SARS COV-2 SPIKE PROTEIN CONSTRUCT

§103 §112

Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION 1. Applicant’s amendments/responses filed 10/13/22 and 7/2/26 are acknowledged and have been entered. 2. Applicant's election without traverse of Group I and the following species in Applicant’s amendment and response filed 7/2/26 is acknowledged: -a self-replicating molecule that corresponds to SEQ ID NO: 122 and that encodes the amino acid sequence corresponding to SEQ ID NO: 26; -the Gaussian Luciferase signal sequence shown in SEQ ID NO: 2; -elements of the replicon comprising in the following order: nsP1-nsP2, nsP3, nsP4, a subgenomic promoter, and the sequence; -with regard to claims 9 and 10, the RNA molecule encoding SEQ ID NO: 26 and further comprising a nucleic acid sequence corresponding to SEQ ID NO: 258 [that encodes the signal sequence SEQ ID NO: 2]; -a liposome carrier; and -the construct comprises a C-terminal T4 fibritin trimerization (foldon) motif. As such, Applicant has elected a self-replicating molecule (corresponding to SEQ ID NO: 122) that further comprises encoding sequence for the Gaussian Luciferase signal sequence shown in SEQ ID NO: 2 (and encoded by SEQ ID NO: 258). SEQ ID NO: 122 encodes SEQ ID NO: 26. SEQ ID NO: 26 is identical to instantly recited SEQ ID NO: 1 but for having GSAS 682-685 and 2P 986-987 amino acid substituents and a substitution of the transmembrane and cytosolic regions with a C-terminal T4 fibritin-trimerization(foldon) motif. SEQ ID NO: 26 comprises its own homologous signal sequence (see for example, sequence listing for SEQ ID NO: 26, Table 15, and Figure 35 at the first signal sequence). Claims 1, 7-10, 12, 15, 16, 18 and 22-24 read on the elected species. Claims 1, 18, 21 and 22 are independent claims. Please note that claim 2 and its dependent claims 3 and 4 recite that “the sequence further comprises another sequence encoding a heterologous signal sequence; wherein the heterologous signal sequence comprises a positive charge at its N terminus”. In molecular biology, the methionine at the N-terminus of the signal peptide is regarded both as the starter methionine and an integral part of the actual signal sequence. None of the signal sequences recited in claims 3 or 4 comprise a positive charge at the N-terminus, as is enunciated below in this office action. Also please note that a free NH2 group at the N-terminus of a peptide (on the first amino acid residue) is inherently electrically neutral, not positive. However, in the interest of compact prosecution, claims 2-4 are presently being included in examination. Upon consideration of the prior art, the species of biodegradable polymeric microparticle delivery system (dependent claim 13) and submicron cationic oil-in-water emulsion (dependent claim 14) are also being included in examination. Accordingly, claim 16 (non-elected species of Group I) and claims 11, 17 and 21 (non-elected Groups II-IV) are withdrawn from further consideration by the Examiner, 37 CFR 1.142(b), as being drawn to non-elected inventions. Claims 1-4, 7-10, 12-15, 18 and 22-24 are presently being examined as they read upon the elected species and the species enunciated below in this office action. Claims 1, 18 and 22 are independent claims. 3. The lengthy specification has not been checked to the extent necessary to determine the presence of all possible minor errors. Applicant’s cooperation is requested in correcting any errors of which Applicant may become aware in the specification. 4. Claim interpretation: The specification discloses “By “Coronavirus S antigen” is intended the amino acid sequence, or a nucleotide sequence encoding the amino acid sequence, of a wild-type Coronavirus S protein, variant, or fragment thereof. Unless indicated otherwise, descriptions of the wild-type-type S antigen are made by reference to residues 1-1273 encoded by the genome of 2019-nCoV S (GenBank: MN908947), as depicted in the SEQ ID NO: 11 (polypeptide)” (page at lines 13-17). However, SEQ ID NO: 11 in the instant sequence listing is the SSP signal sequence, whereas the said GenBank sequence appears to correspond to instantly recited SEQ ID NO: 1 (or to SEQ ID NO: 11 in 63/010,763 provisional application). Therefore, in the interest of compact prosecution, the term “Coronavirus S antigen” is being interpreted as being related to SEQ ID NO: 1 rather than to SEQ ID NO: 11. SEQ ID NO: 49 is identical to SEQ ID NO: 1 but for the GSAS 2P substituents recited in instant base claim 1 (i.e., GSAS 682-685 and 2P 986-987) and they are 99.6% identical. SEQ ID NO: 26 is 93.6% identical to SEQ ID NO: 1 and comprises the GSAS 682-685/2P986-987 amino acid substituents recited in instant base claim 1, along with a substitution of a T4 fibritin trimerization (foldon) motif for the transmembrane and cytoplasmic regions). SEQ ID NO: 26 and SEQ ID NO: 49 are identical up to residue 1208, while SEQ ID NO: 26 substitutes the transmembrane and cytosolic domains of SEQ ID NO: 49 with a C-terminal Tr fibritin trimerization (foldon) motif having the sequence shown in SEQ ID NO: 24. An amino acid sequence at least 99% identical to SEQ ID NO: 26 (1237 amino acid residues in length) must have at least 1225 amino acid residues identical, and 12 amino acid residues may be different. In the instance the sequence is 10 amino acids shorter than SEQ ID NO: 26, only 2 amino acid residues out of the 1215 amino acid residues may be different. An amino acid sequence at least 99% identical to SEQ ID NO: 49 (1273 amino acid residues in length) must have 1261 amino acid residues identical, and 12 amino acid residues may be different. In the instance that the sequence is 10 amino acids shorter than SEQ ID NO: 49, only 2 amino acid residues out of the 1263 amino acid residues may be different. 5. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 6. Claims 1-4, 7-10, 12-15, 18 and 22-24 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection. An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations using such descriptive means as words, structures, figures, diagrams, and formulas that fully set forth the claimed invention. Lockwood v. Amer. Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997). Possession may be shown in a variety of ways including description of an actual reduction to practice, or by showing that the invention was "ready for patenting" such as by the disclosure of drawings or structural chemical formulas that show that the invention was complete, or by describing distinguishing identifying characteristics sufficient to show that the applicant was in possession of the claimed invention. See, e.g., Pfaff v. Wells Elecs., Inc., 525 U.S. 55, 68, 119 S.Ct. 304, 312, 48 USPQ2d 1641, 1647 (1998); Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406; Amgen, Inc. v. Chugai Pharm., 927 F.2d 1200, 1206, 18 USPQ2d 1016, 1021 (Fed. Cir. 1991) (one must define a compound by "whatever characteristics sufficiently distinguish it"). "Compliance with the written description requirement is essentially a fact-based inquiry that will ‘necessarily vary depending on the nature of the invention claimed.' " Enzo Biochem, 323 F.3d at 963, 63 USPQ2d at 1612. An invention described solely in terms of a method of making and/or its function may lack written descriptive support where there is no described or art-recognized correlation between the disclosed function and the structure(s) responsible for the function. See MPEP 2163 I.A. An applicant may also show that an invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics which provide evidence that applicant was in possession of the claimed invention, i.e., complete or partial structure, other physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics. Enzo Biochem, 323 F.3d at 964, 63 USPQ2d at 1613 (quoting the Written Description Guidelines, 66 Fed. Reg. at 1106, n. 49, stating that "if the art has established a strong correlation between structure and function, one skilled in the art would be able to predict with a reasonable degree of confidence the structure of the claimed invention from a recitation of its function".). "Thus, the written description requirement may be satisfied through disclosure of function and minimal structure when there is a well-established correlation between structure and function." See MPEP 2163 II.3. Applicant has broadly claimed: A self-replicating RNA (srRNA) molecule comprising a sequence encoding a SARS-CoV-2 spike (S) antigen, or an immunogenic variant or fragment thereof, wherein the antigen comprises (i) proline substitutions at residues 986 and 987 relative to SEQ ID NO: 1 and (ii) GSAS (SEQ ID NO: 190) substitution at a furin cleavage site relative to residues 682-685 of SEQ ID NO: 1 (instant base claim 1), including in instant dependent claims 3 and 4, a variant of any one of the sequences (that are fully defined heterologous signal sequences) having 1-5 amino acid residue, deletions, insertions, or substitutions (claims 3 and 4), a heterologous signal sequence comprising