Prosecution Insights
Last updated: April 19, 2026
Application No. 17/919,704

KIT FOR EVALUATING SENSITIVITY OF PATIENT TO MET INHIBITOR

Final Rejection §101§102§103§112§DP
Filed
Oct 18, 2022
Examiner
CHUNDURU, SURYAPRABHA
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Beijing Neurosurgical Institute
OA Round
2 (Final)
53%
Grant Probability
Moderate
3-4
OA Rounds
4y 0m
To Grant
70%
With Interview

Examiner Intelligence

Grants 53% of resolved cases
53%
Career Allow Rate
377 granted / 710 resolved
-6.9% vs TC avg
Strong +17% interview lift
Without
With
+17.2%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
58 currently pending
Career history
768
Total Applications
across all art units

Statute-Specific Performance

§101
4.2%
-35.8% vs TC avg
§103
29.6%
-10.4% vs TC avg
§102
30.8%
-9.2% vs TC avg
§112
17.8%
-22.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 710 resolved cases

Office Action

§101 §102 §103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION 1. The Applicant’s response to the office action filed on October 21, 2025 is acknowledged. Status of the Application 2. Claims 1-2 are pending under examination with elected SEQ ID NO. 3 and a probe that hybridizes to SEQ ID NO: 1. Claims 4 and 6 have been previously withdrawn from further consideration as being drawn to nonelected group. Claims 3, 5 and 7-11 were canceled. Further, new claims 12-13 are withdrawn from further consideration as being drawn to nonelected group and SEQ ID Nos. The Applicant’s arguments have been fully considered and found persuasive in-part for the following reasons. Objection to the Specification-Withdrawn 3. The objection to the specification has been withdrawn in view of the amendment. Claim Rejections - 35 USC § 112-Maintained 4. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 2 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 2 recites the broad recitation first nucleotide sequence SEQ ID NO: 3 and the claim 1 upon which claim 2 depends recites first nucleotide sequence SEQ ID NO: 1 which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. Claim 2 recites first nucleic acid sequence is shown in SEQ ID NO. 3, which is 6537 nucleotides in length, which is dependent on claim 1 which recites that the first nucleotide sequence as shown in SEQ ID NO:1, which is 39 nucleotides in length. The metes and bounds of the claim are unclear and indefinite because the first It is not clear how the first nucleic acid sequence of 39 nucleotides in length of claim 1 could encompass the sequence of SEQ ID NO: 3, which is more than 39 nucleotides in length. Response to Arguments: With reference to the rejection of claims 2 and 11 under 35 USC 112(b) the Applicant’s arguments and the amendment have been fully considered and found persuasive in-part. The rejection of claims 2 and 11 is withdrawn in view of deleting ‘preferably’ in claim 2. However, the rejection of claim 2, the arguments drawn to SEQ ID NO: 3, the arguments and the amendment have been fully considered and found unpersuasive because claim 1 upon which claim 2 depends, recites that the first nucleotide sequence is SEQ ID NO: 1, which is a short nucleotide sequence having 39 nucleotides in length. Claim 2 recites said first nucleotide sequence is SEQ ID NO:3, which is a longer sequence having 6537 nucleotides in length. It is unclear how the shorter sequence of SEQ ID NO: 1 can encompass the longer sequence of SEQ ID NO:3. The rejection has been maintained for claim 2 and restated to address the amendment. Claim Rejections - 35 USC § 102-withdrawn 5.(i) The rejection of claims 1-3 and 11 under 35 USC 102(a) as being anticipated by white et al has been withdrawn in view of the amendment. However, the reference is applied to the amended claims because White et al. teach the probe sequence comprising SEQ ID NO: 21. The recitation of ‘and/or’ need not necessarily require a first primer pair and a first probe. The alternate language ‘or’ indicates either the first primer pair or a first probe is sufficient to meet the limitations of claim 1. (ii) The rejection of claim 1 under 35 USC 102(a) as being anticipated by Jin et al., has been withdrawn in view of the amendment. Double Patenting-Maintained 6. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-2 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5 of co-pending Application No. 17/919,711. Although the claims at issue are not identical, they are not patentably distinct from each other because the claims 1-2 are entirely within the scope of the claims 1-5 of the co-pending application, specifically the kit of claims 1-2 comprising a primer pair and/or a probe amplifying a first nucleotide sequence of Seq ID No: 1 and 3 is within the scope of the claims 1-5 of the co-pending application. The instant claims differ from the claim in the co-pending application, in reciting a kit comprising a primer pair amplifying SEQ ID NO: 3 which is which is obvious over the claims 1-5 disclosing SEQ ID NO: 2 in the co-pending application, which encompass the seq ID No:3 as claimed in the instant application. Further the first primer pair consisting of SEQ ID NO: 19-20 and a probe consisting of the sequence of SEQ ID NO: 21 are within the scope of the claim 3 of the co-pending application reciting SEQ ID Nos 4-5 and 6 and coextensive in scope. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Response to Arguments: With reference to the rejection of claims 1-3 and 11 under obviousness type of double patenting over the claims in the co-pending application 17/919,711, the Applicant’s arguments were fully considered and found persuasive in-part. The rejection of claims 3 and11 is moot in view of the amendment. With reference to the rejection of claims 1-2, the Applicant’s arguments drawn to functional use (for evaluating to MET inhibitors) of primer pair and/or probe, have been fully considered and found unpersuasive. As noted in MPEP 2111.02, the preamble reciting intended use is not given any patentable weight because it does not change the product structure or sequence composition and the primers and/or probe to detect SEQ ID NO: 1, 3, 19-21 in the claims 1-2 read on the SEQ ID NO: 1-5 of the claims 1-5 in the co-pending application and are co-extensive in scope. For all the above the rejection has been maintained and restated to address the amendment. Claim Rejections - 35 USC § 101-Maintained 7. 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim 1-2 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception without significantly more. The claims recite primers and/or probe which represent product, a statutory category. Claims recite a judicial exception (law of nature) without significantly more because said primers and/or probe are considered as a law of nature products, said products exist in nature. This judicial exception is not integrated into a practical application because the judicial exception is not markedly different from law of nature (White et al. (US 2019/0033306)). The claim(s) do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the additional elements recited in the claims (kit) do not add significantly more to the claimed product. The additional elements are not themselves natural laws, but neither are they sufficient to transform the nature of the claims because they consist of well-understood, routine, conventional activity already engaged in by the scientific community. The additional elements consist of well-understood, routine, conventional activity already engaged in by the scientific community (White et al. (US 2019/0033306)). The additional elements, when viewed as a whole, add nothing significant beyond the sum of their parts taken separately. The Court has made clear that to transform an unpatentable law of nature into a patent-eligible application of such a law, one must do more than simply state the law of nature while adding the words "apply it." Essentially, appending conventional steps specified at a high level of generality, to laws of nature, natural phenomena, and abstract ideas cannot make those laws, phenomena, and ideas patent-eligible. The Court’s decision rested upon an examination of the particular claims in light of the Court's precedents, specifically Bilski, Flook and Diehr. The Court repeated the long- standing exceptions (laws of nature, natural phenomena, and abstract ideas) to categories of patent eligibility defined in 35 U.S.C. § 101. In conducting the analysis, the Court addressed the "machine-or-transformation" test explained in Bilski with a reminder that the test is an "important and useful clue" to patentability but that it does not trump the "law of nature" exclusion. A claim that recites a law of nature or natural correlation, with additional elements/steps that involve well-understood, routine, conventional activity previously engaged in by researchers in the field is not patent-eligible, regardless of whether the steps result in a transformation. On the other hand, reaching back to Neilson, the Court pointed to an eligible process that included not only a law of nature (hot air promotes ignition) but also several unconventional steps involving a blast furnace) that confined the claims to a particular, useful application of the principle. For these reasons, the claims are rejected under section 101 as being directed to non-statutory subject matter. Response to Arguments: With reference the rejection of claims 1-3 and 11 under 35 USC 101, the applicant’s arguments and the amendment have been fully considered and found persuasive. The rejection of claims 3 and 11 has been withdrawn in view of the amendment. With reference to the Applicant’s arguments drawn to a kit, the arguments were found unpersuasive. First, as noted in MPEP 2111.02, intended use (kit for evaluating the sensitivity of glioma patient to an MET inhibitor) is not given any patentable weight. Second, as discussed above the claims require a primer pair or a probe, which encompass the naturally existing sequences of MET gene, which are within the scope of naturally existing sequences of nature and fall within the scope of the judicial exception. For all the above the rejection has been maintained and restated to address the amendment. New Rejections Necessitated by the Amendment Claim Rejections - 35 USC § 103 8. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1-2 are rejected under 35 U.S.C. 103 as being unpatentable over White et al. (US 2019 /0033306) in view of Lowe et al. (Nucleic Acids Research, Vol. 18, No. 7, page 1757-1761, (1990)). Note: the recitation of ‘and/or’ in claims which is interpreted as one of the alternatives, required by the claims. White et al. teach a kit of claim 1, for evaluating the sensitivity of a glioma patient to an MET inhibit to amplify a nucleotide sequence comprising primers and/ or probe capable of amplifying a first sequence of SEQ ID No: 1, wherein the probe sequence comprises SEQ ID NO: 21 (para 0014-0015, 0136-0147 a probe sequence of SEQ ID NO:678 comprising first nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO 21 see the following sequence alignment). For SEQ ID NO:1 Publication No. US20190033306A1 SEQ ID NO 678; LENGTH: 633; TYPE: DNA; ORGANISM: Homo sapiens; Query Match 100.0%; Score 39; Length 633; Best Local Similarity 100.0%; Matches 39; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTTGACATGCCTAATAAAAGATTTGGTTGGATGAATTTC 39 ||||||||||||||||||||||||||||||||||||||| Db 612 GTTGACATGCCTAATAAAAGATTTGGTTGGATGAATTTC 574 For SEQ ID No: 21 SEQ ID NO 678; LENGTH: 633; TYPE: DNA; ORGANISM: Homo sapiens; Query Match 100.0%; Score 28; Length 633; Best Local Similarity 100.0%; Matches 28; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAAATCTTTTATTAGGCATGTCAACATC 28 |||||||||||||||||||||||||||| Db 588 CAAATCTTTTATTAGGCATGTCAACATC 615 With reference to claim 2, White et al. teach a probe for specifically binding a first nucleotide sequence of SEQ ID NO:3 wherein the probe comprises the sequence of SEQ ID NO: 21 (para 0136-0147; binding agent (probe) for binding fused gene Seq ID NO: 678, which comprises SEQ ID NO: 1 and SEQ ID NO: 21). Although White et al. teach probe sequence comprising SEQ ID NO:21, however, White et al did not teach probe consisting of SEQ ID NO:21. Lowe et al. teach a method for designing primers and evaluating their performance wherein Lowe et al. disclose a computer program for rapid selection of oligonucleotide primers for polymerase chain reaction, wherein the length of the primers designed to have 18 to 22 nucleotides or (paragraphs under subheading ‘computer program’ on page 1757-1758, abstract). Lowe et al. teach that all primers designed for over 10 gene products were experimentally tested and the results showed that all the amplification products specified by the primers are of the predicted size and also hybridize with the appropriate cDNA or internal oligonucleotide probe (see page 1759-1760, col. 2, paragraph 1, table 1). It would have been prima facie obvious to a person of ordinary skill in the art before the effective date of the invention to modify the teaching of the known gene sequence comprising the probe sequence of SEQ ID NO: 21 as taught by White et al. and a method to design primers/ probes from the known sequence as taught by Lowe et al. to improve the specificity of primers/probe for detecting target nucleic acid in a sample. The ordinary person skilled in the art would have motivated to generate primers and probes from the known sequence as taught by Lowe et al. and have a reasonable expectation of success that such primers/ probe generated using known sequence as taught by White et al. would detect target nucleic acid. The claimed primers/probe are functional equivalents of the polynucleotide sequence taught by White et al. in view of Lowe et al. because Lowe et al. explicitly taught that the primers/probe generated from a known sequence using a computer program would specifically amplify the target sequence and all primers designed for over 10 gene products from known sequences were experimentally tested and the results showed that all the amplification products specified by the primers are of the predicted size also hybridizes with the appropriate cDNA or internal oligonucleotide probe (see page 1760, col. 2, paragraph 1) and such a modification of the known sequences are considered obvious over the prior art. As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim such as oligomer length and sequence, are disclosed in the prior art White et al. and Lowe et al.), it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the selection of hybridization conditions performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art and such a modification of the method is considered obvious over the cited prior art. Conclusion No claims are allowable. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SURYAPRABHA CHUNDURU whose telephone number is (571)272-0783. The examiner can normally be reached 8.00am-4.30pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Suryaprabha Chunduru Primary Examiner Art Unit 1681 /SURYAPRABHA CHUNDURU/Primary Examiner, Art Unit 1681
Read full office action

Prosecution Timeline

Oct 18, 2022
Application Filed
Aug 08, 2025
Non-Final Rejection — §101, §102, §103
Nov 03, 2025
Response Filed
Jan 23, 2026
Final Rejection — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12601003
METHOD FOR SELECTING POLYNUCLEOTIDES BASED ON ENZYME INTERACTION DURATION
2y 5m to grant Granted Apr 14, 2026
Patent 12577563
METHODS FOR MULTIPLEXING RECOMBINASE POLYMERASE AMPLIFICATION
2y 5m to grant Granted Mar 17, 2026
Patent 12577606
Gene target region enrichment method and kit
2y 5m to grant Granted Mar 17, 2026
Patent 12553044
METHYLATION DETECTION AND ANALYSIS OF MAMMALIAN DNA
2y 5m to grant Granted Feb 17, 2026
Patent 12534756
Method and system for the amplification of a nucleic acid
2y 5m to grant Granted Jan 27, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
53%
Grant Probability
70%
With Interview (+17.2%)
4y 0m
Median Time to Grant
Moderate
PTA Risk
Based on 710 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month