAAGCAGACC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182159 AGCTTCTTTGAATATGCGCTGGGTGCTGCTGAAGATATTGCTAATAAGATCAAGCAGACC 4182218 Query 361 ACTGACGAATATATCAACACTATTCTGCCTCCGCTGACTAAAGCACTGTTTAAATATGTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182219 ACTGACGAATATATCAACACTATTCTGCCTCCGCTGACTAAAGCACTGTTTAAATATGTT 4182278 Query 421 CGTGAAGGTAAATATACTTTCTGTACTCCTGGTCACATGGGCGGTACTGCATTCCAGAAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182279 CGTGAAGGTAAATATACTTTCTGTACTCCTGGTCACATGGGCGGTACTGCATTCCAGAAA 4182338 Query 481 AGCCCGGTAGGTAGCCTGTTCTATGATTTCTTTGGTCCGAATACCATGAAATCTGATATT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182339 AGCCCGGTAGGTAGCCTGTTCTATGATTTCTTTGGTCCGAATACCATGAAATCTGATATT 4182398 Query 541 TCCATTTCAGTATCTGAACTGGGTTCTCTGCTGGATCACAGTGGTCCACACAAAGAAGCA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182399 TCCATTTCAGTATCTGAACTGGGTTCTCTGCTGGATCACAGTGGTCCACACAAAGAAGCA 4182458 Query 601 GAACAGTATATCGCTCGCGTCTTTAACGCAGACCGCAGCTACATGGTGACCAACGGTACT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182459 GAACAGTATATCGCTCGCGTCTTTAACGCAGACCGCAGCTACATGGTGACCAACGGTACT 4182518 Query 661 TCCACTGCGAACAAAATTGTTGGTATGTACTCTGCTCCAGCAGGCAGCACCATTCTGATT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182519 TCCACTGCGAACAAAATTGTTGGTATGTACTCTGCTCCAGCAGGCAGCACCATTCTGATT 4182578 Query 721 GACCGTAACTGCCACAAATCGCTGACCCACCTGATGATGATGAGCGATGTTACGCCAATC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182579 GACCGTAACTGCCACAAATCGCTGACCCACCTGATGATGATGAGCGATGTTACGCCAATC 4182638 Query 781 TATTTCCGCCCGACCCGTAACGCTTACGGTATTCTTGGTGGTATCCCACAGAGTGAATTC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182639 TATTTCCGCCCGACCCGTAACGCTTACGGTATTCTTGGTGGTATCCCACAGAGTGAATTC 4182698 Query 841 CAGCACGCTACCATTGCTAAGCGCGTGAAAGAAACACCAAACGCAACCTGGCCGGTACAT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182699 CAGCACGCTACCATTGCTAAGCGCGTGAAAGAAACACCAAACGCAACCTGGCCGGTACAT 4182758 Query 901 GCTGTAATTACCAACTCTACCTATGATGGTCTGCTGTACAACACCGACTTCATCAAGAAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182759 GCTGTAATTACCAACTCTACCTATGATGGTCTGCTGTACAACACCGACTTCATCAAGAAA 4182818 Query 961 ACACTGGATGTGAAATCCATCCACTTTGACTCCGCGTGGGTGCCTTACACCAACTTCTCA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182819 ACACTGGATGTGAAATCCATCCACTTTGACTCCGCGTGGGTGCCTTACACCAACTTCTCA 4182878 Query 1021 CCGATTTACGAAGGTAAATGCGGTATGAGCGGTGGCCGTGTAGAAGGGAAAGTGATTTAC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182879 CCGATTTACGAAGGTAAATGCGGTATGAGCGGTGGCCGTGTAGAAGGGAAAGTGATTTAC 4182938 Query 1081 GAAACCCAGTCCACTCACAAACTGCTGGCGGCGTTCTCTCAGGCTTCCATGATCCACGTT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182939 GAAACCCAGTCCACTCACAAACTGCTGGCGGCGTTCTCTCAGGCTTCCATGATCCACGTT 4182998 Query 1141 AAAGGTGACGTAAACGAAGAAACCTTTAACGAAGCCTACATGATGCACACCACCACTTCT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182999 AAAGGTGACGTAAACGAAGAAACCTTTAACGAAGCCTACATGATGCACACCACCACTTCT 4183058 Query 1201 CCGCACTACGGTATCGTGGCGTCCACTGAAACCGCTGCGGCGATGATGAAAGGCAATGCA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183059 CCGCACTACGGTATCGTGGCGTCCACTGAAACCGCTGCGGCGATGATGAAAGGCAATGCA 4183118 Query 1261 GGTAAGCGTCTGATCAACGGTTCTATTGAACGTGCGATCAAATTCCGTAAAGAGATCAAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183119 GGTAAGCGTCTGATCAACGGTTCTATTGAACGTGCGATCAAATTCCGTAAAGAGATCAAA 4183178 Query 1321 CGTCTGAGAACGGAATCTGATGGCTGGTTCTTTGATGTATGGCAGCCGGATCATATCGAT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183179 CGTCTGAGAACGGAATCTGATGGCTGGTTCTTTGATGTATGGCAGCCGGATCATATCGAT 4183238 Query 1381 ACGACTGAATGCTGGCCGCTGCGTTCTGACAGCACCTGGCACGGCTTCAAAAACATCGAT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183239 ACGACTGAATGCTGGCCGCTGCGTTCTGACAGCACCTGGCACGGCTTCAAAAACATCGAT 4183298 Query 1441 AACGAGCACATGTATCTTGACCCGATCAAAGTCACCCTGCTGACTCCGGGGATGGAAAAA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183299 AACGAGCACATGTATCTTGACCCGATCAAAGTCACCCTGCTGACTCCGGGGATGGAAAAA 4183358 Query 1501 GACGGCACCATGAGCGACTTTGGTATTCCGGCCAGCATCGTGGCGAAATACCTCGACGAA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183359 GACGGCACCATGAGCGACTTTGGTATTCCGGCCAGCATCGTGGCGAAATACCTCGACGAA 4183418 Query 1561 CATGGCATCGTTGTTGAGAAAACCGGTCCGTATAACCTGCTGTTCCTGTTCAGCATCGGT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183419 CATGGCATCGTTGTTGAGAAAACCGGTCCGTATAACCTGCTGTTCCTGTTCAGCATCGGT 