DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 2, 3, 5, 11, 15, 23, 30, 32, 37, 46, 69, 76, 100, 103, 106, 119, 120-123 are pending. Claims 1, 74, 75, 77, 90, 91, 95, and 96 are canceled. Claims 2, 3, 5, 11, 15, 23, 30, 32, 37, 46, 69, 76, 100, and 119 are amended. New claims 120-123 are added. Applicant’s election without traverse of group IV (claims 100, 103, and 106) in the Remarks filed 1/7/26 is acknowledged. Applicant elects the species of:
Species 1: SEQ ID NO: 949;
Species 2: miR-30;
Species 3: Neuromuscular disorder;
Species 7: Facioscapulohumeral muscular dystrophy (FSHD);
Claims 32, 37, and 46 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Examination on the merits commences on claims 2, 3, 5, 11, 15, 23, 30, 69, 76, 100, 103, 106, 119, 120-123.
Claim Interpretation
Examiner interprets limitations following the phrase “optionally” in claims 3, 11, 15, 23, 30, 69, 100, 103, and 106 as unnecessary claim limitations.
Claim Objection
Claim 30 recites, “wherein at least about 80% of an initial amount of the engineered oligonucleotide or salt thereof remains when the engineered oligonucleotide or salt thereof is stored in… ”. Examiner requests further clarification of “remains” such that it sufficiently phrased to convey what actually remains after the claimed time period.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 100, 15, and 76 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The independent claim 100 recites, “A method of treating a subject in need thereof comprising: administering to the subject a therapeutically effective amount of the engineered oligonucleotide or salt thereof comprising a polynucleotide sequence, wherein the engineered oligonucleotide or salt thereof is at least partially complementary to at least a portion of at least a first and a second RNA originating from two genetic loci that are associated with a disease or condition…”. However, claim 100 lacks antecedent basis for “the engineered oligonucleotide”. Furthermore, it is unclear given lacking guidance from the specification and drawings how exactly the “two genetic loci” are “associated” with a disease or condition as well as how specifically the claimed oligonucleotide is binding two different RNAs, two separate RNAs, or a single RNA from separate genes. Given the metes and bounds of the engineered oligonucleotide are unclear, claim 100 is indefinite.
Claims 2, 3, 5, 11, 15, 23, 30, 69, 76, 103, 106, 119, 120-123 are also rejected under 35 USC 112 (b) by virtue of their dependency on claim 100 without remedying the indefiniteness.
Claim 15 recites, “the engineered oligonucleotide sequence comprises the sugar, base, or backbone modification…”. However, claim 15 lacks antecedent basis for “the sugar, base, or backbone modification”. Given the metes and bounds of the engineered oligonucleotide are unclear, claim 15 is indefinite.
Claim 76 recites, “The method of claim 100, where the structure and chemistry is optimized to impart greater than or equal to 100X stability to natural nucleases compared to an unmodified sequence or a comparable ncRNA. …”. However, claim 76 lacks antecedent basis for “the structure and chemistry” and fails to specify which structure and feature of claim 100 is being addressed. Given the metes and bounds of the structure and chemistry are unclear, claim 76 is indefinite. Examiner is interpreting the limitation as the structure and chemistry of the engineered oligonucleotide composition of claim 100.
Claim Rejections - 35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 2, 3, 5, 11, 15, 23, 30, 69, 76, 100, 103, 106, 119, 120-123 is/are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A3.(a).(i) states, “whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention.”
For claims drawn to a genus, MPEP 2163.II.A3.(a).(ii) states, “written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species” where “representative number of species’ means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.”
The claims are drawn to a method of treating a subject in need thereof comprising: administering to the subject a therapeutically effective amount of the engineered oligonucleotide or salt thereof comprising a polynucleotide sequence, wherein the engineered oligonucleotide or salt thereof is at least partially complementary to at least a portion of at least a first and a second RNA originating from two genetic loci that are associated with a disease or condition wherein a predicted Gibbs free energy(AG) of binding of the engineered oligonucleotide ranges from about -17 to about -36 kcal mol at about 37 degrees Celsius and at a pH ranging from about 7.2 to about 7.6.
The specification has not adequately described the entire genus of “oligonucleotides” that can target a “first and a second RNA” from “two genetic loci that are associated with disease” for the following reasons.
Size and Breadth of the Genus
The claims are drawn to a method of treating a subject in need thereof comprising: administering to the subject a therapeutically effective amount of the engineered oligonucleotide or salt thereof comprising a polynucleotide sequence, wherein the engineered oligonucleotide or salt thereof is at least partially complementary to at least a portion of at least a first and a second RNA originating from two genetic loci that are associated with a disease or condition wherein a predicted Gibbs free energy(AG) of binding of the engineered oligonucleotide ranges from about -17 to about -36 kcal mol at about 37 degrees Celsius and at a pH ranging from about 7.2 to about 7.6.
However, the claimed language does not limit the structure of the oligonucleotides or the targeted RNAs, either in length, modification, secondary/tertiary structure, or further function and there is no clear structure-function relationship shown to know which structures would have the claimed capability of binding two different RNAs from separate genetic loci with the claimed free energies required to be capable of treating the claimed broad genus of subjects and disease states. Furthermore, the claimed language does not limit the “at least a first and a second RNA” or the “genetic loci associated with disease” such that there is a clear relationship of how the loci are associated with a disease state and weather the two RNAs are a single mRNA spliced from separate genes or separate and distinct RNA segments from separate and distinct genetic loci.