a positive charge at its N terminus (claims 2-4), the self-replicating RNA molecule recited in claims 9 and 10, wherein the encoded sequence is at least 99% identical to SEQ ID NO: 26 and the same length as, or up to 10 amino acids shorter than SEQ ID NO: 26, or at least 99% identical to SEQ ID NO: 49 and the same length as or up to 10 amino acids shorter than SEQ ID NO: 149, the self-replicating RNA molecule recited in claim 23 which is at least 95% identical to SEQ ID NO: 122 or to SEQ ID NO: 125 and the same length or up to 30 nucleotides shorter than either sequence, and encoding an amino acid sequence at least 99% identical to SEQ ID NO: 26 or to SEQ ID NO: 49, respectively, and the same length as or up to 10 amino acids shorter than either sequence, and including the limitations recited in the dependent claims. The specification does not disclose a representative number of species of such immunogenic variant or fragment thereof nor a heterologous signal sequence comprising a positive charge at its N-terminus, nor sufficient relevant identifying characteristics in the form of structure or functional characteristics coupled with a known or disclosed correlation between structure and function. The specification discloses that “By “Coronavirus S antigen” is intended the amino acid sequence, or a nucleotide sequence encoding the amino acid sequence, of a wild-type Coronavirus S protein, variant, or fragment thereof. Unless indicated otherwise, descriptions of the wild-type-type S antigen are made by reference to residues 1-1273 encoded by the genome of 2019-nCoV S (GenBank: MN908947), as depicted in the SEQ ID NO: 11 (polypeptide)” (page at lines 13-17). (However, SEQ ID NO: 11 in the instant sequence listing is the SSP signal sequence, whereas the said GenBank sequence appears to correspond to instantly recited SEQ ID NO: 1 (or to SEQ ID NO: 11 in 63/010,763 provisional application), as is stated above in this office action.) Please note however, that the self-replicating RNA molecule encodes a SARS-CoV-2 spike (S) antigen protein or an immunogenic variant or fragment thereof that has substitutions relative to SEQ ID NO: 1 but may not be SEQ ID NO: 1. The specification does not disclose a limiting definition for the limitation “immunogenic variant” nor of a fragment thereof of such immunogenic variant. Therefore, the immunogenic variant/fragment thereof must comprise a sequence that is some variant of a SARS-CoV-2 spike protein that has the functional property of being immunogenic in some sense, either as pertains to specific portions of the said protein or to the protein as a whole. The specification does discuss immunogenic compositions for the induction of an immune response in a subject against Coronaviral infection (e.g., page 11 at lines 29-32, page 35 at lines 23-32). The specification discloses that an immunogenic fragment is an epitope-containing fragment (page 12 at lines 21-27). The specification discloses that an antigen is a molecule containing one or more epitopes (such as linear, conformational, or both) that will stimulate a host’s immune system to make a humoral and/or cellular antigen-specific immune response (i.e., an immune response which specifically recognizes a naturally occurring polypeptide) (page 12 at lines 2-31). The specification discloses that an epitope is that portion of an antigen that determines its immunological specificity (page 12 at lines 31-32). The specification discloses that a “variant” of a polypeptide sequence includes amino acid sequences having one or more amino acid substitutions and/or deletions when compared to the reference sequence (pages 12 at lines 14-16). The specification does not disclose variants of the heterologous signal sequences recited in claims 3 and 4 that comprise up to 5 amino acid residue deletions, insertions, or substitutions, nor ones comprising a positive charge at the N-terminus (claim 2). The specification does not disclose a structure/function relationship for the portion(s) of a wild-type SARS-CoV-2 spike antigen that may be changed and what it may be changed to in order for the antigen to comprise linear or conformational epitopes that confer the functional property of being an “immunological variant or fragment thereof”. The specification discloses that T and B cell epitopes can be identified empirically or can be predicted (paragraph spanning pages 12-13); however, they must still be verified experimentally in vitro and/or in vivo. The specification discloses that a “signal sequence” refers to a short (usually less than 60 amino acids) amino acid sequence present on precursor proteins (typically at the N terminus), and which is typically absent from the mature protein. The specification further discloses that the signal peptide possesses the functional property of directing the transport and/or secretion of the translated protein through the membrane, with a heterologous signal sequence indicating a signal sequence that originates from a different species than the antigen (page 16 at lines 8-15). With regard to claims 9, 10 and 23, these said claims all depend upon instant base claim 1. Instant base claim 1 recites that the self-replicating RNA molecule encodes a SARS-CoV-2 spike antigen or an immunogenic variant or fragment thereof. As is stated above, the instant specification discloses that the definition of a SARS-CoV-2 spike antigen is the amino acid sequence, or a nucleotide sequence encoding the amino acid sequence, of a wild-type Coronavirus S protein, variant, or fragment thereof; thus variants that are not natural variants are encompassed by the said definition. It is clear that that definition of the self-replicating RNA molecule with regard to variants of SEQ ID NO: 26, SEQ ID NO: 49, SEQ ID NO: 122 or SEQ ID NO: 145 is broader than just natural variants (this is relevant to the lack of an adequate number of representative species). Although one of skill in the art could envision sequences that are within the recited percentages of identity, one of skill in the art could not readily envision which of those sequences possess the functional property of being a SARS-CoV-2 spike antigen, i.e., one that is reactive with an immune cell or antibody (the definition of an antigen), or of being an immunogenic variant of a SARS-CoV-2 spike antigen, i.e., one that possesses the functional property of eliciting an immune response to the spike protein. One of skill in the art could not readily envision which variants having the recited degree of identity are those that comprise one or more linear and/or conformational epitopes that possess the functional property of stimulating a host’s immune system to make a humoral and/or cellular antigen-specific immune response against a naturally occurring polypeptide (this is relevant to the lack of a structure/function relationship). As stated above: The specification discloses that an immunogenic fragment is an epitope-containing fragment (page 12 at lines 21-27). The specification discloses that an antigen is a molecule containing one or more epitopes (such as linear, conformational, or both) that will stimulate a host’s immune system to make a humoral and/or cellular antigen-specific immune response (i.e., an immune response which specifically recognizes a naturally occurring polypeptide) (page 12 at lines 2-31). The specification discloses that an epitope is that portion of an antigen that determines its immunological specificity (page 12 at lines 31-32). Therefore, it appears that the instant specification does not adequately disclose the breadth of the immunogenic variant or fragment thereof of the antigen, nor of the heterologous signal sequence variant, that is encoded by the srRNA molecule recited in the instant claims. In light of this, a skilled artisan would reasonably conclude that Applicant was not in possession of the genus of all such immunogenic variant or fragment thereof or heterologous signal sequence variant, and hence not in possession of the encoding srRNA molecule/composition thereof at the time the instant application was filed. 