DETAILED ACTION
Notice of AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I, claims 1-3, 15-17, 19, 21 and 23; and the species of SEQ ID NO: 8 in the reply filed on 08 April 2026 is acknowledged. The requirement is deemed proper and therefore made Final.
Status of Application
Claims 1-8, 15-17, 19, 21, 23, 30-32 and 35-38 are pending; Claims 4-8, 30-32 and 35-38 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected subject matter, there being no allowable generic or linking claim. Thus, claims 1-3, 15-17, 19, 21 and 23 are subject to examination on the merits.
Priority
The instant application is a 371 of PCT/GB2021/050939 filed 19 April 2021 which claims benefit of foreign priority document UK 2005732.9 filed 20 April 2020 is acknowledged. Said document has been received.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 08 May 2025 and 18 October 2022 have been considered by the examiner. See initialed and signed PTO/SB/08’s.
Claim Objections
Claims 1 and 2 are objected to because of the following informalities: the sequence identifiers should have a colon (e.g. SEQ ID NO:). Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-3, 21 and 23 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a natural phenomenon) without additional elements that integrate the judicial exception into a practical application. An analysis with respect to the claims as a whole reveals that they do not include additional elements that integrate the judicial exception into a practical application. See MPEP 2106.
Analysis of subject-matter eligibility under 35 U.S.C. § 101 requires consideration of the following steps:
Step (1) whether the claim is directed to one of the four categories recited in §101 (process, machine, manufacture or composition of matter);
Step (Revised 2A - Prong 1) do the claims recite an abstract idea (mathematical concepts, mental processes or method of organizing human activity), law of nature or natural phenomenon;
Step (Revised 2A - Prong 2) do the claims recite additional elements that integrate the judicial exception into a practical application; and
Step (2B) whether the claim as a whole recites something that amounts to significantly more than the judicial exception. (See 2019 Revised Patent Subject Matter Eligibility Guidance (2019 PEG)).
Step 1: Yes; the claims are directed to a composition of matter.
Step 2A – Prong 1: Yes, the claims recite a natural phenomenon, namely, a naturally occurring product/promoter.
Step 2A – Prong 2: No, the claims do not recite any additional elements that integrate the judicial exception into a practical application because the claims are merely drawn to what already exists in nature. It is noted, elected species SEQ ID NO: 8, is a naturally occurring nucleic acid found in humans (See Supplemental Content, 20260123_121938_us-17-919-710-8.rge file, Result #1). Despite the claims reciting “synthetic CNS-specific promoter”, there is nothing in the claims which differentiates this naturally occurring promoter/nucleic acid in terms of structure and/or function. Thus, there is ultimately nothing in the claims which integrates the judicial exception into a practical application. Even for the claims which recite that the protein is in a pharmaceutical composition (claim 21) or found in a cell (claim 23), there is nothing in the claims or specification which distinguishes that found in nature from that produced in human cells.
Step 2B: As noted in answering that of 2A – Prong 2 above, there is nothing in the claims which amounts to significantly more in terms of structure and/or function and the claims read on naturally occurring enzymes. Thus, the claims are drawn to a judicial exception, namely, a naturally occurring product.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-3, 15-17, 19, 21 and 23 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are drawn to synthetic CNS-specific promoters comprising SEQ ID NO: 8 (the elected species) or a variant thereof; or wherein the variant comprises at least 60% sequence identity to SEQ ID NO: 8 (claim 2) or maintains at least 25% functionality compared the reference (here SEQ ID NO: 8) promoter. However, the specification does not describe any variations of the promoter of SEQ ID NO: 8, with the exceptions of instant SEQ ID NO: 7 (1910na) and SEQ ID NO: 26 (593na), which are longer versions of SEQ ID NO: 8 (540na) – also See Supplemental Content, 20260123_121939_us-17-919-710-8.rnpbm, Results #1 and 2. However, these two variants are not representative of all potential variations of the 540 nucleic acid sequence of SEQ ID NO:8, or those having as little as 60% identity for claim 2, in terms of structure and function.