The genus of “oligonucleotides” are broad and diverse in the art. Oligonucleotides can be single stranded or double stranded, DNA or RNA, modified with 2’, 5’, and 3’ modifications. Single stranded oligonucleotides may have a double stranded region, and double stranded oligonucleotides may have a single stranded region. Some oligonucleotides include structural genes, genes containing control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNA and other RNA interference reagents (RNAi or iRNA agents), shRNA, antisense oligos. Nucleotide, ribozyme, microRNA, microRNA mimetic, supermir, aptamer, antimir, antagomir, Ul adapter, triplex-forming oligonucleotide, G-quadruplex oligonucleotide, RNA activator, immunostimulatory oligo, and decor oligonucleotides, among others. In this case, the claims encompass the genus with broad functional limitations, where there is substantial variation within the genus of oligonucleotides and genetic loci.
Species disclosed in the Specification
The specification discloses a variety of nucleic acids that can serve as oligonucleotides that hybridize a target RNA from two genetic loci. FIG. 1A and 1B teaches a natural miR-30 guide strand sequences and examples of engineered family members. FIG. 2A shows free energy (AG) and hybridization between natural miR-30a-5p sequence and target sites in the 3'UTRs of ITGA6, SERPINEl, and EGFR transcripts. FIG 6B shows exemplar duplex stability of engineered miR-30 miRNA mimics in human serum. FIG. 28 shows simultaneous knockdown of DUX4 and DBET RNA transcripts in FSHD patient myoblasts by multi-targeted ASOs.
Although the specification discloses several embodiments of “oligonucleotide,” and “genetic loci”, the specification fails to teach representative species which sufficiently describe the full genus capable of the claimed broad binding and targeting by multi-specific expression inhibitors.
Species Disclosed in the Art
Oligonucleotides can be single stranded or double stranded, DNA or RNA, modified with 2’, 5’, and 3’ modifications. Single stranded oligonucleotides may have a double stranded region, and double stranded oligonucleotides may have a single stranded region. Some oligonucleotides include structural genes, genes containing control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNA and other RNA interference reagents (RNAi or iRNA agents), shRNA, antisense oligos. Nucleotide, ribozyme, microRNA, microRNA mimetic, supermir, aptamer, antimir, antagomir, Ul adapter, triplex-forming oligonucleotide, G-quadruplex oligonucleotide, RNA activator, immunostimulatory oligo, and decor oligonucleotides, among others.
Regarding nucleic acid oligonucleotides as gene modulators, Wang teaches that the ability to predict nucleic acid hybridization (i.e., via “rational design”) is generally limited to the use of unmodified nucleic acids, and that many broadly employed chemical modifications to DNA and RNA have not been included in predictive models (pg. 2, para. 1 and pg. 14, para. 1; Wang et al., 2022, PLOS ONE, 17(5), e0268575). Wang teaches thermodynamic models of hybridization for nucleic acid molecules with phosphorothioate linkages, where each linkage modification decreases duplex stability (pg. 13, para. 4) Wang teaches that backbone and sugar ring modifications, in conjunctions with nucleotide sequence, would likely require a combinatorially large (and synthetically intractable) set of duplexes to fully characterize (pg. 13, para. 3). Therefore, it is unpredictable that nucleic acid hybridization without a rational design incorporating thermodynamics, phosphorothioate linkages or backbone/sugar ring modifications would successfully promote nucleic acid binding.
Regarding oligonucleotide gene modulators, Butler (Butler, US 9982257 B2, published 5/29/2018) teaches single stranded gene expression influencing oligonucleotides for subject delivery to treat various diseases conditions (22 line 60). Butler teaches the oligonucleotide as a polymer or oligomer of nucleotide monomers, containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges with internucleotidic linkages (22 line 60) and be of various length including 20 nucleosides (23 line 25) .
As the prior art establishes, there is substantial variation within the genus of oligonucleotides which can target RNAs from genetic loci associated with disease. Applicant fails to adequately describe a sufficient variety of species to reflect the variation within the genus. Furthermore, the description of a representative number of species from the specification is not representative of the entire genus. Given the lack of guidance in the art and specification regarding common structural characteristics shared by members of the genus and lack of predictability of undefined modifications, secondary structure, or functional relationship of the oligonucleotide to the target RNA(s) or the target RNA(s) to a disease state, the specification disclosure is not sufficient to show that the Applicant was in possession of the claimed “oligonucleotide” that can target a “first and a second RNA originating from two genetic loci that are associated with disease” at the time the invention was filed. Examiner suggests disclosing a specific structure of oligonucleotide with the elected SEQ ID NO as well as disclosing the structure-function relationship of that oligonucleotide with the two RNAs by specifying the nature of the binding and disclosing the specific RNAs and the specific genetic loci as genes from which the two RNAs are presumably coded as well as disclosing how those loci are associated with what specific disease.
Dependent claims
The dependent claims of claim 100 do not further limit the genus so as to resolve the issues above, and therefore lack adequate written description for the reason outlined for claim 100.