7. Claims 9 and 10 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. “To be enabling, the specification of a patent must teach those skilled in the art how to make and use the full scope of the claimed invention without ‘undue experimentation.’” Genentech, Inc. v. Novo Nordisk, A/S, 108F.3d 1361, 1365, 42 USPQ2d 1001, 1004 (Fed. Cir. 1997) (quoting In re Wright, 999F2d 1557, 1561, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993)). In In re Wands 8 USPQ2d 1400 (CAFC 1988), a number of factors are set forth which a court may consider in determining whether a disclosure would require undue experimentation. These factors were set forth as follows: (1) the quantity of experimentation necessary, (2) the amount of direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of those in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claims. All the factors need not be reviewed when determining whether a disclosure is enabling. Amgen, Inc. v. Chugai Pharm. Co., Ltd., 927F2.d 1200, 1213, 18 USPQ2d 1016, 1027 (Fed. Cir. 1991) (noting that the Wands factors “are illustrative, not mandatory. What is relevant depends upon the facts.”). The specification does not disclose how to make and use the instant invention, A self-replicating RNA molecule of claim 1 comprising from 5’ to 3’, the sequence comprising SEQ ID NO: 172, a construct encoding: (i) a signal sequence selected from the group consisting of SEQ ID NO: 258-268 and (ii) a first amino acid sequence that is at least 99% identical to SEQ ID NO: 26 or to SEQ ID NO: 49 and in either instance is the same length as, or up to 10 amino acid residues shorter than the said SEQ ID NO, and a sequence having SEQ ID NO: 173. The specification has not enabled the breadth of the claimed invention because the claims encompass a self-replicating RNA (srRNA) molecule that encodes a fusion protein that has both a defined heterologous signal sequence and an endogenous signal sequence, wherein it is unpredictable that the claimed self-replicating RNA molecule can be used for its disclosed purpose. The state of the art is such that it is unpredictable in the absence of appropriate evidence whether the claimed compositions can be made and/or used. It is unpredictable, except for the heterologous signal sequences recited in the absence of the endogenous signal sequence or in the working examples disclosed in Figure 35 and Table 15 (that have part or all of the endogenous signal sequence replaced with the specifically recited heterologous signal sequences) that the claimed srRNA molecule can be made and/or used. The encoded protein comprises an amino acid sequence at least 99% identical to SEQ ID NO: 26 or to SEQ ID NO: 49 that each comprise an endogenous SARS-CoV-2 signal sequence, and in either instance is the same length as, or up to 10 amino acids shorter than the said sequence. As such, the claims encompass embodiments of srRNA molecules wherein the srRNA comprises encoding regions for both an endogenous SARS-CoV-2 signal sequence that is present in both SEQ ID NO: 26 or SEQ ID NO: 49 and the heterologous signal sequence recited at part (i) of claim 9. The specification discloses working examples of constructs having encoding nucleic acid sequences for heterologous signal sequences that are 18 to 24 amino acid residues in length depending upon the particular signal sequence and that replace either the first 16 or the first 18 amino acid residues of the (same) endogenous SARS-CoV-2 signal sequence found in either of SEQ ID NO: 26, 49, or 1 with a heterologous signal sequence that is recited in the claims (e.g., see sequence listing, Figure 35 and Table 15). The specification does not disclose any constructs that encode more than one signal sequence (i.e., the endogenous and heterologous signal sequences). The art establishes that in some instances, multiple signal sequences can span the cell membrane several times ((e.g., evidentiary reference Lipp et al. (JCB, 1989, 109: 2013-2022)). In contrast the spike (S) protein of SARs-CoV-22 is a single pass type I transmembrane protein that spans the viral membrane only once ((e.g., evidentiary reference Zhang et al. (Curr. Opin. Virol., 2021, 50: 173-182)). In addition, ambiguous or competing signal sequences can route a single translation product to more than one intracellular destination thereby affecting function and expression (e.g., evidentiary reference Venuto and de Marco (Cell. Biochem., 2013, 114: 510-513)). There is insufficient guidance in the specification as to how to make and/or use the instant invention. Undue experimentation would be required of one skilled in the art to practice the instant invention. See In re Wands 8 USPQ2d 1400 (CAFC 1988). 8. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 9. Claims 1-4, 7-10, 12-15, 18 and 22-24 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. a) Claims 3-4 recite the limitation of their (penultimate) base claim 2, i.e., “wherein the heterologous signal sequence comprises a positive charge at its N terminus”; however, none of the sequences recited in claims 3 or 4 have a positive charge at the N terminus (and as a side issue, only one of the recited sequences has a positive charge at the second position from the N-terminus) and so lack antecedent basis in their base claim. In molecular biology, the methionine at the N-terminus of the Gaussian luciferase signal peptide is regarded both as the starter methionine and an integral part of the actual signal sequence. In addition, a free NH2 group at the N-terminus of a peptide (on the first amino acid residue) is inherently electrically neutral, not positive. b) Claim 1 is indefinite in the recitation of “ or an immunogenic variant or fragment thereof” because it is not clear what is meant, i.e., if the fragment thereof pertains to the antigen or to the immunogenic variant. 10. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. 11. For the purpose of prior art rejections, the filing date of the instant claims 1, 7, 12- 15, 18, 22 and 24 is deemed to be the filing date of provisional application 63/010,763, i.e., 4/16/2020. For the purpose of prior art rejections, the filing date of instant claims 2-4, 8, 9, 10 and 23 is deemed to be the filing date of provisional application 63/029,813, i.e., 5/26/20, as provision application 63/010,763 does not support the claimed limitations of the instant application. Provisional application 63/010,763 does not provide support for a signal sequence or for the particular signal sequences recited in the instant claims, nor for sequence insertion into SEQ ID NO: 171 between positions 7561-7562, nor for instantly recited SEQ ID NO: 26 or a sequence at least 99% identical thereto including with the recited length limitations recited in instant claims 9 and 23), nor for a sequence at least 99% identical to instantly recited SEQ ID NO: 49 including with the length limitations recited in claim 23 (note that SEQ ID NO: 49 is identical to SEQ ID NO: 1, but for the GSAS-2P substituent amino acid residues being present in SEQ ID NO: 49), nor for SEQ ID NO: 122. 12. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 13. Claims 1, 7, 8, 12-15, 18, 22 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over US 11,253,587 in view of WO2018091540A1 (IDS reference), as evidenced by a comparison of instant SEQ ID NO: 49 with SEQ ID NO: 20 and 21 of the primary art reference (shown below). Independent claim 1 recites: A self-replicating RNA molecule comprising a sequence encoding a SARS-CoV-2 spike (S) antigen, or an immunogenic variant or fragment thereof, wherein the antigen comprises (i) proline substitutions at residues 986 and 987 relative to SEQ DI NO: 1 and (ii) a GSAS (SEQ ID NO: 190) substitution at a furin cleavage site relative to residues 682-685 of SEQ ID NO: 1. Claim 12 recites: A composition comprising an immunologically effective amount of the self-replicating RNA molecule of claim 1 and a pharmaceutically acceptable carrier. Independent claim 18 recites: A method of inducing an immune response against the antigen in a subject in need thereof, the method comprising administering to the subject an immunologically effective amount of the self-replicating RNA molecule of claim 1. Independent claim 22 recites: A method of inducing an immune response against the antigen in a subject in need thereof, the method comprising administering t the subject an immunologically effective amount of the self-replicating RNA molecule of claim 15. US 11,253,587 (that issued from application serial no. 17/218,148) discloses a vaccine composition for the treatment of Coronavirus, wherein the vaccine comprises VLPs comprising a nucleic acid sequence encoding the SARS-CoV-2 spike protein. The spike protein comprised in the vaccine of ‘587 is the nucleic acid (DNA) corresponding to SEQ ID NO: 20 or 21 of ‘587 which encode a protein identical to instantly recited SEQ ID NO: 49 (and SEQ ID NO: 49 is identical to instantly recited SEQ ID NO: 1 comprising GSAS 682-685 and 2P 986-987 amino acid residue substituents*). (US 11,253,587 has priority to 3/30/2020 for these said limitations). A comparison of instantly recited SEQ ID NO: 1 with the said GSAS/2P substituent amino acid residues with the art sequences is shown below. US 11,253,587 further discloses that coronaviruses are positive stranded RNA genome viruses. US 11,253,587 discloses that VLPs are produced by making a DNA expression construct, co-transfecting a proprietary cell line with the plasmids, culturing the cells in a bioreactor, harvesting the cells. US 11,253,587 discloses that the rapid spread of new variants and emergence of new variants has raised significant concerns regarding reinfection and the effectiveness of recently approved vaccines that were developed against the original strain of SEARS-CoV-2; as a result there is a need to develop new vaccines which induce strong immunity against the virus while being safe and easy to store and distribute (column 