Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
1. Applicant’s election with traverse of group I in the reply filed on September 09, 2025 is acknowledged. The traversal is based on examining all method claims and kit claims as one group and the claims are not directed to detection of methylation markers. The arguments were found unpersuasive. The claims as presented require detecting one or more regions of chromosomal DNA by labeling unmodified CG sites and measuring the level of labeled CG-containing region or hmCG (hydroxymethylated CG) sites which is within the scope of detecting methylated and unmethylated cytosines or hydroxymethylated CG sites in a cfDNA sample. The lack of unity is based on the prior art references provided in the International search report, which indicates that the technical feature labeling the CG sites is not a special technical feature that links all the groups together. Thus, the lack of unity deemed proper. The election of a species and a primer pair with traverse is acknowledged. The Applicant’s argue that the claim 12 is amended to remove species and the requirement of species election should be withdrawn. The arguments were found unpersuasive because the requirement of species election is based on all the claims and dependent claims recite species. As indicated in the office action each species represents separate regions on chromosomal DNA and all the species are not linked to the same sequence and each sequence region has different structure and function. Thus, the requirement to the election of species is deemed proper.
Status of the Application
2. Claims 12-20, 24-25 and 28-29 are considered along with the elected species (u-CG-DLR Chr21: 34672959 and elected pair of primers (SEQ ID No: 7 and 8) are considered for examination. Claims 21-23, 26-27 and nonelected species and seq ID Nos. are withdrawn from further consideration as being drawn to nonelected group.
Priority
3. This application filed on September 30, 2022 is a 371 of PCT/IB2020/053011 filed on March 30, 2020.
Nucleotide and/or Amino Acid Sequence Disclosures
4. This application contains sequence disclosures that are encompassed by the definitions for nucleotide and amino acid set forth in 37CFR 1.821(a)(1) and (a)(2). However, this application fails to comply the requirements of 37 CFR 1.821 through 1.825. Nucleotide and/or amino acid sequences appearing in the specification (para 0082, 0113) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Further, Examiner notes that the sequence listing or CRF do not contain the sequences listed in the above paragraphs.
Claim Rejections - 35 USC § 112
5. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION —The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
A. Claims 16 and 28-29 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The claims 16, 28 recite ‘region shown in Tables 4, 5 and 6’. The limitations ‘region shown in tables 4, 5 and 6’ are unclear and indefinite because it is not clear what regions the tables are referring to.
B. Claims 12-20, 24-25 and 28-29 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 12 recites the limitation "said labels" in step (a) of the claim. There is insufficient antecedent basis for this limitation in the claim. The limitations, said labels, lack support in the preceding lines of step(a) and it is not clear if the limitations are referring to what the limitations are referring to M.Sssl and beta-glucosyltransferse enzymes as labels or do they refer to any other labels.
Claim Rejections - 35 USC § 102
6. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 12-15, 17-19 and 24 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Song (WO 2017/176630).
Note: the phrase recited in claim 12 ‘which are differentially modified between a DNA sample and a peripheral blood DNA sample of a pregnant female, or between non-pregnant female peripheral DNA sample and DNA sample of placental origin) is considered as an intended use and the method of claim 12 does not require performing the method using said limitations.
Song teaches a method of claim 12, wherein the method comprising: a) enzymatic covalent labeling of nucleic acid molecules of the sample of isolated cfDNA at unmodified CG, uCG, sites with hydroxymethylated CG, hmCG, sites with beta-glucosyltransferase and derivatization of said labels with DNA oligonucleotide (capture tag) (page 1, line 24 to line 8 on page 2, page 26 line 23 to line 5 on page 29, page 15, line 8 to line 29 on page 17),
b) measuring the level of the labeled CG-containing regions of the sample of isolated cfDNA at one or more regions (one or more loci) of chromosomal DNA from the human genome (page 2, line 3-6, page 26 line 23 to line 5 on page 29, page 15, line 8 to line 29 on page 17, page 20, line 24-34);
c) comparing or correlating the measured level of the labeled CG-containing regions of step b) to a standard reference value of at least one said regions (page 2, line 3-6, page 26 line 23 to line 33 on page 31, page 15, line 8 to line 29 on page 17, page 20, line 24-34, page 19, line 3-30).
With reference to claims 13-14, Song et al. teach diagnosing a trisomy or gender based on said comparison of step c), comparable to the standard reference value from a female bearing a fetus with trisomy 21 (down’s syndrome) (page 25, line 33 to line 14 on page 27).