Claim Rejections - 35 USC § 112(a) – Scope of Enablement
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 2, 3, 5, 11, 15, 23, 30, 69, 76, 100, 103, 106, 119, 120-123 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while enabling for a method of treating a subject with the neuromuscular disorder Facioscapulohumeral Muscular Dystrophy (FSHD) using a short-stranded oligonucleotide RNAi, does not reasonably enable the method for the genus of all oligonucleotides that can target any gene related to any disorder. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention and Breadth of claims
The claims are drawn to a method of treating a subject in need thereof comprising administering to the subject a therapeutically effective amount of the engineered oligonucleotide wherein a predicted Gibbs free energy(AG) of binding of the engineered oligonucleotide ranges from about -17 to about -36 kcal mol at about 37 degrees C and at a pH ranging from about 7.2 to about 7.6.
However, the claimed language does not limit the structure of the oligonucleotides in length, modification, secondary/tertiary structure, or further function. The genus of “oligonucleotides” is broad and diverse in the art. Oligonucleotides can be single stranded or double stranded, DNA or RNA, modified with 2’, 5’, and 3’ modifications. Single stranded oligonucleotides may have a double stranded region, and double stranded oligonucleotides may have a single stranded region. Some oligonucleotides include structural genes, genes containing control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNA and other RNA interference reagents (RNAi or iRNA agents), shRNA, antisense oligos. Nucleotide, ribozyme, microRNA, microRNA mimetic, supermir, aptamer, antimir, antagomir, Ul adapter, triplex-forming oligonucleotide, G-quadruplex oligonucleotide, RNA activator, immunostimulatory oligo, and decor oligonucleotides, among others. Accordingly, enablement of the method requires one skilled in the art to be able to use any oligonucleotide for treating any disease in any subject.
Guidance from the Specification
The specification discloses a variety of nucleic acids that can serve as oligonucleotides that hybridize a target RNA. FIG. 1A and 1B teaches a natural miR-30 guide strand sequences and examples of engineered family members. FIG. 2A shows free energy (AG) and hybridization between natural miR-30a-5p sequence and target sites in the 3'UTRs of ITGA6, SERPINEl, and EGFR transcripts. FIG 6B shows exemplar duplex stability of engineered miR-30 miRNA mimics in human serum. FIG. 28 shows simultaneous knockdown of DUX4 and DBET RNA transcripts in FSHD patient myoblasts by multi-targeted ASOs.
Although the specification discloses several embodiments of “oligonucleotides” as short-stranded DNAs of more than 5 bases and less than 50 bases the specification fails to teach representative species of oligonucleotides which sufficiently describe the full genus of oligonucleotides within the claimed predicted Delta G state capable of predictably treating any diseased subject in need by targeting any combination of genes. As such, the scope of enablement in the disclosure does not bear a reasonable correlation to the scope of the claims. MPEP 2164.08.
State of the Art
The genus of oligonucleotides and genetic loci are broad and diverse in the art. “Two genetic loci” may involve two different genes on different parts of the chromosome, or it can also refer to two different exon regions or distinct genomic segments that are transcribed into a single, contiguous pre-mRNA or mature mRNA molecule. A single mRNA molecule can contain functional sequences derived from two distinct genetic locations, and a binding molecule can interact with neighboring regions of that single mRNA. Similarly, oligonucleotides vary substantially. They can be single stranded or double stranded, DNA or RNA, modified with 2’, 5’, and 3’ modifications. Single stranded oligonucleotides may have a double stranded region, and double stranded oligonucleotides may have a single stranded region. Some oligonucleotides include structural genes, genes containing control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNA and other RNA interference reagents (RNAi or iRNA agents), shRNA, antisense oligos. Nucleotide, ribozyme, microRNA, microRNA mimetic, supermir, aptamer, antimir, antagomir, Ul adapter, triplex-forming oligonucleotide, G-quadruplex oligonucleotide, RNA activator, immunostimulatory oligo, and decor oligonucleotides, among others.
Regarding nucleic acid oligonucleotides as gene modulators, Wang teaches that the ability to predict nucleic acid hybridization (i.e., via “rational design”) is generally limited to the use of unmodified nucleic acids, and that many broadly employed chemical modifications to DNA and RNA have not been included in predictive models (pg. 2, para. 1 and pg. 14, para. 1; Wang et al., 2022, PLOS ONE, 17(5), e0268575). Wang teaches thermodynamic models of hybridization for nucleic acid molecules with phosphorothioate linkages, where each linkage modification decreases duplex stability (pg. 13, para. 4) Wang teaches that backbone and sugar ring modifications, in conjunctions with nucleotide sequence, would likely require a combinatorially large (and synthetically intractable) set of duplexes to fully characterize (pg. 13, para. 3). Therefore, it is unpredictable that nucleic acid hybridization without a rational design incorporating thermodynamics, phosphorothioate linkages or backbone/sugar ring modifications would successfully promote nucleic acid binding.
Regarding oligonucleotide gene modulators, Butler (Butler, US 9982257 B2, published 5/29/2018) teaches single stranded gene expression influencing oligonucleotides for subject delivery to treat various diseases conditions (22 line 60). Butler teaches the oligonucleotide as a polymer or oligomer of nucleotide monomers, containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges with internucleotidic linkages (22 line 60) and be of various length including 20 nucleosides (23 line 25) .