2 at lines 30-46). See entire reference, including background 1st paragraph, example 2, sequence listing. *Instantly recited SEQ ID NO: 49 is identical to instantly recited SEQ ID NO: 1 but for the GSAS 682-685 and 2P 986-987 amino acid substituents in SEQ ID NO: 49 relative to SEQ ID NO: 1). GenCore RESULT 1 US-17-218-148-21 Sequence 21, US/17218148 Patent No. 11253587 GENERAL INFORMATION APPLICANT: VARIATION BIOTECHNOLOGIES INC. TITLE OF INVENTION: VACCINE COMPOSITIONS FOR THE TREATMENT OF CORONAVIRUS FILE REFERENCE: 2007801-0145 CURRENT APPLICATION NUMBER: US/17/218,148 CURRENT FILING DATE: 2021-03-30 PRIOR APPLICATION NUMBER: 63/070,150 PRIOR FILING DATE: 2020-08-25 PRIOR APPLICATION NUMBER: 63/002,237 PRIOR FILING DATE: 2020-03-30 NUMBER OF SEQ ID NOS: 44 SEQ ID NO 21 LENGTH: 3822 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide Alignment Scores: Length: 3822 Score: 6726.00 Matches: 1273 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 Gaps: 0 US-17-918-676-1correct (1-1273) x US-17-218-148-21 (1-3822) Qy 1 MetPheValPheLeuValLeuLeuProLeuValSerSerGlnCysValAsnLeuThrThr 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGTTCGTGTTTCTGGTGCTGCTGCCTCTGGTGAGCTCCCAGTGCGTGAACCTGACCACA 60 Qy 21 ArgThrGlnLeuProProAlaTyrThrAsnSerPheThrArgGlyValTyrTyrProAsp 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 AGGACCCAGCTCCCCCCTGCCTATACCAATTCCTTCACAAGGGGCGTGTACTATCCAGAC 120 Qy 41 LysValPheArgSerSerValLeuHisSerThrGlnAspLeuPheLeuProPhePheSer 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 AAGGTGTTTCGCTCTAGCGTGCTGCACAGCACACAGGATCTGTTTCTGCCCTTCTTTTCC 180 Qy 61 AsnValThrTrpPheHisAlaIleHisValSerGlyThrAsnGlyThrLysArgPheAsp 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AACGTGACCTGGTTCCACGCCATCCATGTGAGCGGCACCAATGGCACAAAGAGGTTCGAC 240 Qy 81 AsnProValLeuProPheAsnAspGlyValTyrPheAlaSerThrGluLysSerAsnIle 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AATCCTGTGCTGCCCTTCAACGATGGCGTGTACTTCGCCTCTACCGAGAAGAGCAACATC 300 Qy 101 IleArgGlyTrpIlePheGlyThrThrLeuAspSerLysThrGlnSerLeuLeuIleVal 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 ATCCGCGGCTGGATCTTTGGCACCACACTGGACTCCAAGACACAGTCTCTGCTGATCGTG 360 Qy 121 AsnAsnAlaThrAsnValValIleLysValCysGluPheGlnPheCysAsnAspProPhe 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 AACAATGCCACCAACGTGGTCATCAAGGTGTGCGAGTTCCAGTTTTGTAATGATCCTTTC 420 Qy 141 LeuGlyValTyrTyrHisLysAsnAsnLysSerTrpMetGluSerGluPheArgValTyr 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CTGGGCGTGTACTATCACAAGAACAATAAGAGCTGGATGGAGTCCGAGTTTCGCGTGTAT 480 Qy 161 SerSerAlaAsnAsnCysThrPheGluTyrValSerGlnProPheLeuMetAspLeuGlu 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TCCTCTGCCAACAATTGCACATTTGAGTACGTGTCCCAGCCATTCCTGATGGACCTGGAG 540 Qy 181 GlyLysGlnGlyAsnPheLysAsnLeuArgGluPheValPheLysAsnIleAspGlyTyr 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GGCAAGCAGGGCAATTTCAAGAACCTGCGGGAGTTCGTGTTTAAGAATATCGATGGCTAC 600 Qy 201 PheLysIleTyrSerLysHisThrProIleAsnLeuValArgAspLeuProGlnGlyPhe 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTCAAGATCTACAGCAAGCACACCCCTATCAACCTGGTGAGAGACCTGCCACAGGGCTTC 660 Qy 221 SerAlaLeuGluProLeuValAspLeuProIleGlyIleAsnIleThrArgPheGlnThr 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TCCGCCCTGGAGCCTCTGGTGGATCTGCCAATCGGCATCAACATCACCAGGTTTCAGACA 720 Qy 241 LeuLeuAlaLeuHisArgSerTyrLeuThrProGlyAspSerSerSerGlyTrpThrAla 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CTGCTGGCCCTGCACCGCAGCTACCTGACACCTGGCGACAGCTCCTCTGGATGGACCGCC 780 Qy 261 GlyAlaAlaAlaTyrTyrValGlyTyrLeuGlnProArgThrPheLeuLeuLysTyrAsn 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GGGGCCGCCGCCTACTATGTGGGCTATCTGCAGCCACGGACCTTCCTGCTGAAGTACAAC 840 Qy 281 GluAsnGlyThrIleThrAspAlaValAspCysAlaLeuAspProLeuSerGluThrLys 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GAGAATGGCACCATCACAGACGCAGTGGATTGCGCCCTGGACCCCCTGTCCGAGACCAAG 900 Qy 301 CysThrLeuLysSerPheThrValGluLysGlyIleTyrGlnThrSerAsnPheArgVal 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TGTACACTGAAGTCTTTTACCGTGGAGAAGGGCATCTATCAGACATCTAATTTCCGGGTG 960 Qy 321 GlnProThrGluSerIleValArgPheProAsnIleThrAsnLeuCysProPheGlyGlu 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CAGCCCACCGAGAGCATCGTGAGATTTCCAAATATCACAAACCTGTGCCCCTTTGGCGAG 1020 Qy 341 ValPheAsnAlaThrArgPheAlaSerValTyrAlaTrpAsnArgLysArgIleSerAsn 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GTGTTCAACGCCACCAGATTCGCCAGCGTGTACGCCTGGAATCGGAAGAGAATCAGCAAC 1080 Qy 361 CysValAlaAspTyrSerValLeuTyrAsnSerAlaSerPheSerThrPheLysCysTyr 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TGCGTGGCCGACTATTCCGTGCTGTACAACTCTGCCAGCTTCTCCACCTTTAAGTGCTAT 1140 Qy 381 GlyValSerProThrLysLeuAsnAspLeuCysPheThrAsnValTyrAlaAspSerPhe 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GGCGTGTCTCCCACAAAGCTGAATGACCTGTGCTTTACCAACGTGTACGCCGATAGCTTC 1200 Qy 401 ValIleArgGlyAspGluValArgGlnIleAlaProGlyGlnThrGlyLysIleAlaAsp 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 GTGATCAGGGGCGACGAGGTGAGACAGATCGCACCAGGCCAGACAGGCAAGATCGCCGAC 1260 Qy 421 TyrAsnTyrLysLeuProAspAspPheThrGlyCysValIleAlaTrpAsnSerAsnAsn 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 TACAATTATAAGCTGCCCGACGATTTCACCGGCTGCGTGATCGCCTGGAACAGCAACAAT 1320 Qy 441 LeuAspSerLysValGlyGlyAsnTyrAsnTyrLeuTyrArgLeuPheArgLysSerAsn 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CTGGATTCCAAAGTGGGCGGCAACTACAATTATCTGTACAGGCTGTTTCGCAAGTCCAAT 1380 Qy 461 LeuLysProPheGluArgAspIleSerThrGluIleTyrGlnAlaGlySerThrProCys 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 CTGAAGCCTTTCGAGCGGGACATCAGCACAGAGATCTACCAGGCCGGCTCCACCCCATGC 1440 Qy 481 AsnGlyValGluGlyPheAsnCysTyrPheProLeuGlnSerTyrGlyPheGlnProThr 500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 AATGGCGTGGAGGGCTTTAACTGTTATTTCCCCCTGCAGTCTTACGGCTTCCAGCCTACA 1500 Qy 501 AsnGlyValGlyTyrGlnProTyrArgValValValLeuSerPheGluLeuLeuHisAla 520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 AACGGCGTGGGCTATCAGCCATACAGAGTGGTGGTGCTGTCCTTTGAGCTGCTGCACGCA 1560 Qy 521 ProAlaThrValCysGlyProLysLysSerThrAsnLeuValLysAsnLysCysValAsn 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 CCAGCAACAGTGTGCGGACCTAAGAAGTCTACCAATCTGGTGAAGAACAAGTGCGTGAAC 1620 Qy 541 PheAsnPheAsnGlyLeuThrGlyThrGlyValLeuThrGluSerAsnLysLysPheLeu 560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 TTCAACTTCAACGGCCTGACCGGCACAGGCGTGCTGACCGAGTCCAACAAGAAGTTCCTG 1680 Qy 561 ProPheGlnGlnPheGlyArgAspIleAlaAspThrThrAspAlaValArgAspProGln 580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 CCCTTTCAGCAGTTCGGCAGAGACATCGCCGATACCACAGACGCCGTGAGAGACCCCCAG 1740 Qy 581 ThrLeuGluIleLeuAspIleThrProCysSerPheGlyGlyValSerValIleThrPro 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 ACCCTGGAGATCCTGGACATCACACCTTGCTCTTTCGGCGGCGTGAGCGTGATCACACCT 1800 Qy 601 GlyThrAsnThrSerAsnGlnValAlaValLeuTyrGlnAspValAsnCysThrGluVal 620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 GGCACCAATACAAGCAACCAGGTGGCCGTGCTGTATCAGGACGTGAATTGTACCGAGGTG 1860 Qy 621 ProValAlaIleHisAlaAspGlnLeuThrProThrTrpArgValTyrSerThrGlySer 640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 CCAGTGGCCATCCACGCCGATCAGCTCACCCCCACATGGAGGGTGTACTCCACCGGCTCT 1920 Qy 641 AsnValPheGlnThrArgAlaGlyCysLeuIleGlyAlaGluHisValAsnAsnSerTyr 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 AACGTGTTCCAGACACGCGCCGGATGCCTGATCGGAGCCGAGCATGTGAACAATTCTTAT 1980 Qy 661 GluCysAspIleProIleGlyAlaGlyIleCysAlaSerTyrGlnThrGlnThrAsnSer 680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 GAGTGCGACATCCCCATCGGAGCCGGCATCTGTGCCAGCTACCAGACCCAGACAAACAGC 2040 Qy 681 ProGlySerAlaSerSerValAlaSerGlnSerIleIleAlaTyrThrMetSerLeuGly 700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 CCTGGCTCCGCCAGCTCCGTGGCCTCTCAGAGCATCATCGCCTATACCATGAGCCTGGGG 2100 Qy 701 AlaGluAsnSerValAlaTyrSerAsnAsnSerIleAlaIleProThrAsnPheThrIle 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 GCCGAGAATAGCGTGGCCTACTCTAACAATAGCATCGCCATCCCCACCAACTTCACAATC 2160 Qy 721 SerValThrThrGluIleLeuProValSerMetThrLysThrSerValAspCysThrMet 740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 TCCGTGACCACAGAGATCCTGCCCGTGAGCATGACCAAGACATCTGTGGACTGCACAATG 2220 Qy 741 TyrIleCysGlyAspSerThrGluCysSerAsnLeuLeuLeuGlnTyrGlySerPheCys 760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 TATATCTGTGGCGATTCTACCGAGTGCAGCAACCTGCTGCTGCAGTACGGCAGCTTTTGT 2280 Qy 761 ThrGlnLeuAsnArgAlaLeuThrGlyIleAlaValGluGlnAspLysAsnThrGlnGlu 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 ACCCAGCTCAACCGGGCCCTGACAGGAATCGCAGTGGAGCAGGACAAGAACACACAGGAG 2340 Qy 781 ValPheAlaGlnValLysGlnIleTyrLysThrProProIleLysAspPheGlyGlyPhe 800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 GTGTTCGCCCAGGTGAAGCAGATCTACAAGACCCCACCCATCAAGGACTTTGGCGGCTTC 2400 Qy 801 AsnPheSerGlnIleLeuProAspProSerLysProSerLysArgSerPheIleGluAsp 820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 AACTTCAGCCAGATCCTGCCAGATCCCTCCAAGCCTTCTAAGAGGAGCTTTATCGAGGAC 2460 Qy 821 LeuLeuPheAsnLysValThrLeuAlaAspAlaGlyPheIleLysGlnTyrGlyAspCys 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 CTGCTGTTCAACAAGGTGACCCTGGCCGATGCCGGCTTCATCAAGCAGTATGGCGATTGC 2520 Qy 841 LeuGlyAspIleAlaAlaArgAspLeuIleCysAlaGlnLysPheAsnGlyLeuThrVal 860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 