4183478 Query 1621 ATCGATAAGACCAAAGCACTGAGCCTGCTGCGTGCTCTGACTGACTTTAAACGTGCGTTC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183479 ATCGATAAGACCAAAGCACTGAGCCTGCTGCGTGCTCTGACTGACTTTAAACGTGCGTTC 4183538 Query 1681 GACCTGAACCTGCGTGTGAAAAACATGCTGCCGTCTCTGTATCGTGAAGATCCTGAATTC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183539 GACCTGAACCTGCGTGTGAAAAACATGCTGCCGTCTCTGTATCGTGAAGATCCTGAATTC 4183598 Query 1741 TATGAAAACATGCGTATTCAGGAACTGGCTCAGAATATCCACAAACTGATTGTTCACCAC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183599 TATGAAAACATGCGTATTCAGGAACTGGCTCAGAATATCCACAAACTGATTGTTCACCAC 4183658 Query 1801 AATCTGCCGGATCTGATGTATCGCGCATTTGAAGTGCTGCCGACGATGGTAATGACTCCG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183659 AATCTGCCGGATCTGATGTATCGCGCATTTGAAGTGCTGCCGACGATGGTAATGACTCCG 4183718 Query 1861 TATGCTGCATTCCAGAAAGAGCTGCACGGTATGACCGAAGAAGTTTACCTCGACGAAATG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183719 TATGCTGCATTCCAGAAAGAGCTGCACGGTATGACCGAAGAAGTTTACCTCGACGAAATG 4183778 Query 1921 GTAGGTCGTATTAACGCCAATATGATCCTTCCGTACCCGCCGGGAGTTCCTCTGGTAATG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183779 GTAGGTCGTATTAACGCCAATATGATCCTTCCGTACCCGCCGGGAGTTCCTCTGGTAATG 4183838 Query 1981 CCGGGTGAAATGATCACCGAAGAAAGCCGTCCGGTTCTGGAGTTCCTGCAGATGCTGTGT 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183839 CCGGGTGAAATGATCACCGAAGAAAGCCGTCCGGTTCTGGAGTTCCTGCAGATGCTGTGT 4183898 Query 2041 GAAATCGGCGCTCACTATCCGGGCTTTGAAACCGATATTCACGGTGCATACCGTCAGGCT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183899 GAAATCGGCGCTCACTATCCGGGCTTTGAAACCGATATTCACGGTGCATACCGTCAGGCT 4183958 Query 2101 GATGGCCGCTATACCGTTAAGGTATTGAAAGAAGAAAGCAAAAAATAA 2148 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4183959 GATGGCCGCTATACCGTTAAGGTATTGAAAGAAGAAAGCAAAAAATAA 4184006 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. Claim Rejections - 35 USC § 103 (AIA ) Claim 36 remains rejected under 35 U.S.C. 103 as being unpatentable over Mimizuka et al. (JP-2009-207495A published 9/17/2009; cited in the IDS). Claims 43-44 remain rejected under 35 U.S.C. 103 as being unpatentable over Mimizuka et al. (JP-2009-207495A published 9/17/2009; cited in the IDS) in view of Ying et al. (U.S. Publication No. 2021/0147887 published 5/20/2021, priority date 3/13/2020). These rejections have been discussed at length in the prior Office action. They are maintained for the reasons of record and those set forth below. Applicant argues that claim 33 is not obvious over Mimizuka et al. Applicant states that the addition of equal or excess molar equivalents of dicarboxylic acid to the fermentation broth provided unexpected results. Applicant states that Ying et al. do not overcome this defect. Applicant states that Mimizuka et al. teach away from the addition of an extra crystallization step prior to the enzymatic decarboxylation reaction. Applicant concludes that a person of ordinary skill in the art would not have arrived at the claimed subject matter from the teachings of Mimizuka et al. and Ying et al. Applicant’s arguments have been fully considered but not deemed persuasive to overcome the instant rejections. With regard to the argument that claim 33 is not obvious over Mimizuka et al., it is noted that as interpreted, claim 33 does not require a specific molar ratio of lysine to dicarboxylic acid. See extensive discussion above as to why the term “molar equivalent” has been found indefinite. With regard to the argument that Mimizuka et al. teach away from the addition of an extra crystallization step prior to the enzymatic decarboxylation reaction, it is noted that there is no statement or teaching by Mimizuka et al. indicating that crystallization of the lysine dicarboxylate salt should be avoided. Also, the claims as written required the addition of dicarboxylic acid to the lysine-containing fermentation broth to create salt crystals which are dissolved in an aqueous solution, which is taught by Mimizuka et al. As previously indicated, Mimizuka et al. teach adding dicarboxylic acid to form a lysine dicarboxylic acid salt which is dissolved in an aqueous medium. Therefore, step (c) of claim 33 and that of Mimizuka et al. result in the salt being dissolved in the aqueous solution. Claim 36 is directed in part to