After a thorough search of the related art, in the method of treating a subject in need thereof comprising administering to the subject a therapeutically effective amount of the engineered oligonucleotide wherein a predicted Gibbs free energy(AG) of binding of the engineered oligonucleotide, evidence in the art is lacking as to whether any oligonucleotides can be predictably used within the claimed method. Taking this into consideration, the lack of related examples in the specification, the lack of knowledge in the art of the unpredictability oligonucleotides, and the large genus of “oligonucleotides” recited in the claims, it is the conclusion that undue experimentation would be required to use the described invention to target any unspecific RNAs from any unspecified genetic locus. Examiner suggests disclosing the target gene or genes and incorporating the elected species of oligonucleotide SEQ ID and disease state from the dependent claims.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 2, 3, 5, 11, 15, 23, 30, 69, 76, 100, 103, 106, 119, 120-123 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Harper (Harper, S., AU-2020200323-A1, published 2/6/2020), claim 100 as evidenced by NNDB_Gibbs (NNDB_Gibbs, https://rna.urmc.rochester.edu/NNDB/help.html#:~:text=remove%20the%20pseudoknot.-,Free%20Energy%2C%20Enthalpy%2C%20and%20Entropy%20Change,%C2%B037)/(310.15%20K), retrieved 2/14/2026, printed as pages 1/1 to 1/3), and claim 100 further evidenced by GenBankGTPBP2 (GenBankGTPBP2, Homo sapiens GTP binding protein 2 (GTPBP2), transcript variant 2, mRN - Nucleotide - NCBI, ACCESSION NM_001286216 XM_005249197, revision 8/6/2019, retrieved 2/16/26, printed as pages 1/1 to 4/4), and claim 122 and 123 as evidenced by Tawil (Tawil, Rabi, et al. Neurology 85.4 (2015): 357-364.)
Regarding independent claim 100, Harper teaches methods and products for treating the neuromuscular disorder FSHD by inhibiting the expression of the DUX4 gene by delivering various inhibitory RNAs targeting the DUX4 gene to muscle cells, wherein the RNAs include antisense RNAs, small inhibitory RNAs (siRNAs), short hairpin RNAs (shRNAs) or artificial microRNAs (DUX4 miRNAs) that inhibit expression of DUX4 [0013]. Harper teaches the RNA interference (RNAi) of the invention is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases where the miRNAs are small (21-25 nucleotides), noncoding RNAs that share sequence homology and base-pair with 3'untranslated regions of cognate messenger RNAs (mRNAs)[0008]. Harper teaches the interaction between the miRNAs and mRNAs directs cellular gene silencing machinery to prevent the translation of the mRNAs [0008]. Harper teaches expression of DUX4 inhibited by greater than 90% [00015]. Harper teaches SEQ ID NO: 8758 targeting DUX4 with 92.7% identity to claimed elected SEQ ID NO: 949 (pg 127).
PNG
media_image1.png
191
855
media_image1.png
Greyscale
Harper teaches the base of the stem (5' of position 13 and 3' of position 75) is also derived from mir-30a structure and sequence with some modifications depending on the primary sequence of the guide strand. Specifically, the nucleotide at position 13 can vary to help facilitate a required mismatched between the position 13 and 75 nucleotides. This bulged structure is hypothesized to facilitate proper Drosha cleavage [0044].
Harper is silent as to the Gibbs free energy of binding of the engineered oligonucleotides of the invention, however, NNDB_Gibbs free energy model calculation teaches Harper’s SEQ ID NO: SEQ ID NO: 8758 (CCUAGACAGCGUCGGAAGGUGG) targeting DUX4 (92% identity to elected SEQ ID NO: 949), has a (ΔG) of -6 kcal/mol at 37 degrees Celsius at pH of 7, i.e. an oligonucleotide of a predicted Gibbs free energy(Δ G) of about -17 to about -36 kcal mol at about 37 degrees Celsius and at a pH of about 7.2.
Harper is silent as to the multi-targeting capability of the anti-DUX4 oligonucleotides in addition to the target of Dux4 mRNA. However, GenBankGTPBP2 teaches GTPBP2 human mRNA has 13 contiguous nucleotides complementary to Harper’s SEQ ID NO: 8758 also complementary to DUX4 (92.7% identity to claimed SEQ ID NO: 949) (pg 127). GenBankGTPBP2 also teaches the GTPBP2 gene is associated with severe intellectual disability and structural nuerologic abnormalities (pg 1), i.e. a second region of at least five contiguous bases in the engineered oligonucleotide are complementary to contiguous nucleotides contained within the second RNA related to a disease state.