CTGGGCGACATCGCAGCCCGCGACCTGATCTGTGCCCAGAAGTTTAATGGCCTGACCGTG 2580 Qy 861 LeuProProLeuLeuThrAspGluMetIleAlaGlnTyrThrSerAlaLeuLeuAlaGly 880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 CTGCCTCCACTGCTGACAGATGAGATGATCGCACAGTACACATCCGCCCTGCTGGCCGGC 2640 Qy 881 ThrIleThrSerGlyTrpThrPheGlyAlaGlyAlaAlaLeuGlnIleProPheAlaMet 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 ACCATCACATCTGGATGGACCTTCGGGGCCGGGGCCGCCCTGCAGATCCCATTTGCCATG 2700 Qy 901 GlnMetAlaTyrArgPheAsnGlyIleGlyValThrGlnAsnValLeuTyrGluAsnGln 920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 CAGATGGCCTATAGATTCAACGGCATCGGCGTGACCCAGAATGTGCTGTACGAGAACCAG 2760 Qy 921 LysLeuIleAlaAsnGlnPheAsnSerAlaIleGlyLysIleGlnAspSerLeuSerSer 940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2761 AAGCTGATCGCCAATCAGTTTAACTCCGCCATCGGCAAGATCCAGGACTCCCTGTCTAGC 2820 Qy 941 ThrAlaSerAlaLeuGlyLysLeuGlnAspValValAsnGlnAsnAlaGlnAlaLeuAsn 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2821 ACAGCCTCTGCCCTGGGCAAGCTGCAGGATGTGGTGAATCAGAACGCCCAGGCCCTGAAT 2880 Qy 961 ThrLeuValLysGlnLeuSerSerAsnPheGlyAlaIleSerSerValLeuAsnAspIle 980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2881 ACCCTGGTGAAGCAGCTCAGCAGCAACTTCGGGGCCATCAGCAGCGTGCTGAACGACATC 2940 Qy 981 LeuSerArgLeuAspProProGluAlaGluValGlnIleAspArgLeuIleThrGlyArg 1000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2941 CTGAGCCGGCTGGACCCCCCTGAGGCAGAGGTGCAGATCGACAGGCTGATCACAGGCCGC 3000 Qy 1001 LeuGlnSerLeuGlnThrTyrValThrGlnGlnLeuIleArgAlaAlaGluIleArgAla 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3001 CTGCAGAGCCTGCAGACCTACGTGACACAGCAGCTCATCAGGGCCGCCGAGATCAGAGCC 3060 Qy 1021 SerAlaAsnLeuAlaAlaThrLysMetSerGluCysValLeuGlyGlnSerLysArgVal 1040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3061 TCCGCCAATCTGGCCGCCACCAAGATGTCTGAGTGCGTGCTGGGCCAGAGCAAGCGCGTG 3120 Qy 1041 AspPheCysGlyLysGlyTyrHisLeuMetSerPheProGlnSerAlaProHisGlyVal 1060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3121 GACTTTTGTGGCAAGGGCTATCACCTGATGTCCTTCCCACAGTCTGCCCCCCACGGAGTG 3180 Qy 1061 ValPheLeuHisValThrTyrValProAlaGlnGluLysAsnPheThrThrAlaProAla 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3181 GTGTTTCTGCATGTGACCTACGTGCCTGCCCAGGAGAAGAACTTCACCACAGCCCCAGCC 3240 Qy 1081 IleCysHisAspGlyLysAlaHisPheProArgGluGlyValPheValSerAsnGlyThr 1100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3241 ATCTGCCACGATGGCAAGGCACACTTTCCCCGGGAGGGCGTGTTCGTGTCTAACGGCACC 3300 Qy 1101 HisTrpPheValThrGlnArgAsnPheTyrGluProGlnIleIleThrThrAspAsnThr 1120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3301 CACTGGTTTGTGACACAGAGAAATTTCTACGAGCCTCAGATCATCACCACAGACAATACA 3360 Qy 1121 PheValSerGlyAsnCysAspValValIleGlyIleValAsnAsnThrValTyrAspPro 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3361 TTCGTGAGCGGCAACTGTGACGTGGTCATCGGCATCGTGAACAATACCGTGTATGATCCC 3420 Qy 1141 LeuGlnProGluLeuAspSerPheLysGluGluLeuAspLysTyrPheLysAsnHisThr 1160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3421 CTGCAGCCTGAGCTGGACTCCTTTAAGGAGGAGCTGGATAAGTACTTCAAGAATCACACC 3480 Qy 1161 SerProAspValAspLeuGlyAspIleSerGlyIleAsnAlaSerValValAsnIleGln 1180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3481 TCTCCCGACGTGGATCTGGGCGACATCAGCGGCATCAATGCCTCCGTGGTGAACATCCAG 3540 Qy 1181 LysGluIleAspArgLeuAsnGluValAlaLysAsnLeuAsnGluSerLeuIleAspLeu 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3541 AAGGAGATCGACAGGCTGAACGAGGTGGCCAAGAATCTGAACGAGTCCCTGATCGATCTG 3600 Qy 1201 GlnGluLeuGlyLysTyrGluGlnTyrIleLysTrpProTrpTyrIleTrpLeuGlyPhe 1220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3601 CAGGAGCTGGGCAAGTATGAGCAGTACATCAAGTGGCCATGGTATATCTGGCTGGGCTTC 3660 Qy 1221 IleAlaGlyLeuIleAlaIleValMetValThrIleMetLeuCysCysMetThrSerCys 1240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3661 ATCGCCGGCCTGATCGCCATCGTGATGGTGACCATCATGCTGTGCTGTATGACATCCTGC 3720 Qy 1241 CysSerCysLeuLysGlyCysCysSerCysGlySerCysCysLysPheAspGluAspAsp 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3721 TGTTCTTGCCTGAAGGGCTGCTGTAGCTGTGGCTCCTGCTGTAAGTTTGATGAGGACGAT 3780 Qy 1261 SerGluProValLeuLysGlyValLysLeuHisTyrThr 1273 ||||||||||||||||||||||||||||||||||||||| Db 3781 AGCGAGCCCGTGCTGAAGGGCGTGAAGCTGCACTACACC 3819 Gencore RESULT 2 US-17-218-148-20 Sequence 20, US/17218148 Patent No. 11253587 GENERAL INFORMATION APPLICANT: VARIATION BIOTECHNOLOGIES INC. TITLE OF INVENTION: VACCINE COMPOSITIONS FOR THE TREATMENT OF CORONAVIRUS FILE REFERENCE: 2007801-0145 CURRENT APPLICATION NUMBER: US/17/218,148 CURRENT FILING DATE: 2021-03-30 PRIOR APPLICATION NUMBER: 63/070,150 PRIOR FILING DATE: 2020-08-25 PRIOR APPLICATION NUMBER: 63/002,237 PRIOR FILING DATE: 2020-03-30 NUMBER OF SEQ ID NOS: 44 SEQ ID NO 20 LENGTH: 3822 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide Alignment Scores: Length: 3822 Score: 6726.00 Matches: 1273 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 Gaps: 0 US-17-918-676-1correct (1-1273) x US-17-218-148-20 (1-3822) Qy 1 MetPheValPheLeuValLeuLeuProLeuValSerSerGlnCysValAsnLeuThrThr 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACC 60 Qy 21 ArgThrGlnLeuProProAlaTyrThrAsnSerPheThrArgGlyValTyrTyrProAsp 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 AGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGAC 120 Qy 41 LysValPheArgSerSerValLeuHisSerThrGlnAspLeuPheLeuProPhePheSer 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 AAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCC 180 Qy 61 AsnValThrTrpPheHisAlaIleHisValSerGlyThrAsnGlyThrLysArgPheAsp 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGAT 240 Qy 81 AsnProValLeuProPheAsnAspGlyValTyrPheAlaSerThrGluLysSerAsnIle 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATA 300 Qy 101 IleArgGlyTrpIlePheGlyThrThrLeuAspSerLysThrGlnSerLeuLeuIleVal 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 ATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTT 360 Qy 121 AsnAsnAlaThrAsnValValIleLysValCysGluPheGlnPheCysAsnAspProPhe 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 AATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTT 420 Qy 141 LeuGlyValTyrTyrHisLysAsnAsnLysSerTrpMetGluSerGluPheArgValTyr 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTAT 480 Qy 161 SerSerAlaAsnAsnCysThrPheGluTyrValSerGlnProPheLeuMetAspLeuGlu 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAA 540 Qy 181 GlyLysGlnGlyAsnPheLysAsnLeuArgGluPheValPheLysAsnIleAspGlyTyr 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTAT 600 Qy 201 PheLysIleTyrSerLysHisThrProIleAsnLeuValArgAspLeuProGlnGlyPhe 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTT 660 Qy 221 SerAlaLeuGluProLeuValAspLeuProIleGlyIleAsnIleThrArgPheGlnThr 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACT 720 Qy 241 LeuLeuAlaLeuHisArgSerTyrLeuThrProGlyAspSerSerSerGlyTrpThrAla 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCT 780 Qy 261 GlyAlaAlaAlaTyrTyrValGlyTyrLeuGlnProArgThrPheLeuLeuLysTyrAsn 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAAT 840 Qy 281 GluAsnGlyThrIleThrAspAlaValAspCysAlaLeuAspProLeuSerGluThrLys 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAG 900 Qy 301 CysThrLeuLysSerPheThrValGluLysGlyIleTyrGlnThrSerAsnPheArgVal 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTC 960 Qy 321 GlnProThrGluSerIleValArgPheProAsnIleThrAsnLeuCysProPheGlyGlu 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAA 1020 Qy 341 ValPheAsnAlaThrArgPheAlaSerValTyrAlaTrpAsnArgLysArgIleSerAsn 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAAC 1080 Qy 361 CysValAlaAspTyrSerValLeuTyrAsnSerAlaSerPheSerThrPheLysCysTyr 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTAT 1140 Qy 381 GlyValSerProThrLysLeuAsnAspLeuCysPheThrAsnValTyrAlaAspSerPhe 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTT 1200 Qy 401 ValIleArgGlyAspGluValArgGlnIleAlaProGlyGlnThrGlyLysIleAlaAsp 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 GTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGAT 1260 Qy 421 TyrAsnTyrLysLeuProAspAspPheThrGlyCysValIleAlaTrpAsnSerAsnAsn 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 TATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAAT 1320 Qy 441 LeuAspSerLysValGlyGlyAsnTyrAsnTyrLeuTyrArgLeuPheArgLysSerAsn 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAAT 1380 Qy 461 LeuLysProPheGluArgAspIleSerThrGluIleTyrGlnAlaGlySerThrProCys 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 CTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGT 1440 Qy 481 AsnGlyValGluGlyPheAsnCysTyrPheProLeuGlnSerTyrGlyPheGlnProThr 500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 AATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACT 1500 Qy 501 AsnGlyValGlyTyrGlnProTyrArgValValValLeuSerPheGluLeuLeuHisAla 520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 AATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCA 1560 Qy 521 ProAlaThrValCysGlyProLysLysSerThrAsnLeuValLysAsnLysCysValAsn 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 CCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAAT 1620 Qy 541 PheAsnPheAsnGlyLeuThrGlyThrGlyValLeuThrGluSerAsnLysLysPheLeu 560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 TTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTG 1680 Qy 561 