the process of claim 33 wherein the ammonium hydroxide is added to maintain a total ammonium concentration between 0.05% and 0.5% w/v. While Mimizuka et al. do not teach the specific total ammonium concentration recited, it is noted that it would have been routine optimization to arrive to the recited range since all that would have been required is to test the process of Mimizuka et al. with different ammonium concentrations. Furthermore, it is well settled that routine optimization is not patentable, even though it results in significant improvement over the prior art (see MPEP 2144.05 (II)). One of ordinary skill in the art has a reasonable expectation of success at arriving to these concentrations because ammonium hydroxide is being used for pH control in a medium that is buffered. With regard to claims 43-44, which as interpreted are directed in part to the process of claim 33 wherein the cells that produce lysine are bacterial and immobilized, it is reiterated herein that it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to use the immobilized lysine producing cells of Ying et al. in the method of Mimizuka et al. A person of ordinary skill in the art is motivated to use the immobilized cells of Ying et al. for the benefit of using a reusable cell that allows for higher yields of lysine, which is a precursor of the cadaverine dicarboxylate salt, thus increasing the yield of the cadaverine dicarboxylate salt. One of ordinary skill in the art has a reasonable expectation of success at using the immobilized cells of Ying et al. because Ying et al. teach using their cells for the production of lysine. Therefore, for the reasons extensively discussed above and those of record, the invention of claims 36, 43-44 would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention. Conclusion No claim is in condition for allowance. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action. Applicant is advised that any Internet email communication by the Examiner has to be authorized by Applicant in written form. See MPEP § 502.03 (II). Without a written authorization by Applicant in place, the USPTO will not respond via Internet email to any Internet correspondence which contains information subject to the confidentiality requirement as set forth in 35 U.S.C. 122. Sample written authorization language can be found in MPEP § 502.03 (II). An Authorization for Internet Communications in a Patent Application or Request to Withdraw Authorization for Internet Communications form (SB/439) can be found at https://www.uspto.gov/patent/forms/ forms-patent-applications-filed-or-after-september-16-2012, which can be electronically filed. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Any inquiry concerning this communication or earlier communications from the examiner should be directed to DELIA M RAMIREZ, Ph.D., whose telephone number is (571) 272-0938. The examiner can normally be reached on Monday-Friday from 8:30 AM to 5:00 PM. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert B. Mondesi, can be reached at (408) 918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. /DELIA M RAMIREZ/Primary Examiner, Art Unit 1652 DR July 7, 2026
Read full office action

Prosecution Timeline

Sep 13, 2022
Application Filed
Dec 30, 2025
Non-Final Rejection mailed — §102, §103, §112
Apr 29, 2026
Response Filed
Jul 09, 2026
Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12716081
MUTANT OF CORYNEBACTERIUM GLUTAMICUM WITH ENHANCED L-CITRULLINE PRODUCTIVITY AND METHOD FOR PREPARING L-CITRULLINE USING THE SAME
2y 10m to grant Granted Aug 25, 2026
Patent 12698515
GENETICALLY ENGINEERED BACTERIUM USING GLUCOSE AS SUBSTRATE FOR DE NOVO SYNTHESIS OF VANILLIN AND APPLICATION THEREOF
2y 4m to grant Granted Aug 04, 2026
Patent 12698492
ISOLATED CAS13 PROTEIN AND USE THEREOF
2y 3m to grant Granted Aug 04, 2026
Patent 12668785
COMBINATION TREATMENT
2y 11m to grant Granted Jun 30, 2026
Patent 12655405
SEQUENCE SPECIFIC DEGRADATION OF SINGLE-STRANDED POLYNUCLEOTIDES WITH CARD1 NUCLEASE
3y 4m to grant Granted Jun 16, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
65%
Grant Probability
99%
With Interview (+56.3%)
2y 9m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 855 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month