DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 52-82 are pending.
Applicant’s election without traverse of Group I, drawn to the engineered guide RNA claims, in the reply filed on 12/29/2025 is acknowledged. Further, the elected species without traverse is the species of a U7 promoter.
Claims 73 and 79-82 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/29/2025.
Thus, cl. 52-72, 74-78 are examined here.
Priority
The Application claims benefit to various provisional applications: 63/013,774; 63/030,118, 63/086,434; 63/112,486; 63/119,878; and 63/153,817.
63/112,486 discloses the claimed invention, so recognize the priority to ‘486, filing date of 11/11/2020.
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994). The provisional apps: 63/012774, 63/030118, 63/086434 (only 1 slide), appear to disclose a PowerPoint slide(s) with elements of instant claims and no clear claimed engineered guide RNA.
The disclosure of the prior-filed application, Application No. 63/012774, 63/030118, 63/086434, fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 11/8/2022, 04/14/2023, 04/24/2023, were filed before the mailing date of this Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 52 and its dependent claims (53-72, 74-78) are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 52 recites that “the targeting sequence contains at least one mismatch relative to the target RNA” at line 3, and at least 50 nucleotides (nt.) having complementarity to target RNA; although the claim requires some complementarity to the target RNA, the specification also notes that a targeting sequence can have up to 50 base mismatches (par. 107; so for the recited claim, the targeting sequence is 50 nt. and, when read in the light of the specification and under BRI, can have 50 base mismatches, i.e. the range of complementarity is quite broad from 1-100%); thus here there is unclarity regarding what level of complementarity is required, since there can be complementarity without binding of the targeting sequence to the target RNA, which would be a non-functional engineered guide RNA (gRNA).
All the dependent claims are rejected since they do not overcome the indefiniteness. In the interest of compact prosecution, any complementarity is sufficient to meet the limitation of the claim.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 52-59, 63-64, 70-72, 74-76, 78 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Kole et al. (US20030036519, pub. 02/20/2003, “Kole”).
Regarding instant cl. 52, Kole discloses in Fig. 2 (see below), a U7 snRNA construct (heavy line) with a stem-loop structure (i.e. a hairpin) and an antisense sequence (stippled box) and a U7-specific Sm sequence (open box) (par. 11).
PNG
media_image1.png
239
368
media_image1.png
Greyscale
Kole discloses that the length, which is not critical, of antisense sequence can be up to 50 nt. in length (par. 18). The U7 snRNA construct carrying an antisense strand may be used to upregulate a mutant gene whose pre-mRNA results in aberrant splicing, and consequently, a mis-coded mutant protein (par. 7). The antisense sequence by binding to an appropriate sequence can correct the mis-regulated splicing (par. 7). The advantage of the U7 construct to deliver the antisense sequence: a) antisense oligonucleotide require periodic administration (par. 6), b) antisense sequence from the U7 constructs will be expressed/delivered in the nucleus thus capable of modulating pre-mRNA splicing (par. 8). One form of sickle cell disease (termed b-thalassemia) is caused by mis-regulated splicing of β-globin pre-mRNA that is caused by a mutation of a T to a G in the intron that results in the intron being expressed in the mRNA with a pre-mature stop codon and, consequently, a truncated β-globin polypeptide (par. 44). Kole discloses one antisense sequence (U7.5, Fig. 3) comprising the sequence UCUUACCUCAGU, the underlined, bolded C would bind to the G (100% binding to a mutant intron target sequence), while the overall sequence still has complementary to the wild-type intron with one mismatch.
Regarding instant cl. 53, Kole Fig. 2 (see above) discloses the Sm-binding sequence (open box) and the snRNA stem-loop (i.e. the hairpin) are at a 3’ end.
Regarding instant cl. 54, Kole discloses that the length of the antisense is not critical and can be up to 100 bases in length (par. 18).
Regarding instant cl. 55 and 56, Kole discloses the consensus Sm sequence AAUUUUUGGAG (par. 35), which is 100% identical to instant SEQ ID NO: 57.
Regarding instant cl. 57, Kole discloses U7 smOPT plasmid carries the mouse U7 snRNA gene (par. 35).
Regarding instant cl. 58 and 59, Kole Fig. 3 discloses sequences that comprise a sequence that is 100% identical to SEQ ID NO: 42 (caggttttctgacttcggtcggaaaacccct; see highlighted portion, here the mRNA has a U instead of a T).
PNG
media_image2.png
88
824
media_image2.png
Greyscale
Regarding instant cl. 63, Kole Fig. 2 (see above) discloses the antisense sequence (i.e. noted as “anti-histone,” i.e. instant targeting sequence), the Sm-binding sequence and the snRNA hairpin in 5’ to 3’ orientation.