ProPheGlnGlnPheGlyArgAspIleAlaAspThrThrAspAlaValArgAspProGln 580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 CCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAG 1740 Qy 581 ThrLeuGluIleLeuAspIleThrProCysSerPheGlyGlyValSerValIleThrPro 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 ACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCA 1800 Qy 601 GlyThrAsnThrSerAsnGlnValAlaValLeuTyrGlnAspValAsnCysThrGluVal 620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 GGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTC 1860 Qy 621 ProValAlaIleHisAlaAspGlnLeuThrProThrTrpArgValTyrSerThrGlySer 640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 CCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCT 1920 Qy 641 AsnValPheGlnThrArgAlaGlyCysLeuIleGlyAlaGluHisValAsnAsnSerTyr 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 AATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATAT 1980 Qy 661 GluCysAspIleProIleGlyAlaGlyIleCysAlaSerTyrGlnThrGlnThrAsnSer 680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 GAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCT 2040 Qy 681 ProGlySerAlaSerSerValAlaSerGlnSerIleIleAlaTyrThrMetSerLeuGly 700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 CCTGGTAGTGCAAGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGT 2100 Qy 701 AlaGluAsnSerValAlaTyrSerAsnAsnSerIleAlaIleProThrAsnPheThrIle 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 GCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATT 2160 Qy 721 SerValThrThrGluIleLeuProValSerMetThrLysThrSerValAspCysThrMet 740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 AGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATG 2220 Qy 741 TyrIleCysGlyAspSerThrGluCysSerAsnLeuLeuLeuGlnTyrGlySerPheCys 760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 TACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGT 2280 Qy 761 ThrGlnLeuAsnArgAlaLeuThrGlyIleAlaValGluGlnAspLysAsnThrGlnGlu 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 ACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAA 2340 Qy 781 ValPheAlaGlnValLysGlnIleTyrLysThrProProIleLysAspPheGlyGlyPhe 800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 GTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTT 2400 Qy 801 AsnPheSerGlnIleLeuProAspProSerLysProSerLysArgSerPheIleGluAsp 820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 AATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGAT 2460 Qy 821 LeuLeuPheAsnLysValThrLeuAlaAspAlaGlyPheIleLysGlnTyrGlyAspCys 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 CTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGC 2520 Qy 841 LeuGlyAspIleAlaAlaArgAspLeuIleCysAlaGlnLysPheAsnGlyLeuThrVal 860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 CTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTT 2580 Qy 861 LeuProProLeuLeuThrAspGluMetIleAlaGlnTyrThrSerAlaLeuLeuAlaGly 880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 TTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGT 2640 Qy 881 ThrIleThrSerGlyTrpThrPheGlyAlaGlyAlaAlaLeuGlnIleProPheAlaMet 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 ACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATG 2700 Qy 901 GlnMetAlaTyrArgPheAsnGlyIleGlyValThrGlnAsnValLeuTyrGluAsnGln 920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 CAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAA 2760 Qy 921 LysLeuIleAlaAsnGlnPheAsnSerAlaIleGlyLysIleGlnAspSerLeuSerSer 940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2761 AAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCC 2820 Qy 941 ThrAlaSerAlaLeuGlyLysLeuGlnAspValValAsnGlnAsnAlaGlnAlaLeuAsn 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2821 ACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAAC 2880 Qy 961 ThrLeuValLysGlnLeuSerSerAsnPheGlyAlaIleSerSerValLeuAsnAspIle 980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2881 ACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATC 2940 Qy 981 LeuSerArgLeuAspProProGluAlaGluValGlnIleAspArgLeuIleThrGlyArg 1000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2941 CTTTCACGTCTTGACCCTCCTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGA 3000 Qy 1001 LeuGlnSerLeuGlnThrTyrValThrGlnGlnLeuIleArgAlaAlaGluIleArgAla 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3001 CTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCT 3060 Qy 1021 SerAlaAsnLeuAlaAlaThrLysMetSerGluCysValLeuGlyGlnSerLysArgVal 1040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3061 TCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTT 3120 Qy 1041 AspPheCysGlyLysGlyTyrHisLeuMetSerPheProGlnSerAlaProHisGlyVal 1060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3121 GATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCCTCAGTCAGCACCTCATGGTGTA 3180 Qy 1061 ValPheLeuHisValThrTyrValProAlaGlnGluLysAsnPheThrThrAlaProAla 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3181 GTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTGCC 3240 Qy 1081 IleCysHisAspGlyLysAlaHisPheProArgGluGlyValPheValSerAsnGlyThr 1100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3241 ATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACA 3300 Qy 1101 HisTrpPheValThrGlnArgAsnPheTyrGluProGlnIleIleThrThrAspAsnThr 1120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3301 CACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACACA 3360 Qy 1121 PheValSerGlyAsnCysAspValValIleGlyIleValAsnAsnThrValTyrAspPro 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3361 TTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCT 3420 Qy 1141 LeuGlnProGluLeuAspSerPheLysGluGluLeuAspLysTyrPheLysAsnHisThr 1160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3421 TTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACA 3480 Qy 1161 SerProAspValAspLeuGlyAspIleSerGlyIleAsnAlaSerValValAsnIleGln 1180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3481 TCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAA 3540 Qy 1181 LysGluIleAspArgLeuAsnGluValAlaLysAsnLeuAsnGluSerLeuIleAspLeu 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3541 AAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTC 3600 Qy 1201 GlnGluLeuGlyLysTyrGluGlnTyrIleLysTrpProTrpTyrIleTrpLeuGlyPhe 1220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3601 CAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCATGGTACATTTGGCTAGGTTTT 3660 Qy 1221 IleAlaGlyLeuIleAlaIleValMetValThrIleMetLeuCysCysMetThrSerCys 1240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3661 ATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTTGC 3720 Qy 1241 CysSerCysLeuLysGlyCysCysSerCysGlySerCysCysLysPheAspGluAspAsp 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3721 TGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGAC 3780 Qy 1261 SerGluProValLeuLysGlyValLysLeuHisTyrThr 1273 ||||||||||||||||||||||||||||||||||||||| Db 3781 TCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACA 3819 US 11,253,587 does not teach wherein the vaccine comprises a self-replicating RNA (srRNA) encoding the SARS-CoV-2 spike protein comprising GSAS 682-685 and 2P 986-987 amino acid residue substituents (SEQ ID NO: 20 and 21 of the art reference) instead of VLPs (viral like particles). WO2018091540A1 teaches a self-replicating RNA vaccine, the “SAM” vector comprising VEE TC-38 (alphavirus-derived RNA replicon), with a sequence encoding a Zika antigen inserted immediately after nucleotide 7561 (e.g., Example 1, page 5 at lines 21-25). WO2018091540A1 teaches that the Zika virus is a plus-strand RNA virus (page 1 at line 22). WO2018091540A1 teaches that self-replicating RNA molecules can be directly translated after delivery to a cell and this translation provides an RNA-dependent RNA polymerase which then produces both antisense and sense transcripts from the delivered RNA, leading to the production of multiple daughter RNAs, the overall result being a huge amplification in the number of introduced replicon RNAs and the encoded antigen becoming a major polypeptide product of the cells (first full paragraph on page 21). WO2018091540A1 teaches that the alphavirus replicase comprises nsP1, nsP2, nsP3, and nsP4 (non-structural proteins) (paragraph spanning pages 21-22), while the structural proteins are not included, and the encoding RNA for the antigen occupies the position the structural genes occupied, i.e., the subgenomic transcript encodes the antigen rather than the structural alphavirus virion proteins (first full paragraph on page 22). WO2018091540A1 teaches that the self-replicating molecule may have two ORFs, the first encoding a replicase, the second encoding the antigen (2nd full paragraph on page 22). WO2018091540A1 teaches that the self-replicating RNA can conveniently be prepared by in vitro transcription (IVT) (paragraph spanning pages 22-23). WO2018091540A1 also teaches that an advantage of a self-replicating RNA includes the absence of a limiting anti-vector immune response and a lack of risk of genomic integration (first full paragraph on page 26). WO2018091540A1 further teaches the delivery of the nucleic acid based vaccine in lipid