With reference to Claims 15, 19, 24, Song et al. teach that the levels of the labeled CG- containing regions in the sample of isolated cfDNA are measured by real-time quantitative polymerase chain reaction (qPCR) (page 27, line 10-14).
With reference to claims 17-18, Song et al teach that the method further comprising producing nucleic acid molecules from the labeled CG-containing regions using a nucleic acid polymerase which contacts the labeled nucleic acid sequence at or around the site of the labeled uCG or hmCG; wherein polymerization starts from the 3'-end of an oligonucleotide primer non-covalently attached to the ODN of the labeled CG-containing region of the sample of isolated cfDNA; for further amplification of labeled CG-containing regions of the sample of isolated cfDNA, an oligonucleotide primer non-covalently attached to the ODN and yet another oligonucleotide primer that binds to the one strand of an adapter sequence attached to the labeled CG-containing regions through ligation-mediated PCR are used to obtain a sample enriched in unmodified or hydroxymethylated DNA (page 17, line 10 to line 29). For all the above the claims are anticipated.
Claim Rejections - 35 USC § 103
6. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 12-20, 24-25 and 28-29 are rejected under 35 U.S.C. 103 as being unpatentable over Song et al. (WO 2017/176630) in view of Cox et al. (US 2006 /0188875) and Lowe et al. (Nucleic Acids Research, Vol. 18, No. 7, page 1757-1761, 1990).
Song et al. teach a method of claim 12, However, Song et al. did not teach region u-CG-DLR chr21:34672959 and primer sequences of SEQ ID No: 7 and 8 to amplify said region.
Cox et al. teach a method for detecting single nucleotide polymorphism sites in nucleic acid segments or regions of chromosome 21, wherein a nucleic acid segment of chromosome 21 comprises the region of u-CG-DLR chr21:34672959 and primers to amplify said region, wherein the nucleic acid region comprises the primer sequences of Seq ID No: 7 and 8 (para 0013, 0001-0006, 0031-0048-indicating SNP sequences in dbSNP.txt comprising said region and see sequence alignment of primer sequences of SEQ ID NO: 7 and 8).
Sequence alignment for seq ID NO: 7
Sequence 26064, US/10284444; Publication No. US20060188875A1
GENERAL INFORMATION
APPLICANT: Cox, David; Patil, Nila; Berno, Anthony; Hinds, David
TITLE OF INVENTION: Human Genomic Polymorphisms;
CURRENT APPLICATION NUMBER: US/10/284,444; CURRENT FILING DATE: 2002-10-31; PRIOR APPLICATION NUMBER: US 10/166,341; PRIOR FILING DATE: 2001-09-18; NUMBER OF SEQ ID NOS: 37858;
SEQ ID NO 26064; LENGTH: 201; TYPE: DNA; ORGANISM: Homo sapiens; Query Match 100.0%; Score 26; Length 201; Best Local Similarity 100.0%; Matches 26; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TAGAAATCTTTAGGAGGTGGTGAATG 26
||||||||||||||||||||||||||
Db 106 TAGAAATCTTTAGGAGGTGGTGAATG 131
Sequence alignment for SEQ ID NO: 8
SEQ ID NO 26064; LENGTH: 201; TYPE: DNA; ORGANISM: Homo sapiens
Query Match 100.0%; Score 19; Length 201; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CATGGTGGAAGAGATGGGC 19
|||||||||||||||||||
Db 178 CATGGTGGAAGAGATGGGC 160
Lowe et al. teach a method for designing primers and evaluating their performance wherein Lowe et al. disclose a computer program for rapid selection of oligonucleotide primers for polymerase chain reaction, wherein the length of the primers designed to have 18 to 22 nucleotides or (paragraphs under subheading ‘computer program’ on page 1757-1758, abstract). Lowe et al. teach that all primers designed for over 10 gene products were experimentally tested and the results showed that all the amplification products specified by the primers are of the predicted size and also hybridize with the appropriate cDNA or internal oligonucleotide probe (see page 1759-1760, col. 2, paragraph 1, table 1).
