DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 40-41, 45 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claims 40-41 recite SEQ ID NO: 19 and both originally depend on claim 37, which does not comprise SEQ ID NO: 19. Therefore claims 40-41 widen scope of claim 37 instead of limiting it.
Claim 45 recites SEQ ID NO: 19 and originally depend on claim 20, which does not comprise SEQ ID NO: 19. Therefore claim 45 widens scope of claim 20 instead of limiting it.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1, 5, 10, 12-13, 17, 19, 36-38, 44, 46-47, 49-51 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Khvorova et al (US 2007/0031844, February 2007).
Concerning claims 1, 5, 10, 17, 19 and 36-38 Khvorova disclose a number of siRNAs (see Abstract), which are double-stranded RNAs (see paragraphs [0004-0005]), including siRNA with one strand of SEQ ID NO: 726433 (see sequence listing), 19 nucleotides long, with nucleotides 1-16 fully identical to portion of instant SEQ ID NO: 2, which is a portion of target RACK1 RNA, making SEQ ID NO: 726433 a passenger strand:
SEQ ID NO: 2 1 GAACTGAAGCAAGAAGTTATC 21
|||||||||||::|:|
SEQ ID NO: 726433 1 GAAGCAAGAAGUUAUCAGU 19
It is inherent that the guide strand is complementary to passenger strand, meaning that a strand complementary to SEQ ID NO: 726433 is complementary to instant SEQ ID NO: 2 as well. Further Khvorova disclose that siRNAs of invention comprise modified nucleotides (see paragraph [0120]).
Concerning claims 12-13 Khvorova disclose that siRNA can comprise 2-O-methyl modifications (see paragraphs [0120, 0086]).
Concerning claim 44 Khvorova disclose that siRNA can be in a form of shRNA (see paragraph [0105]).
Concerning claims 46-47 Khvorova disclose that siRNAs of the invention can be conjugated to antibodies (see paragraph [0284]).
Concerning claims 49-50 Khvorova disclose that siRNAs of the invention can be encoded in a viral vector (see paragraph [0277]).
Concerning claim 51 Khvorova disclose that siRNAs of the invention can be delivered into cells (see paragraph [0007]), therefore inherently disclosing compositions of such siRNAs.
Claim(s) 1, 5, 10, 17, 19-20, 36-38, 44, 49-51 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Duchateau et al (US 2013/0190385, July 2013).
Concerning claims 1, 5, 10, 17, 19-20, 36-38 Duchateau disclose a number of siRNAs (see paragraph [0156]), including siRNA of SEQ ID NO: 751 (see Table II on page 23), which is a passenger strand of such siRNA with nucleotides 2-21 fully complementary to instant SEQ ID NO: 83 and the same nucleotides comprise instant SEQ ID NO: 294:
SEQ ID NO: 83 1 ATCATGTCCGGGAACTGCGG 20
||||||||||||||||||||
SEQ ID NO: 751 21 TAGTACAGGCCCTTGACGCCC 1
It is inherent that the strand complementary to SEQ ID NO: 751, guide strand, comprises instant SEQ ID NO: 83 and is complementary to instant SEQ ID NO: 294, which is a portion of target RACK1 RNA. Duchateau further disclose that siRNAs can be chemically modified (see paragraph [0044]).
Concerning claim 44 Duchateau disclose that siRNA can be in a form of shRNA (see paragraph [0047]).
Concerning claims 49-50 Duchateau disclose that siRNA can be encoded in a viral vector (see paragraph [0043, 0059]).
Concerning claim 51 Duchateau disclose that siRNA can be included in compositions (see paragraphs [0208-0209]).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1, 5, 10, 17, 19-20, 24-25, 32-33, 36-38, 44, 49-51 is/are rejected under 35 U.S.C. 103 as being unpatentable over Duchateau, above, and in further view of Vickers et al (The Journal of Biological Chemistry, 2003, vol.278, no.9: 7108-7118, of record) and Swayze (US 2010/0197762, August 2010, of record).
Teachings of Duchateau are discussed above.
Duchateau do not teach that antisense oligonucleotide of the strand complementary to SEQ ID NO: 751 (instant SEQ ID NO: 83) is a gapmer comprising 10 DNA nucleotides flanked by 5 RNA nucleotides as in instant claims 25, 32, 33.
Vickers teach that double-stranded RNAs such as siRNAs can be effective targeting the same targets as single-stranded antisense oligonucleotides (see Abstract).
Swayze teach design of effective antisense oligonucleotides such as gapmers comprising 10 DNA nucleotides flanked by 5 RNA nucleotides shown as 5-10-5 (see paragraphs [0005, 0006, 0010]).
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to create an antisense oligonucleotide gapmer based on the strand complementary to SEQ ID NO: 751 (same as instant SEQ ID NO: 83) of Duchateau and teachings of Vickers and Swayze. One of the ordinary skill in the art would be motivated to do so because Vickers teach that antisense oligonucleotides can target the same sequence as siRNAs, making it obvious to create antisense oligonucleotide based on Duchateau teaching of siRNA with antisense strand of instant SEQ ID NO: 83 and further modify such oligonucleotide based on teachings of Swayze, arriving at instant invention.
Claim(s) 1, 51, 52, 73 is/are rejected under 35 U.S.C. 103 as being unpatentable over Duchateau, above, and in further view of Castor (US 2012/0052114, March 2012).
Teachings of Duchateau are discussed above.
Duchateau do not teach that siRNA is in composition comprising nanoparticles such as nanosomes.
Castor teach delivery of siRNAs using phospholipid nanosomes (see paragraph [0003]).
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to create a composition comprising siRNA taught by Duchateau with a phospholipid nanosome taught by Castor. One of the ordinary skill in the art would be motivated to do so to improve delivery of such siRNA as taught by Castor.
Improper Markush Rejection
Claims 1, 5, 20 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a "single structural similarity" and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a "single structural similarity" and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of sequences from claims 1, 5, 20 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: claims 1 and 5 recite target sequences of the same gene and claim 20 recite sequences targeting some of the targets. Sequences of claims 1 and 5 are different portions of the gene, therefore they lack any structural similarity. Sequences of claim 20 target different portions of the gene, therefore lacking structural similarity. Further, their activity varies widely as evidenced by data in instant Example 2.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Response to Arguments
Applicant's arguments filed 12/11/2025 have been fully considered but they are not persuasive.
Previous 112, 101, 102 and 103 rejections are withdrawn in view of new amendments, arguments are moot.
Concerning improper Markush rejection Applicant argues that after new amendments the claims recite a list of alternatives instead of Markush group. According to MPEP 2117, part I, “a "Markush" claim recites a list of alternatively useable members”. Therefore, the rejection is maintained.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EKATERINA POLIAKOVA-GEORGANTAS/ Primary Examiner, Art Unit 1637
Prosecution Insights