The MPEP in section 2163(I) states that the purpose of the written description requirement is to ensure that the inventor had possession, at the time the invention was made/filed, of the specific subject matter claimed:
To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonable conclude the inventor had possession of the claimed invention. See, e.g., Moba, B.V. v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116. However, a showing of possession alone does not cure the lack of a written description. Enzo Biochem, Inc. v. Gen-Probe, Inc., 323 F.3d 956, 969-70, 63 USPQ2d 1609, 1617 (Fed. Cir. 2002). For example, it is now well accepted that a satisfactory description may be found in originally-filed claims or any other portion of the originally-filed specification. See In re Koller, 613 F.2d 819, 204 USPQ 702 (CCPA 1980); In re Gardner, 475 F.2d 1389, 177 USPQ 396 (CCPA 1973); In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976). However, that does not mean that all originally-filed claims have adequate written support. The specification must still be examined to assess whether an originally-filed claim has adequate support in the written disclosure and/or the drawings.
PNG
media_image1.png
18
19
media_image1.png
Greyscale
An applicant shows that the inventor was in possession of the claimed invention by describing the claimed invention with all of its limitations using such descriptive means as words, structures, figures, diagrams, and formulas that fully set forth the claimed invention. Lockwood v. Amer. Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997)"
Further, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated:
"A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398 (Fed. Circ. 1997).
MPEP § 2163 further states that if a biomolecule is described only by a functional characteristic, without any disclosed correlation between function and structure of the sequence, it is "not sufficient characteristic for written description purposes, even when accompanied by a method of obtaining the claimed sequence." Furthermore, the courts have also held that possession may not be shown by merely describing how to obtain possession of members of the claimed genus or how to identify their common structural features. See University of Rochester, 358 F.3d at 927, 69 USPQ2d at 1895.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1, 3, 15-17, 19, 21 and 23 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Kugler et al. (Molecular and Cellular Neuroscience, 2001 – cited herein).
Kugler et al. teach:
Regarding claims 1, 3, CNS tissue specific promoter Syn-1 for expression of proteins of interest in neurons/brain. Syn1 and instant SEQ ID NO: 8 (as the elected species), for example, have the same function but different structures/sequences, having only about 2.4% sequence identity (see below). Nonetheless, claim 1 recites a CNS specific promoter of SEQ ID NOs: 8, or functional variants thereof. Said Syn1 promoter is considered a functional variant because it has the same function and the claims do not require any sort of sequence identity (See Materials and Methods and Figure 1).
Regarding claims 15-17, 19 and 23, the promoter is placed in an expression cassette and directs expression of a heterologous protein of interest (EGFP), wherein said cassette is in an adenoviral vector and made and purified in 293S suspension cells, and further transduced in vitro into neurons (See Materials and Methods, p. 93, Figure 1 and Figure7). The expression cassette also is indicated being ideal in AAV vectors (See p. 89, 2nd col., first paragraph).
Regarding claims 21 and further claim 23, the purified vectors were then placed into a pharmaceutically acceptable composition comprising PBS buffer and injected into rats where the protein of interest was expressed in brain cells (See Materials and Methods and Figure 8).
GenCore version 6.5.2
Copyright (c) 1993 - 2026 Biocceleration Ltd.
OM nucleic - nucleic search, using sw model
Run on: April 20, 2026, 16:02:18 ; Search time 1 Seconds
(without alignments)
0.504 Million cell updates/sec
Title: US-17-919-710-8
Perfect score: 540
Sequence: 1 gctggtgcttcttttttctg..........tgaagatatcaataatatgc 540
Scoring table: IDENTITY_NUC
Gapop 10.0 , Gapext 1.0
Searched: 1 seqs, 467 residues
Total number of hits satisfying chosen parameters: 2
Minimum DB seq length: 0
Maximum DB seq length: inf
Post-processing: Minimum Match 0%
Maximum Match 100%
Listing first 50 summaries
Database : US-17-919-710-14.fasta:*
SUMMARIES
%
Result Query
No. Score Match Length DB ID Description
----------------------------------------------------------------------------
c 1 13 2.4 467 1 US-17-919-710-14 Regulatory Nucleic
2 10.8 2.0 467 1 US-17-919-710-14 Regulatory Nucleic
ALIGNMENTS
RESULT 1
US-17-919-710-14/c
Query Match 2.4%; Score 13; DB 1; Length 467;
Best Local Similarity 65.5%;
Matches 19; Conservative 0; Mismatches 10; Indels 0; Gaps 0;
Qy 460 ATCAAGTTTGCCAAACACATTTCTGAAAG 488
||| |||| || | | | ||||| ||
Db 157 ATCCTGTTTCCCCTCCCCCTCTCTGATAG 129
RESULT 2
US-17-919-710-14
Query Match 2.0%; Score 10.8; DB 1; Length 467;
Best Local Similarity 52.2%;
Matches 24; Conservative 0; Mismatches 22; Indels 0; Gaps 0;
Qy 192 GGGCGATCAGAGCAACAGCTGGGGAGACTTTTTCAACAAAGATGAG 237
| | | | | | | || | | |||| || | ||||||
Db 1 GAGGGCCCTGCGTATGAGTGCAAGTGGGTTTTAGGACCAGGATGAG 46
Search completed: April 20, 2026, 16:02:18
Job time : 1 secs
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claim 1-3, 15-17, 19, 21 and 23 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 2, 27 and 115 of copending Application No. 18027293 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because anticipate the instant claims.