PNG
media_image2.png
234
879
media_image2.png
Greyscale
Regarding claim 101, Examiner is interpreting that while “Two genetic loci” may involve two different genes on different parts of the chromosome, it can also refer to two different exon regions or distinct genomic segments that are transcribed into a single, contiguous pre-mRNA or mature mRNA molecule. A single mRNA molecule can contain functional sequences derived from two distinct genetic locations, and a binding molecule can interact with neighboring regions of that single mRNA. As described above, Examiner is interpreting Harper’s RNA oligonucleotide which has complementary regions to human DUX4 and GTPBP2 mRNA, as reading on claim 100, i.e. an engineered oligonucleotide or salt thereof is at least partially complementary to at least a portion of at least a first and a second RNA originating from two genetic loci that are associated with a disease or condition, wherein when the engineered oligonucleotide or salt thereof at least partially binds to the first RNA, a first region of at least seven contiguous bases in the engineered oligonucleotide are complementary to contiguous nucleic acids contained within the first RNA, and a second region of at least five contiguous bases in the engineered oligonucleotide are complementary to contiguous nucleic acids contained within the first RNA, and wherein when the engineered oligonucleotide or salt thereof at least partially binds to the second RNA, a first region of at least seven contiguous bases in the engineered oligonucleotide are complementary to contiguous nucleotides contained within the second RNA, and a second region of at least five contiguous bases in the engineered oligonucleotide are complementary to contiguous nucleotides contained within the second RNA.
Regarding claim 2, as described above, Harper teaches the oligonucleotide as a miRNA [0008].
Regarding claim 3, as described above, Harper teaches the base of the stem (5' of position 13 and 3' of position 75) is derived from mir-30a structure and sequence with some modifications depending on the primary sequence of the guide strand. Specifically, the nucleotide at position 13 can vary to help facilitate a required mismatched between the position 13 and 75 nucleotides. This bulged structure is hypothesized to facilitate proper Drosha cleavage [0044].
Regarding claim 5, as described above, Harper teaches the oligonucleotide where the miRNAs are small (21-25 nucleotides), noncoding RNAs that share sequence homology and base-pair with 3'untranslated regions of cognate messenger RNAs (mRNAs)[0008], i.e. the engineered oligonucleotide or salt thereof is from about 5 to about 50 nucleotides in length. Examiner notes that claim 5 uses a sequence of limitations separated by an ";" and uses "and/or" before the last ";", therefore the list of SEQ ID NOs (SEQ ID NO 949 elected) is not a necessary limitation, given the use of the "and/or".
Regarding claims 11 and 15, as described above, Harper teaches the oligonucleotide base of the stem (5' of position 13 and 3' of position 75) is derived from mir-30a structure and sequence with modifications depending on the primary sequence of the guide strand. Specifically, the nucleotide at position 13 can vary to help facilitate a required mismatched between the position 13 and 75 nucleotides [004].
Regarding claim 23, as described above, Harper teaches the oligonucleotide target RNA as mRNA [0008].
Regarding claim 30, Harper teaches the pharmaceutical compositions of the invention are stable under the conditions of manufacture and storage and preserved against the contaminating actions of microorganisms such as bacteria and fungi [0034]. Examiner is interpreting this as at least about 80% of an initial amount of the engineered oligonucleotide or salt thereof remains intact and effective for use for at least about a month.
Regarding claim 69 and 106, as described above, Harper teaches treating the neuromuscular disorder FSHD by inhibiting the expression of the DUX4 gene by delivering various inhibitory RNAs targeting the DUX4 gene to muscle cells [0013].
Regarding claim 76, Harper teaches the oligonucleotide compositions engineered for sustained expression of miRNAs from transduced myofibers [0039] and where the compositions contain adjuvants, buffers, and pharmaceutical modifications to significantly enhance composition effectiveness and stability upon intramuscular delivery to a subject [0033-0044]. Examiner is interpreting this as compositions optimized to impart greater than 100X stability compared to comparable ncRNA.
Regarding claim 103, Harper teaches the oligonucleotide compositions may also comprise other ingredients such as diluents and adjuvants [0027].
Regarding claim 119, as described above, Harper teaches the oligonucleotide at position 13 can vary to help facilitate a required mismatched between the position 13 and 75 nucleotides to facilitate proper Drosha cleavage [0044].
Regarding claim 120 and 121, Harper teaches the vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a rAAV of the invention to a human [0029].
Regarding claim 122 and 123, Tawil teaches biomarker analysis as diagnostic criteria for diagnosing FSHD (pg 360 col 2 para 2).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claim 2, 3, 5, 11, 15, 23, 30, 69, 76, 100, 103, 106, 119, 120-123 are rejected on the grounds of nonstatutory double patenting as being unpatentable over claims 1-24 of the patent No. US11795459B2.
Although the claims at issue are not identical, they are not patentably distinct from each other because the co-pending claims anticipate the instant claims.
The reference claims teach:
1. An antisense oligonucleotide or salt thereof comprising a polynucleotide sequence, wherein the antisense oligonucleotide or salt thereof is at least partially complementary to at least a portion of at least a first and a second RNA originating from two genetic loci that are associated with a disease or condition, wherein at least a portion of the first or the second RNA is encoded in a IRX5 gene, wherein when the antisense oligonucleotide or salt thereof at least partially binds to the first RNA, a first region of at least seven contiguous bases in the antisense oligonucleotide are complementary to contiguous nucleic acids contained within the first RNA, and a second region of at least five contiguous bases in the antisense oligonucleotide are complementary to contiguous nucleic acids contained within the first RNA, and wherein when the antisense oligonucleotide or salt thereof at least partially binds to the second RNA, a first region of at least seven contiguous bases in the antisense oligonucleotide are complementary to contiguous nucleotides contained within the second RNA, and a second region of at least five contiguous bases in the antisense oligonucleotide are complementary to contiguous nucleotides contained within the second RNA, and wherein a predicted Gibbs free energy (ΔG) of binding of the antisense oligonucleotide to the first and the second RNA ranges, individually, from about −17 to about −36 kcal mol−1 at about 37 degrees Celsius and at a pH ranging from about 7.2 to about 7.6, wherein the antisense oligonucleotide or salt thereof comprises at least one chemically modified nucleotide.