Regarding instant cl. 64, Fig. 1 discloses a bulge/loop/hairpin formation when the smOPT (labeled as “U7.3” or “U7.5”) with the antisense strand binds to the target RNA.
Regarding instant cl. 70, Kole discloses a plasmid of U7smOPT (par. 35).
Regarding instant cl. 71, 72, Kole discloses U7 promoter included in the construct (par. 35).
Regarding instant cl. 74, Kole Fig. 2 discloses a terminal 3’ end (labeled “term.” in Fig. 2) forming regions (par. 11).
Regarding instant cl. 75, Kole discloses a viral vector comprising the U7 construct (cl. 5).
Regarding instant cl. 76, Kole discloses a viral vector can be adeno-associated virus (AAV) (par. 20).
Regarding instant cl. 78, Kole discloses viral vector may be provided in a pharmaceutical carrier such as sterile saline solution (par. 31).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 60-62 are rejected under 35 U.S.C. 103 as being unpatentable over Kole et al. (US20030036519, pub. 02/20/2003, “Kole”) as applied to claims 52-59, 63-64, 70-72, 74-76, 78 above, and further in view of Dickson et al. (2008, Human Gene Ther., 19, 1307-1315, “Dickson”).
Kole discloses in Fig. 2 (see below), a U7 snRNA construct (heavy line) with a stem-loop structure (i.e. a hairpin) and an antisense sequence (stippled box) and a U7-specific Sm sequence (open box) (par. 11).
PNG
media_image1.png
239
368
media_image1.png
Greyscale
Kole discloses that the length, which is not critical, of antisense sequence can be up to 50 nt. in length (par. 18). The U7 snRNA construct carrying an antisense strand may be used to upregulate a mutant gene whose pre-mRNA results in aberrant splicing, and consequently, a mis-coded mutant protein (par. 7). The antisense sequence by binding to an appropriate sequence can correct the mis-regulated splicing (par. 7). The advantage of the U7 construct to deliver the antisense sequence: a) antisense oligonucleotide require periodic administration (par. 6), b) antisense sequence from the U7 constructs will be expressed/delivered in the nucleus thus capable of modulating pre-mRNA splicing (par. 8). One form of sickle cell disease (β-thalassemia) is caused by mis-regulated splicing of β-globin pre-mRNA that is caused by a mutation of a T to a G in the intron that results in the intron being expressed in the mRNA with a pre-mature stop codon and, consequently, a truncated β-globin polypeptide (par. 44). Kole discloses that U7.3 and U7.5 RNAs corrected splicing to a similar level (par. 48). Kole discloses one antisense sequence (U7.5, Fig. 3) comprising the sequence UCUUACCUCAGU, the underlined, bolded C would bind to the G (100% binding to a mutant intron target sequence), while the overall sequence still has complementary to the wild-type intron with one mismatch.
Kole does not disclose engineered guide RNA further comprising “an hnRNP binding domain” (cl. 60); the hnRNP binding domain comprises a sequence of UAGGGW (W=A/U) (cl. 61), and the hnRNP binding domain is at a 5’ end of the engineered guide RNA (cl. 62).
Dickson discloses that a single silent nucleotide difference in survival motor neuron-2 gene (SMN2) exon 7, an essential exon for a functional protein, results in an alternatively spliced isoform lacking exon 7 that fails to replace a mutant SMN1, which is associated spinal muscular atrophy (SMA), a leading genetic cause of infant mortality (abstract). Dickson discloses that SMN2 is a target for therapeutic intervention because “all SMA patients retain SMN2 and SMN2 maintains the same coding sequence as SMN1” (abstract). “Therefore, compounds or molecules that increase SMN2 exon 7 inclusion hold great promise for SMA therapeutics” (abstract). One such compound is a “bifunctional RNAs,” which has an antisense RNA sequence specific to the target RNA and an untethered RNA segment that serves as a binding platform for splicing factors (abstract). Dickson identified a bifunctional RNA that recruits hnRNPA1 to exon 8 to block the general splicing machinery and competitively favor the inclusion of SMN exon 7 (abstract, relevant to instant cl. 60). Dickson demonstrates that the bifunctional RNA “stimulated full-length SMN expression in variety of cell-based assays including SMA patient fibroblasts” (abstract). The bifunctional RNA comprises a SELEX-based hnRNP binding domain that blocks general splicing machinery and has the sequence UAGGGA (pg. 1308: Exon8-hnRNPA1, 5’-CCA GCAUUU CCU GCA AAU GAG GGU ACC UAG GGA UAGGGA UAG GGA-3; relevant to instant cl. 61). It appears that the hnRNP binding of Dickson is at the 3’ end with the 5’ end comprising the antisense sequence (see Fig. 1B, top “Exon8-hnRNPA1”); however, MPEP 2144.04(VI)(C) notes that rearrangements of parts that does not affect the operation of the part is obvious matter of design choice; thus although the claimed invention recites the hnRNP binding domain is at the 3’ end, it is obvious (relevant to instant cl. 62).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the U7 snRNA containing an antisense sequence that affects splice-switching of mutant β-globin pre-mRNA of Kole in view of Dickson and arrive at the claimed invention with a reasonable expectation of success. Because Kole demonstrates that a U7 snRNA vector comprising an antisense sequence targeting β-globin mutant splice site to correct splicing, and Dickson demonstrates that by creating a bifunctional RNA, which in addition to the antisense sequence affecting splicing also has a hnRNP binding domain to recruit hnRNPA1 to correct a mis-regulated splicing and produce a functional SMN2 protein, a skilled artisan would reasonably expect success by modifying the U7 snRNA vector containing an antisense sequence of Kole with the addition of hnRNP binding domain sequence at either end of the antisense strand to inhibit the splicing machinery and alter the splicing site selected for incorporation of an exon. Thus, cl. 60-62 are obvious.