The instant claims in their broadest are drawn to a synthetic CNS-specific promoter comprising a sequence according to any one of SEQ ID NOs 1-8, 21-26 or a functional variant thereof (SEQ ID NO: 8 as the elected species) – Claim 1. Wherein dependent claims recite the promoter is in an expression cassette and operably linked to a nucleic acid sequence encoding an expression product; the promoter is in a vector and the promoter is in a cell (claims 15, 16 and 23, respectively).
The claims to the ‘293 in their broadest are drawn to methods of treating a neurological disorder in a subject by administering (a) an isolated nucleic acid encoding a transgene encoding one or more miRNAs; and (b) an isolated nucleic acid encoding a CYP46A1 protein (Claim 1). Dependent claim 27 recites wherein the transgene comprises a promoter and dependent claim 115 recites wherein the promoter is selected from SEQ ID NOs: 152, 74-98 and 112-127.
The promoters comprising the sequences of SEQ ID NOs: 97, 98, 118, 119, 125 of the ‘293 application have 100% sequence identity to instant SEQ ID NO: 8 – See Supplemental Content, 20260123_121939_us-17-919-710-8.rnpbm file, Results #1-3 and Duplicates thereof.
As such, while the claims differ in that the ‘293 claims are drawn to method claims using overlapping promoters that have 100% sequence identity to instant SEQ ID NO: 8, said promoters still necessarily anticipate the instant claims.
Claim 1-3, 15-17, 19, 21 and 23 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 27 and 28 of copending Application No. 18833081 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because anticipate the instant claims.
The instant claims in their broadest are drawn to a synthetic CNS-specific promoter comprising a sequence according to any one of SEQ ID NOs 1-8, 21-26 or a functional variant thereof (SEQ ID NO: 8 as the elected species) – Claim 1. Wherein dependent claims recite the promoter is in an expression cassette and operably linked to a nucleic acid sequence encoding an expression product; the promoter is in a vector and the promoter is in a cell (claims 15, 16 and 23, respectively).
The claims to the ‘081 in their broadest are drawn to methods of treating a neurological disorder in a subject by administering (a) an isolated nucleic acid encoding a transgene encoding one or more miRNAs; and (b) an isolated nucleic acid encoding a CYP46A1 protein (Claim 1). Dependent claim 27 recites wherein the transgene comprises promoter and dependent claim 28 recites wherein the promoter is selected a synapsin-1 or any from Tables 10-13, wherein the promoters in Tables 10-13 include promoters comprising the sequences of SEQ ID NOs: 97, 98, 118, 119, 125 of the ‘081 application which have 100% sequence identity to instant SEQ ID NO: 8 – See Supplemental Content, 20260123_121939_us-17-919-710-8.rnpbm file, Results #1-3 and Duplicates thereof.
As such, while the claims differ in that the ‘293 claims are drawn to method claims using overlapping promoters that have 100% sequence identity to instant SEQ ID NO: 8, said promoters still necessarily anticipate the instant claims.
These both are provisional nonstatutory double patenting rejections because the patentably indistinct claims have not in fact been patented.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SUZANNE M NOAKES whose telephone number is (571)272-2924. The examiner can normally be reached M-F (7-4).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath Rao can be reached at 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SUZANNE M NOAKES/Primary Examiner, Art Unit 1656 21 April 2026