2. The antisense oligonucleotide or salt thereof of claim 1, wherein the antisense oligonucleotide or salt thereof comprises one or more nucleotide insertions, nucleotide deletions, nucleotide substitutions, or any combination thereof, relative to one or more otherwise comparable non-coding RNAs (ncRNAs).
3. The antisense oligonucleotide or salt thereof of claim 2, wherein the antisense oligonucleotide or salt thereof, when at least partially bound to the first or the second RNA, has an at least 10% lower Gibbs free energy (ΔG) of binding at 37 degrees Celsius and at a pH ranging from 7.2 to 7.6, relative to a ΔG of binding of the otherwise comparable ncRNA binding to the first or the second RNA at 37 degrees Celsius and at a pH ranging from 7.2 to 7.6.
4. The antisense oligonucleotide or salt thereof of claim 3, wherein the antisense oligonucleotide or salt thereof comprises a chemically modified base, chemically modified sugar, chemically modified backbone or phosphate linkage, or any combination thereof relative to a naturally occurring base, sugar, backbone, or phosphate linkage, wherein the chemical modification is selected from the group consisting of: a ribose sugar, a deoxyribose sugar, a methyl group, a fluoro group, a methoxyethyl group, an ethyl group, a hydroxymethyl group, a formyl group, a bridged nucleic acid, a locked nucleic acid, a carboxylic acid or salt thereof, a phosphorothioate modified backbone, a methylphosphonate modified backbone, an amino-alkyl chain modification, and any combination thereof.
5. The antisense oligonucleotide or salt thereof of claim 4, wherein the first or the second RNA at least partially comprises an mRNA sequence.
6. The antisense oligonucleotide or salt thereof of claim 5, wherein the antisense oligonucleotide or salt thereof, when contacted with the mRNA sequence, produces at least about a 1.2-fold lower expression of a polypeptide encoded by the mRNA sequence, as compared to contacting an equivalent amount of the otherwise comparable ncRNA with the mRNA sequence; as determined by:
a) transfecting the antisense oligonucleotide or salt thereof into a first isolated mammalian cell comprising the mRNA sequence,
b) transfecting the otherwise comparable ncRNA into a second isolated mammalian cell comprising the mRNA sequence, and
c) measuring an amount of the polypeptide expressed in the first isolated mammalian cell and the second isolated mammalian cell, wherein the first isolated mammalian cell and the second isolated mammalian cell are of the same type of mammalian cell.
7. The antisense oligonucleotide or salt thereof of claim 5, wherein the antisense oligonucleotide or salt thereof, when contacted with the mRNA sequence, produces at least about a 1.2-fold lower activity of a polypeptide encoded by the mRNA sequence, as compared to contacting an equivalent amount of the otherwise comparable ncRNA with the mRNA sequence; as determined by:
a) transfecting the antisense oligonucleotide or salt thereof into a first isolated mammalian cell comprising the mRNA sequence,
b) transfecting the otherwise comparable ncRNA into a second isolated mammalian cell comprising the mRNA sequence, and
c) measuring an amount of activity from the polypeptide expressed in the first isolated mammalian cell and the second isolated mammalian cell, wherein the first isolated mammalian cell and the second isolated mammalian cell are of the same type of mammalian cell.
8. The antisense oligonucleotide or salt thereof of claim 6, wherein the antisense oligonucleotide or salt thereof when contacted with the mRNA sequence produces from about 1.2-fold to about 10-fold lower expression of the polypeptide encoded by the mRNA sequence, as compared to contacting the equivalent amount of the otherwise comparable ncRNA; as determined by:
a) transfecting the antisense oligonucleotide or salt thereof into the first isolated mammalian cell comprising the mRNA sequence,
b) transfecting the otherwise comparable ncRNA into the second isolated mammalian cell comprising the mRNA sequence, and
c) measuring the amount of the polypeptide expressed in the first isolated mammalian cell and the second isolated mammalian cell.
9. The antisense oligonucleotide or salt thereof of claim 7, wherein the antisense oligonucleotide or salt thereof when contacted with the mRNA sequence produces from about 1.2-fold to about 10-fold lower activity of the polypeptide encoded by the mRNA sequence, as compared to contacting the equivalent amount of the otherwise comparable ncRNA; as determined by:
a) transfecting the antisense oligonucleotide or salt thereof into the first isolated mammalian cell comprising the mRNA sequence,
b) transfecting the otherwise comparable ncRNA into the second isolated mammalian cell comprising the mRNA sequence, and
c) measuring the amount of activity from the polypeptide expressed in the first isolated mammalian cell and the second isolated mammalian cell.
10. The antisense oligonucleotide or salt thereof of claim 6, wherein the first isolated mammalian cell and second isolated mammalian cell is a human cell or a mouse cell.
11. The antisense oligonucleotide or salt thereof of claim 10, wherein the first isolated mammalian cell is the human cell, and wherein the human cell is a fibroblast, a leukocyte, a myoblast, a muscle cell.