Claims 65-69 are rejected under 35 U.S.C. 103 as being unpatentable over Kole et al. (US20030036519, pub. 02/20/2003, “Kole”) as applied to claims 52-59, 63-64, 70-72, 74-76, 78 above, and further in view of Turunen et al. (US20190218552, pub. date 07/18/2019, in IDS of 04/14/2023).
The disclosure regarding rej. of claims 52-59, 63-64, 70-72, 74-76, 78 is noted above.
Kole does not disclose the recited mismatch (cl. 65, 66), capable of recruiting RNA editing entity to the target RNA (cl. 67), RNA editing entity is ADAR1 or ADAR2 (cl. 68) and the target RNA is the recited RNAs (cl. 69).
Turunen discloses an antisense oligonucleotide (AON) capable of forming a double stranded complex with a target RNA sequence for the deamination of a target adenosine by an endogenous ADAR enzyme (cl. 1, relevant to instant cl. 67). Turunen discloses one AON targeting SERPINA mRNA, which comprises a mutant Adenine nt., and the AON comprises the C nt., thus the mismatch comprises a A-C mismatch (par. 115, Fig. 1A, B; relevant to instant cl. 65, 66, 69). Turunen discloses that one of the ADARs is a human ADAR1 (par. 71, relevant to instant cl. 68). Turunen demonstrates that with the use of ADAR60-15 antisense sequence comprising a C nt. opposite the mutant “A” nt. in the target mRNA of SERPINA resulted in clear, detectable and significant A to G editing the target mRNA (par. 131, Fig. 8).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the U7 snRNA containing an antisense sequence of Kole in view of Turunen and arrive at the claimed invention with a reasonable expectation of success. Because Kole discloses the use of a U7 snRNA vector to carry an antisense sequence that requires fewer administration and Turunen discloses a SERPINA-specific AON that edits an A to G to correct the mutant A nt. on the SERPINA mutant mRNA, a skilled artisan would reasonably expect success by modifying the antisense sequence in the U7 snRNA vector of Kole with the AON sequence of Turunen to correct the single nt. mutation of SERPINA mRNA requiring few administration. Thus, cl. 65-69 are obvious.
Claim 77 is rejected under 35 U.S.C. 103 as being unpatentable over Kole et al. (US20030036519, pub. 02/20/2003, “Kole”) as applied to claims 52-59, 63-64, 70-72, 74-76, 78 above, and further in view of Zincarelli et al. (2008, Mol. Ther., 16, pg. 1073-1080).
Disclosure related to cl. 52-59, 63-64, 70-72, 74-76, 78 is above and Kole discloses AAV vector (par. 20).
Kole does not disclose the specific, recited AAVs of cl. 77.
Zincarelli tests various AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection and demonstrates that AAV9 had the best viral genome distribution and highest expression levels (abstract, see Fig. 3), but the essential teaching is that it “is extremely important to understand the tropism of AAV serotypes in mouse models. This is because model therapies with specific targets are required in order to assess potential primary and secondary viral targets” and noting selecting serotype(s) based on the outcome desired, e.g. although AAV9 had best viral genome distribution, it showed low levels of genome copy numbers in the brain (pg. 1078).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the U7 snRNA vector carrying an antisense strand in an AAV vector of Kole in view of Zincarelli and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Zincarelli in demonstrating expressing serotypes AAV 1-9 throughout various organs in vivo or throughout the whole organism, a skilled artisan would modify the AAV of Kole with the ideal AAV 1 through 9 serotype as taught by Zincarelli based on the desired target organ for delivery of the U7 snRNA vector carrying the antisense sequence. Thus, cl. 77 is obvious.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600