nanoparticles (LNPs), cationic nano-emulsions (CNE), or biodegradable polymeric microparticles for inducing an immune response in preventing infections (e.g., pages 26-27), and that pharmaceutically acceptable carrier(s) may be added (second and third full paragraphs on page 28-29). WO2018091540A1 teaches substitution of the native signal sequence with the JEV signal sequence (e.g., Example 4) or other heterologous signal sequences or variants thereof (e.g., page 13 at lines 9-12. WO2018091540A1 teaches a self-amplifying mRNA comprising the VEE TC-38 replicon encoding the viral nonstructural proteins 1-4 followed by a subgenomic promoter and an insert encoding the viral antigen (page 5 at lines21-25). The vaccine of the invention comprises an immunologically effective amount of antigen, that amount effective for inducing a measurable immune response against the virus in a subject; the effective amount is to be determined for the health and physical condition of each individual to be administered the composition (page 29 at lines 17-33), and the subject may be a vertebrate such as a mammal, such as a human or a veterinary mammal (page 29 at lines 14-16). See entire reference. It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have made a mRNA version of the nucleic acid sequence encoding the SARS-CoV-2 protein in the vaccine of the primary art reference and to have incorporated the mRNA into the self-replicating RNA vaccine, the “SAM” vector comprising VEE TC-38 (alphavirus-derived RNA replicon) taught by the secondary art reference in place of the Zika mRNA sequence in the secondary art reference srRNA molecule, to have comprised it within a liposome as is taught by the secondary art reference, and to have administered it to a non-human mammalian subject to induce an immune response. One of ordinary skill in the art would have been motivated to do this, and with a reasonable expectation of success in doing so, in order to create a potential vaccine composition against SARS-CoV-2 and having the advantages of being able to use smaller doses (due to the huge amplification quality of the srRNA unlike VLPs that can’t replicate) and the ease of making it as opposed to high scaling up of expression systems and complex downstream purification characteristic of bioreactor production disclosed by the primary art reference. Instant dependent claim 24 is included in this rejection as the construct comprises a C-terminal transmembrane sequence followed by a cytosolic domain. 14. Claims 1, 7, 8, 12-15, 18, 22 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over US 11,253,587 in view of WO2018091540A1 (IDS reference) and Ljungberg and Liljestrom (Expert Rev. Vacc., 2014, 14(2): 177-194) or Maruggi et al. (Mol. Ther. 4.10/2019, 27(4): 757-772), as evidenced by a comparison of instant SEQ ID NO: 49 with SEQ ID NO: 20 and 21 of the primary art reference (see above). Independent claim 1 recites: A self-replicating RNA molecule comprising a sequence encoding a SARS-CoV-2 spike (S) antigen, or an immunogenic variant or fragment thereof, wherein the antigen comprises (i) proline substitutions at residues 986 and 987 relative to SEQ DI NO: 1 and (ii) a GSAS (SEQ ID NO: 190) substitution at a furin cleavage site relative to residues 682-685 of SEQ ID NO: 1. Claim 12 recites: A composition comprising an immunologically effective amount of the self-replicating RNA molecule of claim 1 and a pharmaceutically acceptable carrier. Independent claim 18 recites: A method of inducing an immune response against the antigen in a subject in need thereof, the method comprising administering to the subject an immunologically effective amount of the self-replicating RNA molecule of claim 1. Independent claim 22 recites: A method of inducing an immune response against the antigen in a subject in need thereof, the method comprising administering t the subject an immunologically effective amount of the self-replicating RNA molecule of claim 15. The disclosure and teaching of US 11,253,587 and WO2018091540A1 are enunciated in detail, as is the evidentiary comparison of the art sequences in the primary art reference with instantly recited SEQ ID NO: 49, above in this office action so will not be repeated herein. Ljungberg and Liljestrom teach self-replicating mRNA vaccines developed from alphavirus expression vectors that can be delivered as RNA or as recombinant virus particles, with some being used in human clinical trials (abstract). Ljungberg and Liljestrom teach an alphavirus RNA replicon vaccine vector designed to express only a foreign antigen of interest gene placed under subgenomic control and preceded by nonstructural replicase proteins of the alphavirus (Figure 1 and legend). Ljungberg and Liljestrom teach a myriad of advantages of making and using self-replicating mRNA vaccines as follows. Clinical trials using alphavirus replicon vaccines indicated both humoral and cellular immune responses ensue, with the responses being for the most part Th1 biased or in some cases Th1/Th2 balanced, and with the observation that alphavirus RNAs stimulate strong innate immune responses in a self-adjuvanting manner (clinical trials section). Ljungberg and Liljestrom teach that an advantage of replicon vaccines is that they can be constructed rapidly with incorporating any mutations or variations one wishes to make, an important consideration for emerging infections or for designing vaccines targeting new variants of pathogens. Ljungberg and Liljestrom teach that another advantage is that replicons can be made completely synthetically and can be easily produced using generic production platforms that reduce or eliminate risk of cellular contaminants. Ljungberg and Liljestrom teach that the alphavirus vectors can accommodate quite large inserts, can be used at lower doses, and induce potent immune responses; there is no concern for neutralizing immunity induced against the vector or the replicase, and very few individuals are infected by alphaviruses (page 184). Ljungberg and Liljestrom teach moving these vaccines into the clinic and comparing them with existing vaccine platforms (paragraph spanning pages 1844-185). Ljungberg and Liljestrom teach that replicon and RNA vaccines will be the technologies of choice for development of vaccines against emerging diseases and against pathogens with rapid escape patterns. The synthetic construction and rapid production using generic production platforms put RNA vaccines in an advantageous position, with numerous pre-clinical studies underscoring the potency of these vaccines against infectious diseases (last paragraph on page 185 and Key issues section). See entire reference. Alternatively, Maruggi et al. also teach a multitude of advantages of making and using self-replicating mRNA (sr-mRNA) vaccines. Maruggi et al. teach that mRNA vaccines do not need to cross the nuclear membrane barrier for protein expression, can express complex antigens without packaging constraints, can be produced rapidly within days of obtaining gene sequence information using completely synthetic manufacturing processes, is a versatile platform that is amendable to multiple targets, and is ideal for rapid responses to newly emerging pathogens (paragraph spanning pages 757-758). Maruggi et al. teach that mRNA vaccines mimic a viral infection to elicit potent humoral as well as cellular immune responses, and virtually any sequence could be designed, synthesized and delivered as an mRNA vaccine, and tested rapidly in vivo in animal models (mRNA Vaccines section at column 1 on page 758). Maruggi et al. further teach self-amplifying (self-replicating) mRNA derived from the genome of positive-stranded RNA viruses, wherein the sr-mRNA encodes the antigen of interest and the viral replication machinery required for intracellular RNA amplification leading to high levels of antigen expression (ibid). Maruggi et al. teach that preparation of mRNA has low batch-to-batch variability, potentially saving time and reducing costs as compared with other vaccine platforms (last paragraph on page 758). Maruggi et al. teach that other advantages of sr-mRNA include enhanced and prolonged antigen expression, lower effective RNA doses, potentially resulting in better safety, intrinsic adjuvant effect, enhanced cross-presentation, single-vector delivery of multiple or complex antigens, ability to stimulate besides humoral and cellular adaptive immunity, innate immunity. Maruggi et al. teach that sr-mRNA are based commonly on the engineered RNA genome of positive-sense single-stranded RNA viruses such as alphaviruses, with the alphavirus RNA genomes coding four non-structural proteins, nsP1-4 and form the RNA-dependent RNA polymerase complex. The sr-mRNA replicons are created by replacing viral structural genes with the antigen of interest, which, upon delivery in the cytoplasm of target cells, are capable of RNA amplification to express high levels of the antigen of interest. They can be readily produced by IVT (page 761 at the self-amplifying mRNA