12. The antisense oligonucleotide or salt thereof of claim 1, wherein the disease or condition comprises a neuromuscular disorder including a muscular dystrophy or a myopathy.
13. The antisense oligonucleotide or salt thereof of claim 12, wherein the disease or condition is a Duchenne's muscular dystrophy (DMD), Myotonic Dystrophy (MD), Facioscapulohumeral muscular dystrophy (FSHD), Limb-Girdle muscular dystrophy (LGMD), Becker muscular dystrophy, Oculopharyngeal muscular dystrophy, Emery-Dreifuss muscular dystrophy, or Distal muscular dystrophy.
14. The antisense oligonucleotide or salt thereof of claim 12, wherein the muscular dystrophy is caused by an inherited or spontaneous autosomal dominant mutation.
15. A nucleic acid construct comprising: (a) a first strand comprising the antisense oligonucleotide or salt thereof of claim 4 and (b) a second strand comprising an passenger oligonucleotide or salt thereof with a sequence complementary to at least a portion of the first strand.
16. A pharmaceutical composition comprising the antisense oligonucleotide or salt thereof of claim 4 and a pharmaceutically acceptable excipient, diluent, or carrier.
17. A kit that comprises the pharmaceutical composition of claim 16 in a container.
18. The antisense oligonucleotide or salt thereof of claim 12, wherein the disease or condition is a Facioscapulohumeral muscular dystrophy (FSHD).
19. The antisense oligonucleotide or salt thereof of claim 1, wherein when the antisense oligonucleotide comprises a sequence of SEQ ID No. 919, the nucleobase at a 5′ terminus of the antisense oligonucleotide or salt thereof is a G.
20. The antisense oligonucleotide or salt thereof of claim 1, wherein the antisense oligonucleotide or salt thereof is 5 to 50 nucleotides in length.
21. The antisense oligonucleotide or salt thereof of claim 1, wherein the antisense oligonucleotide or salt thereof is 5 to 30 nucleotides in length.
22. The antisense oligonucleotide or salt thereof of claim 1, wherein the antisense oligonucleotide or salt thereof comprises a covalent linker conjugated to an antibody.
23. The antisense oligonucleotide or salt thereof of claim 1, comprising one of the following chemical modification patterns:
Guide Pattern 1: (N)a(mN)b(N)cNN;
Guide Pattern 2: (N)a(mN)b(N)csfNsmN; or
Guide Pattern 3: (fNmN)h(mN)i(fNmN)jsfNsmN,
wherein:
N is any natural or non-natural nucleotide; mN is a 2′-O-methyl-modified uracil, guanine, adenine, or cytosine; s is a phosphorothioate-modified backbone; fN is a 2′fluoro-modified uracil, guanine, adenine, or cytosine; a is an integer from 8-10; b is an integer from 7-10; c is an integer from 2-4; h is an integer from 5-7; i is an integer of 0 or 1; j is an integer of 3 or 4; and k is an integer from 12-19.
24. The antisense oligonucleotide or salt thereof of claim 22, wherein the covalent linker is a cleavable linker.
Claim 2, 3, 5, 11, 15, 23, 30, 69, 76, 100, 103, 106, 119, 120-123 are provisionally rejected on the grounds of nonstatutory double patenting as being unpatentable over claims 1-43 of co-pending Application No. 18/411650 (reference application).
Although the claims at issue are not identical, they are not patentably distinct from each other because the co-pending claims anticipate the instant claims.
Regarding instant claims, the copending claims teach the bispecific oligonucleotide targeting different RNA from at least two genetic loci, see reference claims 1 and 35-37.
Regarding the instant claim 100 predicted Gibbs free energy(AG) of binding of the engineered oligonucleotide, Examiner notes the optimization of doses/concentrations (i.e., 10% of the EV population containing mRNA) would have been prima facie obvious to one of ordinary skill in the art at the time of filing: “[W[here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. “ In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955) (see MPEP 2144.05). As set forth at MPEP 2144.05 II. A: “Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical.”
The copending claims teach:1. An engineered DUX4-targeting oligonucleotide that is from about 15 to about 25 nucleotides in length, wherein the engineered DUX4-targeting oligonucleotide comprises at least about: 80%, 85%, 90%, or 95% sequence identity to any one of SEQ. ID. NOs: 20,962-42,138.
2. The engineered DUX4-targeting oligonucleotide of claim 1, that is from about 15 to about 25 nucleotides in length, wherein the engineered DUX4-targeting oligonucleotide comprises at least about 80%, 85%, 90%, or 95% sequence identity to any one of SEQ. ID. NOs: 42,006-42,138.
3. The engineered DUX4-targeting oligonucleotide of claim 1, that is complementary to a binding site in a DUX4 RNA that is greater than 85% conserved among individuals.
4. The engineered DUX4-targeting oligonucleotide of claim 2, wherein the engineered DUX4-targeting oligonucleotide comprises a DNA nucleotide and an RNA nucleotide.
