Office Action Predictor
Application No. 17/913,914

CORONAVIRUS DETECTION

Final Rejection §102§112
Filed
Sep 23, 2022
Examiner
GODDARD, LAURA B
Art Unit
1642
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Diagnostics For The Real World, LTD
OA Round
2 (Final)
51%
Grant Probability
Moderate
3-4
OA Rounds
3y 5m
To Grant
89%
With Interview

Examiner Intelligence

51%
Career Allow Rate
633 granted / 1251 resolved
Without
With
+38.0%
Interview Lift
avg trend
3y 5m
Avg Prosecution
67 pending
1318
Total Applications
career history

Statute-Specific Performance

§101
8.9%
-31.1% vs TC avg
§103
27.7%
-12.3% vs TC avg
§102
22.8%
-17.2% vs TC avg
§112
24.1%
-15.9% vs TC avg
Black line = Tech Center average estimate • Based on career data

Office Action

§102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 1. The Amendment filed November 6, 2025 in response to the Office Action of June 6, 2025, is acknowledged and has been entered. Claims 1, 37, 40, 55, 123, 124, 127, 140, 141, 146, 155, 160, 177, 191, 196, and 209-213 are now pending and being examined. Claims 1, 40, 55, 123, 127, 141, 146, 160, 177, 191, 196, and 210-213 are amended. New Rejections (necessitated by amendment) Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 2. Claims 210 and 211 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 210 recites the limitation "A method according to claim 1, which comprises the use of a set of primers according to claim 160". Claim 211 recites “A method according to claim 55 which comprises the use of a set of oligonucleotides according to claim 177”. There is insufficient antecedent basis for these limitations in the claims because there is no prior mention of “the use” of the set of primers or set of oligonucleotides. Examiner Suggestion: Amend the claims to delete “the use of” and to recite instead, for example, “The method according to claim 1, wherein the method employs the set of primers according to claim 160” and “The method according to claim 55, wherein the method employs the set of oligonucleotides according to claim 177.” 3. Claims 160 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 160 recites: “…wherein each nucleic acid amplification primer hybridizes specifically to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid, but not in other human coronavirus nucleic acid, wherein the nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid is the nucleic acid sequence that is conserved in the ORF1ab gene or the Nucleocapsid gene of SARS-CoV-2”. There is insufficient antecedent basis for this limitation in the claims because there is no prior mention of “the nucleic acid sequence that is conserved in the ORF1ab gene or the Nucleocapsid gene of SARS-CoV-2”. Examiner Suggestion: Amend claim 160 to recite: “…wherein each nucleic acid amplification primer hybridizes specifically to a nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid, but not in other human coronavirus nucleic acid, wherein the nucleic acid sequence that is conserved in SARS-CoV-2 nucleic acid is a nucleic acid sequence that is conserved in the ORF1ab gene or the nucleocapsid gene of SARS-CoV-2, wherein: the forward and the reverse nucleic acid primers hybridize specifically to the nucleic acid sequence that is conserved in the ORF1ab gene of SARS-CoV-2…….and/or the forward and the reverse nucleic acid primers hybridize specifically to the nucleic acid sequence that is conserved in the nucleocapsid gene of SARS-CoV-2…” Maintained Rejection The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 4. Claims 1, 37, 40, 55, 123, 124, 127, 140, 141, 146, 155, 160, 177, 191, 196, 209-213 remain rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a WRITTEN DESCRIPTION rejection. The claims are drawn methods, kits, sets of primers, and sets of oligonucleotides, comprising forward primers, reverse primers, detector probes, and/or capture probes that are defined as “comprising a nucleic acid sequence of”: SEQ ID NO:1-20; and wherein the forward primers, reverse primers, detector probes, and/or capture probes are required to perform one or more of the following claimed functions: Determine whether a sample includes SARS-COV-2 nucleic acid; Hybridize specifically to an ORF1ab gene that is conserved in SARS-CoV-2 nucleic acid; Hybridize specifically to a nucleocapsid gene that is conserved in SARS-CoV-2 nucleic acid; and Amplify, capture, or detect SARS-COV-2 nucleic acid. Thus, the claims identify the forward primers, reverse primers, detector probes, and capture probes by: (i) function only, or (ii) partial sequence and function. The partial nucleic acid sequence can comprise as few as two consecutive nucleotides of SEQ ID NOs:1-20 which qualifies as “a nucleic acid sequence of” SEQ ID NO:1-20. Therefore, the genus of forward primers, reverse primers, detector probes, and capture probes required to practice the claimed inventions is vast, encompassing an exponential number of sequence fragments and unknown sequences comprising the claimed sequence fragments, that are all required to perform the claims functions listed above. To perform the amplification, capture, and detection of SARS-CoV-2 nucleic acid through hybridization with the ORF1ab gene or nucleocapsid gene, instant specification discloses selecting the forward primer, reverse primer, detector probe, and capture probe sequences specific to hybridizing SARS-CoV-2 ORF1ab gene or nucleocapsid gene sequences through software sequence alignments of various coronaviruses (Example 2). In Example 3, the specification discloses successfully utilizing forward primers SEQ ID NO:1 and 14, reverse primers SEQ ID NOs:5 and 16, capture probes SEQ ID NOs:9 and 18, and detector probes SEQ ID NOs:12 and 19 to amplify and detect SARS-CoV-2 specifically. The specification discloses exemplary forward primers SEQ ID NOs:1-4, and 14; reverse primers SEQ ID NOs:5-7, and 15-17; detector probes SEQ ID NOs:11-13, 19, and 20; and capture probes SEQ ID NOs:8-10 and 18 ([44-47]; [85-86]; [96]; [253]; [266]). Thus, the instant specification describes SEQ ID NOs:1-20 that function as claimed and listed above. The specification fails to disclose any sequence variants comprising fragments of forward primers, reverse primers, detector probes, and capture probes that possess the claimed functions listed above. To provide adequate written description and evidence of possession of the claimed antibody genus, the instant specification can structurally describe representative forward primers, reverse primers, detector probes, and capture probes that function to hybridize to the SARS-CoV-2 ORF1ab or nucleocapsid genes and amplify, detect, or capture SARS-CoV-2 nucleic acid, or describe structural features common to the members of the genus, which features constitute a substantial portion of the genus. Alternatively, the specification can show that the claimed invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics (see University of California v. Eli Lilly and Co., 119 F.3d 1559, 43 USPQ2d 1398 (Fed. Cir. 1997) and Enzo Biochem, Inc. V. Gen-Probe Inc.). A disclosure that does not adequately describe a product itself logically cannot adequately describe a method of using that product. Although Applicants may argue that it is possible to screen for forward primers, reverse primers, detector probes, and capture probes that hybridize to SARS-CoV-2 ORF1ab or nucleocapsid genes and function as claimed, the court found in (Rochester v. Searle, 358 F.3d 916, Fed Cir., 2004) that screening assays are not sufficient to provide adequate written description for an invention because they are merely a wish or plan for obtaining the claimed chemical invention. “As we held in Lilly, “[a]n adequate written description of a DNA … ‘requires a precise definition, such as by structure, formula, chemical name, or physical properties,’ not a mere wish or plan for obtaining the claimed chemical invention.” 119 F.3d at 1566 (quoting Fiers, 984 F.2d at 1171). For reasons stated above, that requirement applies just as well to non-DNA (or RNA) chemical inventions.” Knowledge of screening methods provides no information about the structure of any future forward primers, reverse primers, detector probes, and capture probes yet to be discovered that may function as claimed. In this case, the only factor present in some of the claims is a recitation of the primer, detector probe, and capture probe function, combined with an unknown sequence comprising a fragment of the primer, detector probe, and capture probe SEQ ID NOs. The instant specification fails to describe structural features common to the members of the genus, which features constitute a substantial portion of the genus because the instant specification discloses only SEQ ID NOs:1-20 that function as claimed. A definition by function does not suffice to define the genus because it is only an indication of what the nucleic acid does, rather than what it is. Other than SEQ ID NOs:1-20, the specification fails to provide the structural features coupled to the claimed functional characteristics. The instant specification fails to describe a representative number of forward primer, reverse primer, detector probe, and capture probe sequences for the vast genus of sequence variants that function as claimed. Accordingly, in the absence of sufficient recitation of distinguishing identifying characteristics, the specification does not provide adequate written description of the claimed genus required to perform the claimed method. Given the lack of representative examples to support the full scope of the claimed variant forward primers, reverse primers, detector probes, and capture probes, and given the lack of reasonable structure-function correlation with regards to the variant sequences required to perform the claimed functions, the present claims lack adequate written description. Thus, the specification does not provide an adequate written description of forward primers, reverse primers, detector probes, and capture probes that is required to practice the claimed inventions. Since the specification fails to adequately describe the product to which the claimed methods use, it also fails to adequately describe the methods. Examiner Suggestion: Examiner previously suggested amending claim 1 to recite (bold/underlined emphasis is added below): “….(i) at least one forward nucleic acid amplification primer and at least one reverse nucleic acid amplification primer that each hybridize specifically to a nucleic acid sequence that is conserved in ORF1ab gene of SARS-CoV-2, wherein the at least one forward nucleic acid primer comprises the nucleic acid sequence of: CTGTTGGTCAACAAGACGGCA (SEQ ID NO:1), GTCAACAAACTGTTGGTCAA (SEQ ID NO:2), GTCAACAAACTGTTGGTCAACA (SEQ ID NO:3), or CATTACAGGTGGTGTTGTTCAGTT (SEQ ID NO:4); and the at least one reverse nucleic acid primer comprises the nucleic acid sequence of: CAATAGTCTGAACAACTGGTGT (SEQ ID NO:5), CTGGTGTAAGTTCCATCTCT (SEQ ID NO:6) or AGGTGACAATTTGTCCACCGAC (SEQ ID NO:7); (ii) a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer that each hybridize specifically to a nucleic acid sequence that is conserved in the nucleocapsid gene of SARS-CoV-2, wherein the forward nucleic acid primer comprises the nucleic acid sequence of: TAGTTGATGACCCGTGTCCT (SEQ ID NO:14); and the reverse nucleic acid primer comprises the nucleic acid sequence of TGGGGTCCATTATCAGACAT (SEQ ID NO:15), CAACACGAACGTCATGATAC (SEQ ID NO:16), or CATAGAACGAACAACGCAC (SEQ ID NO:17); or (iii) a combination of (i) and (ii).” Examiner previously suggested amending the claims to delete reference to variants including “a sequence of” SEQ ID NO:X. Examiner previously suggested limiting the forward primers, reverse primers, detector probes, and capture probes to SEQ ID NOs:1-20, which are the only sequences demonstrated by the specification to function as claimed. Amendments to obviate this rejection are exemplified in suggested claim 1 above, where the currently claimed phrases “comprises a nucleic acid sequence of” or “comprises a nucleic acid sequence” or “comprises a nucleic acid of sequence” should all be amended to recite “comprises the amino acid sequence of” SEQ ID NO:#. Response to Arguments 5. Applicants argue that the claims are amended to remove language pertaining to the sequence variants and complements. 6. The arguments and amendments are persuasive for those specific issues in the claims, however, the issue of claiming forward primers, reverse primers, detector probes, and capture probes comprising “a sequence of” or “a nucleic acid of” a SEQ ID NO remain rejected for the reasons stated above. Examiner suggested claim language to overcome the rejection as stated above. 7. All other objections and rejections recited in the Office Action mailed June 6, 2025 are hereby withdrawn in view of amendments. The rejection of claims under 35 U.S.C. 101 is withdrawn in view of amendments and arguments. The claimed kits comprise probes detectably labeled or modified reverse nucleic acid primer that are not found in nature and function to improve SARS-CoV-2 detection. The rejection of claims 206 and 207 under 35 U.S.C. 102(a)(2) is withdrawn in view of the claims being canceled. 8. Conclusion: No claim is allowed. Conclusion 9. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. 10. Any inquiry concerning this communication or earlier communications from the examiner should be directed to LAURA B GODDARD whose telephone number is (571)272-8788. The examiner can normally be reached Mon-Fri, 7am-3:30pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis can be reached at 571-270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Laura B Goddard/Primary Examiner, Art Unit 1642
Read full office action