vaccines section). Maruggi et al. teach that in addition to being highly versatile, potent, streamlined, scalable, inexpensive, rapidly and easily produced, low in cost, they are cold-chain free and can fill the gap between emerging pandemic infectious diseases and a rapid, abundant supply of effective vaccines (conclusion section). Maruggi et al. teach delivery systems for sr-mRNA vaccines. Maruggi et al. teach that mRNA can be large-scaled for GMP production and that mRNA vaccines have a favorable safety profile. See entire reference. It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have made a mRNA version of the nucleic acid sequence encoding the SARS-CoV-2 protein comprised in the vaccine of the primary art reference and to have incorporated the mRNA into the self-replicating mRNA vaccine, the “SAM” vector comprising VEE TC-38 (alphavirus-derived RNA replicon) taught by the secondary art reference in place of the Zika mRNA sequence in the secondary art reference srRNA molecule, to have comprised it within a liposome as is taught by the secondary art reference, and to have administered it to a non-human mammalian subject to induce an immune response. One of ordinary skill in the art would have been motivated to do this, and with a reasonable expectation of success in doing so, in order to create a potential vaccine composition against SARS-CoV-2 and having the advantages of being able to use smaller doses (due to the huge amplification quality of the srRNA unlike VLPs that can’t replicate) and the ease of making it as opposed to high scaling up of expression systems and complex downstream purification characteristic of bioreactor production disclosed by the primary art reference. This is even more so the case as either of Ljungberg and Liljestrom or Maruggi et al. teach myriad advantages of such vaccines in terms of low cost, rapid, large-scale GMP production for control of pandemic pathogens, engagement of both arms of adaptive immunity as well as innate immunity, lower dosages to achieve results, predominant Th1 profile (for safety), safe and potent performance in clinical trials, and superior storage conditions. Instant dependent claim 24 is included in this rejection as the construct comprises a C-terminal transmembrane sequence followed by a cytosolic domain. 15. It is noted by the Examiner that a signal peptide functions within a specific expression system or within a specific organism rather than working universally across all hosts. In addition, the translocation rate and cleavage accuracy vary dramatically depending upon how the signal sequence interact with adjacent amino acid residues of the partner protein, influencing protein folding (the requirements of which differ for different proteins), yield, and signal peptide cleavage. Also, the signal sequence must match the intended destination. Therefore, it would not have been obvious to have used a particular signal sequence even if it had been known in the art before the filing date of the claimed invention with a protein as recited in the instant claims. In this context, the Examiner points out that IDS reference WO2017068142A1 teaches that the signal peptide of Gaussian luciferase outperforms various mammalian secretory signal peptides (page 16 at lines 12-15, page 25 at lines 8-13); however, please note that the disclosed signal sequence is one amino acid residue shorter than instantly recited SEQ ID NO: 2 (the instant claims require the signal sequence as shown in SEQ ID NO: 2 or consisting of or set forth in SEQ ID NO: 2), and even if the reference had taught the exact sequence, it still would have been unpredictable that the sequence would work in tandem with the primary art reference spike protein sequences. 16. Claims 1, 7, 8, 12-15, 18, 22 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over US 11,253,587 in view of WO2018091540A1 (IDS reference) and Yang et al. (J. Virol. 2002, 76(9): 4634-4642), as evidenced by a comparison of instant SEQ ID NO: 49 with SEQ ID NO: 20 and 21 of the primary art reference. The disclosure/teachings of US 11,253,587 and WO2018091540A1 (hereafter referred to as the” combined references”) have been enunciated above in detail and will not be repeated herein, except to add that the SARS-CoV-2 spike protein is a trimer (first paragraph of detailed description of the invention of US 11,253,587). The combined references do not disclose/teach that the construct comprises a C-terminal T4 fibritin trimerization motif. Yang et al. teach that the envelope glycoproteins of HIV-1 function as a trimer. Yang et al. further teach that the soluble proteins were stabilized by fusion with a trimeric motif derived from T4 fibritin, with the trimer being more stable to heat and reducing conditions than one made with the GCN4 trimerization motif (e.g., abstract). Yang et al. teach that the fibritin carboxy-terminal domain is able to promote trimerization of heterologous proteins and improves solubility of the heterologous proteins (e.g., page 4635 at the first full paragraph). It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have removed the TM and cytosolic regions to make a soluble construct and to have added the T4 fibritin motif (from the C-terminus of T4 fibritin) in their place. One of ordinary skill in the art would have been motivated to do this, and with a reasonable expectation of success in doing so, in order to stabilize a soluble construct of the spike protein. (The Examiner notes that this construct is presumably identical to instantly recited SEQ ID NO: 26 (SEQ ID NO: 26 being identical to SEQ ID NO: 49, but with the TM and cytosolic domains of SEQ ID NO: 49 substituted with the T4 fibritin trimerization motif and the endogenous spike protein signal sequence. However, the instant claims that recite SEQ ID NO: 26 either recite a signal sequence that is a particular heterologous signal sequence that the art does not teach or disclose or recite a particular encoding nucleic acid molecule (instantly recited SEQ ID NO: 122) that appears to be free of the prior art. The same is the case for instantly recited SEQ ID NO: 145 that encodes instantly recited SEQ ID NO: 49. Hence the claims that recite the particular heterologous signal sequence or the encoding nucleotide sequences are not included in this rejection). 17. Claims 1, 7, 8, 12-15, 18, 22 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over US 11,253,587 in view of WO2018091540A1 (IDS reference), Ljungberg and Liljestrom (Expert Rev. Vacc., 2014, 14(2): 177-194) or Maruggi et al. (Mol. Ther. 4.10/2019, 27(4): 757-772), and Yang et al. (J. Virol. 2002, 76(9): 4634-4642), as evidenced by a comparison of instant SEQ ID NO: 49 with SEQ ID NO: 20 and 21 of the primary art reference (see above). The disclosure/teachings of US 11,253,587, WO2018091540A1, Liljestrom (Expert Rev. Vacc., 2014, 14(2): 177-194) or Maruggi et al. (hereafter referred to as the” combined references”) have been enunciated above in detail and will not be repeated herein, except to add that the SARS-CoV-2 spike protein is a trimer (first paragraph of detailed description of the invention of US 11,253,587). The combined references do not disclose/teach that the construct comprises a C-terminal T4 fibritin trimerization motif. Yang et al. teach that the envelope glycoproteins of HIV-1 function as a trimer. Yang et al. further teach that the soluble proteins were stabilized by fusion with a trimeric motif derived from T4 fibritin, with the trimer being more stable to heat and reducing conditions than one made with the GCN4 trimerization motif (e.g., abstract). Yang et al. teach that the fibritin carboxy-terminal domain is able to promote trimerization of heterologous proteins and improves solubility of the heterologous proteins (e.g., page 4635 at the first full paragraph). It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have removed the TM and cytosolic regions to make a soluble construct and to have added the T4 fibritin motif (from the C-terminus of T4 fibritin) in their place. One of ordinary skill in the art would have been motivated to do this, and with a reasonable expectation of success in doing so, in order to stabilize a soluble construct of the spike protein. 18. Claims 18 and 22 are objected to because of the following informalities: both claims recite “A method of inducing an immune response against the antigen” whereas it should recite ‘A method of inducing an immune response against the antigen of claim 1’. Appropriate correction is required. 19. No claim is allowed. 20. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARIANNE DIBRINO whose telephone number is (571)272-0842. The examiner can normally be reached on M, T, Th, F. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the Examiner’s supervisor, MISOOK YU can be reached on 571-272-0839. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Marianne DiBrino/ Marianne DiBrino, Ph.D. Patent Examiner Group 1640 Technology Center 1600 /MISOOK YU/Supervisory Patent Examiner, Art Unit 1641