5. The engineered DUX4-targeting oligonucleotide of claim 1, wherein the oligonucleotide comprises a DNA nucleotide, and/or an RNA nucleotide, optionally wherein the engineered DUX4-targeting oligonucleotide is small interfering RNA (siRNA), a MicroRNA (miRNA), a small nuclear RNA (snRNA), a U spliceosomal RNA (U-RNA), a Small nucleolar RNA (snoRNA), a Piwi-interacting RNA (piRNA), a repeat associated small interfering RNA (rasiRNA), a small rDNA-derived RNA (srRNA), a transfer RNA derived small RNA (tsRNA), a ribosomal RNA derived small RNA (rsRNA), a large non-coding RNA derived small RNA (lncsRNA), or a messenger RNA derived small RNA (msRNA) an antisense oligonucleotide (ASO), a gapmer, a mixmer, double-stranded RNAs (dsRNA), single stranded RNAi, (ssRNAi), DNA-directed RNA interference (ddRNAi), an RNA activating oligonucleotide (RNAa), or an exon skipping oligonucleotide.
8. The engineered DUX4-targeting oligonucleotide of claim 1, wherein the engineered DUX4-targeting oligonucleotide comprises at least one nucleobase selected from the list consisting of a locked nucleic acid nucleobase, a 2′Omethyl nucleobase, or a 2′Methoxyethyl nucleobase.
9. The engineered DUX4-targeting oligonucleotide of claim 2, which binds to the DUX4 coding sequence in an aqueous solution with a predicted melting temperature (Tm) from about 45 to about 65 degrees Celsius wherein the aqueous solution has a pH ranging of from about 7.2 to about 7.6.
10. A conjugate comprising i) the engineered DUX4-targeting oligonucleotide of claim 1; ii) an antibody, an antibody fragment, a single monomeric variable antibody domain, a naturally occurring ligand, a small molecule, or a peptide; and optionally iii) a linker that links i) to ii).
11. A vector containing or encoding the engineered DUX4-targeting oligonucleotide of claim 1.
17. A pharmaceutical composition comprising the engineered DUX4-targeting oligonucleotide of claim 1, and a pharmaceutically acceptable: excipient, diluent, carrier, or a combination thereof.
21. A kit comprising the engineered DUX4-targeting oligonucleotide of claim 1.
23. A method of treating a disease or condition in a subject comprising administering to the subject a therapeutically effective amount the pharmaceutical composition of claim 17.
24. The method of claim 23, wherein the disease or condition is a DUX4 mediated disease or condition, optionally wherein the DUX4 mediated disease or condition is facioscapulohumeral muscular dystrophy.
34. The method of claim 23, further comprising concurrently or consecutively administering a co-therapy.
35. A method comprising administering the engineered DUX-4 targeting oligonucleotide of claim 1 to a subject, wherein after the administering, the engineered DUX-4 targeting oligonucleotide selectively hybridizes to two different endogenous disease related RNAs wherein one of the two different endogenous disease related RNAs is a DUX4 RNA transcribed from a first genetic loci and one of the two different endogenous disease related RNAs is transcribed from a different genetic loci than the first genetic loci.
36. The method of claim 35, wherein the second of the two different endogenous disease related RNAs is selected from SEQ ID NOs: 42139-42894
37. The method of claim 35, wherein the engineered DUX4-targeting oligonucleotide hybridizes to the endogenous disease related RNA that is transcribed from a different genetic loci than the first genetic loci, such that upon hybridization there are no more than 4 mismatches, bulges, insertions or deletions in the binding site, and the resulting duplex contains two regions of complementarity at least 7 contiguous nucleobases long, or one region at least 10 contiguous nucleobases long.
38. The method of claim 35, wherein the method is a method of treating a disease or condition which is a DUX4 mediated disease or condition, optionally wherein the DUX4 mediated disease or condition is facioscapulohumeral muscular dystrophy.
40. The engineered DUX4-targeting oligonucleotide of claim 8, wherein upon hybridization between the engineered DUX4-targeting oligonucleotide and the second RNA, the predicted thermal melting point is about 40 degrees Celsius to about 65 degrees Celsius.
43. A method of treating a disease or condition in a subject comprising administering to the subject a therapeutically effective amount the conjugate of claim 10.
This is a provisional rejection because the copending claims have not yet been patented.
Related Prior Art
Examiner notes Van Deutekom et. al, teaches bispecific antisense oligonucleotide therapy for treatment of neuromuscular disease. Van Deutekom teaches splice-switching compounds with improved characteristics that enhance clinical applicability for treating, ameliorating, preventing, and/or delaying neuromuscular disorders, more specifically DMD (abstract; Van Deutekom, US12331293B2, priority to 2019). Van Deutekom teaches a compound comprising a first and a second antisense oligonucleotide (AON) linked to each other by a linking moiety, wherein said first antisense oligonucleotide (AON) consists of the base sequence of SEQ ID NO: 14, and wherein said second antisense oligonucleotide (AON) consists of the base sequence of SEQ ID NO: 198, wherein sequences complementary to SEQ ID NO: 14 and 198 are located within exon 51 of dystrophin pre-mRNA (claim 1).
Conclusion
Claims 2, 3, 5, 11, 15, 23, 30, 69, 76, 100, 103, 106, 119, 120-123 are rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOHN CHARLES MCKILLOP whose telephone number is (703)756-1089. The examiner can normally be reached Mon-Fri 8:30-5:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner' s supervisor, Jennifer Dunston can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is (571) 273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JOHN CHARLES MCKILLOP/Examiner, Art Unit 1637
/EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637