It would be prima facie obvious to an ordinary person skilled in the art before the effective filing date of the invention to modify the method of Song et al. with a SNP region of chromosome 21 as taught by Cox et al. and designing a primer pair to amplify a nucleic acid region as taught by Lowe et al. to develop an improved method for detecting single nucleotide polymorphic regions or segments in chromosome 21. The ordinary person skilled in the art would have motivated to combine the method of Song et al. with a SNP region on Chromosome 21 as taught by Cox et al. and have a reasonable expectation of success because Cox et al. explicitly taught the SNP comprising regions or segments of chromosome 21 and detecting SNP variations in human to detect the haplotype pattern of chromosome 21 (para 0013) and such a modification is considered obvious over the cited prior art. Further it would be obvious to modify the method of Song et al. and Cox et al. with a method to design primers/ probes from the known sequence as taught by Lowe et al. to improve the specificity of primers for detecting target nucleic acid in a sample. The ordinary person skilled in the art would have motivated to generate primers and probes from the known sequence as taught by Lowe et al. and have a reasonable expectation of success that such primers/ probe generated using known sequence as taught by Cox et al. would detect target nucleic acid. The claimed primers/probe are functional equivalents of the polynucleotide sequence taught by Cox et al. in view of Lowe et al. because Lowe et al. explicitly taught that the primers/probe generated from a known sequence using a computer program would specifically amplify the target sequence and all primers designed for over 10 gene products from known sequences were experimentally tested and the results showed that all the amplification products specified by the primers are of the predicted size also hybridizes with the appropriate cDNA or internal oligonucleotide probe (see page 1760, col. 2, paragraph 1) and such a
modification of the known sequences is considered obvious over the prior art. As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim such as oligomer length and sequence, are disclosed in the prior art Song et al.; Cox et al. and Lowe et al.), it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the selection of hybridization conditions performed was other than routine, that the products resulting from the optimization have any
unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art and such a modification of the method is considered obvious over the cited prior art.
Claim Rejections - 35 USC § 101
6. 35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 12-20, 24-25 and 28-29 are rejected under 35 U.S.C. 101 because the claimed invention is directed to judicial exception without significantly more. The claim(s) recite a method comprising diagnosing a trisomy 21 and /or fetal gender, a process, statutory category. Claims 12-14 recite a
judicial exception (law of nature, natural phenomenon) because claims recite a
correlation of the level of the labeled CG-containing regions in a cfDNA to diagnose trisomy 21 and/or fetal gender, which is a law of nature or natural phenomenon that exits in nature. The claims do not include any additional elements that are sufficient to amount to significantly more than the judicial exception because the additional steps (labeling, hybridizing, amplifying, quantitating) which do not add significantly more to the claimed method. The additional steps are not themselves natural laws, but neither are they sufficient to transform the nature of the claims because they consist of well-understood, routine, conventional activity already engaged in by the scientific community. The additional steps consist of well-understood, routine, conventional activity already engaged in by the scientific community (Song et al. (WO 2017/176630); Cox et al. (US 2006/0188875)). The additional steps, when viewed as a whole, add nothing significant beyond the sum of their parts taken separately. The Court has made clear that to transform an unpatentable law of nature into a patent-eligible application of such a law, one must do more than simply state the law of nature while adding the words "apply it." Essentially, appending conventional steps specified at a high level of generality, to laws of nature, natural phenomena, and abstract ideas cannot make those laws, phenomena, and ideas patent-eligible. This judicial exception is not integrated into a practical application because the judicial exception is not markedly different from the natural phenomenon because the claims recite diagnosing trisomy 21 and/or fetal gender based on comparing the level of the labeled CG-containing regions with a reference value. It is noted that a judicial exception itself, cannot be considered to meet the criteria of "significantly more" than a judicial exception. The Courts decision
rested upon an examination of the particular claims in light of the Court's precedents, specifically Bilski, Flook and Diehr. The Court repeated the long standing exceptions (laws of nature, natural phenomena, and abstract ideas) to categories of patent eligibility defined in 35 U.S.C. § 101. In conducting the analysis, the Court addressed the "machine-or-transformation" test explained in Bilski with a reminder that the test is an "important and useful clue" to patentability but that it does not trump the "law of
nature" exclusion. A claim that recites a law of nature or natural correlation, with additional steps that involve well-understood, routine, conventional activity previously engaged in by researchers in the field is not patent-eligible, regardless of whether the steps result in a transformation. On the other hand, reaching back to Neilson, the Court pointed to an eligible process that included not only a law of nature (hot air promotes ignition) but also several unconventional steps involving a blast furnace) that confined
the claims to a particular, useful application of the principle. For all the above, the claims are rejected under 35 USC 101.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SURYAPRABHA CHUNDURU whose telephone number is (571)272-0783. The examiner can normally be reached 8.00am-4.30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Suryaprabha Chunduru
Primary Examiner
Art Unit 1681
/SURYAPRABHA CHUNDURU/Primary Examiner, Art Unit 1681