Prosecution Timeline

Sep 23, 2022
Application Filed
Jun 04, 2025
Non-Final Rejection — §102, §112
Nov 06, 2025
Response Filed
Dec 23, 2025
Final Rejection — §102, §112
Mar 30, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology. Study what changed to get past this examiner.

Patent 12595308
ANTI-B7H3 ANTIBODY AND USE THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12582643
TASQUINIMOD OR A PHARMACEUTICALLY ACCEPTABLE SALT THEREOF FOR USE IN COMBINATION THERAPY
2y 5m to grant Granted Mar 24, 2026
Patent 12577318
HUMANIZED ANTI-CA IX ANTIBODIES AND METHODS OF THEIR USE
2y 5m to grant Granted Mar 17, 2026
Patent 12570731
METHODS FOR TREATING CANCER WITH AN ANTI-APO B100 ANTIBODY
2y 5m to grant Granted Mar 10, 2026
Patent 12565531
BISPECIFIC FUSION PROTEIN FOR TUMOR TREATMENT
2y 5m to grant Granted Mar 03, 2026

AI Strategy Recommendation

Click below to generate an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
51%
Grant Probability
89%
With Interview (+38.0%)
3y 5m
Median Time to Grant
Moderate
PTA Risk
Based on 1251 resolved cases by this examiner