DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status and Election
Applicant’s amendment filed July 25, 2025 amending claims 86 and 91 is acknowledged. It is noted that there are at least two formatting issues with the claim set filed July 25, 2025. First, claim 21 is missing. Claim 21 is assumed canceled because claim 20 recites “… (PAM) sequence. (Canceled)” suggesting that the inclusion of a return key stroke and “claim 21” was inadvertently deleted. Additionally, “75-77(Canceled)78. (Previously presented) A cell…” is on the same line; and “87-90 (Canceled)91. (Currently amended) A method…” is on the same line. Appropriate correction of formatting is requested.
Claims 1-2, 4-6, 9-10, 12, 16, 20, 23-24, 26, 28, 31-33, 35-38, 40-44, 46-47, 49-52, 55-56, 64, 73-74, 78-84, 86, 91, 93-94 and 97 are pending.
Applicant’s election without traverse of Group 1, directed to methods of correcting a gene variant in GBA1, and elections of the GBA1 SNP rs76763715, N370S mutation, with crRNA sequence of SEQ ID NO 8, and ssODN sequence of SEQ ID NO 3 in the reply filed on July 25, 2025 is acknowledged. Claims 56, 64, 73-74, 78-84, 86, 91, 93-94 and 97 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected groups, there being no allowable generic or linking claim. Claims 33, 35-38 and 40-42 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected species, there being no allowable generic or linking claim.
Claims 1-2, 4-6, 9-10, 12, 16, 20, 23-24, 26, 28, 31-32, 43-44, 46-47, 49-52 and 55 are under examination with the elected species recite above.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency #1 - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825 because not all sequences are recited in the sequence listing filed 4/24/2023. The sequence disclosures are located FIG 4 and FIG 5A. The dsDNA sequences of the GBA1 gene “AGGG…AGGT” and the GBAP1 gene “TTCC...AGGT in FIG. 4 and the dsDNA sequence “GACAA…TGGGGGT” in FIG. 5A are not listed in the sequence listing. Although these sequences may be part of a larger sequence in the sequencing listing, ST. 25 requires that all enumerated nucleotide sequences of 10 or greater nucleotides must correspond to a SEQ ID NO in the sequence listing. The sequences in FIG. 4 and FIG 5A are greater than 10 nucleotides and therefore must be separately represented by a SEQ ID NO.
Required response – Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); as well as
An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter;
If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide:
A replacement CRF in accordance with 1.825(b)(6); and
Statement according to item 2) a) or b) above.
Specific deficiency #2 – Nucleotide and/or amino acid sequences appearing in the drawings, FIGs 4 and FIG. 5A are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Drawings
The drawings are objected to because the text in FIGs. 4A and 5A is light grey, too small, or over shading such that the text is not sufficiently dark or of high enough resolution to permit satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.”
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The use of the term TALEN®, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4, 10, 12 and 44 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 4 contains the trademark/trade name “TALEN”. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe an endonuclease that is a Transcription activator-like (TAL) effector nuclease, accordingly, the identification/description is indefinite. It is suggested to replace “TALEN” with "Transcription activator-like (TAL) effector nuclease."
Claim 10 recites “wherein the Cas nuclease is Cas9 or a variant thereof”. Claim 10 is indefinite because the scope of “Cas9 variant” is undefined. It is not clear what or how much of a Cas9 sequence must be varied and/or maintained for the endonuclease to be considered a variant of Cas9.
Claim 12 is rejected for depending from claim 10 and not remedying the indefiniteness.
To remedy the indefiniteness, it is suggested that claim 10 recite “wherein the Cas nuclease is a Cas9 nuclease”, which encompasses the genus of wildtype and engineered Cas9 nuclease. It is suggested that Claim 12 then recite “wherein the Cas9 nuclease exhibits reduced off-target effector activity, optionally wherein the Cas9 is an enhanced specificity Cas9 (eSpCas9) or a high fidelity Cas9 (HiFiCas9).”
Claim 44 recites “wherein the sequence in the target gene… is immediately upstream of the PAM sequence”. There is a lack of clear antecedent basis for “the PAM sequence”. Claim 44 depends from claims 43, 6 and 1, none of which recites “a PAM sequence”. Although recognition of PAM sequences are qualities of Cas nucleases, which is recited in claim 6, Cas nucleases have different PAM sequences preferences. Using “the” to refer to a PAM sequence is confusing because it is not clear if it is referring to an unrecited specific sequence or an inherent quality of an unrecited specific Cas nuclease.
To remedy the indefiniteness, it is suggested that claim 44 recite “wherein the sequence in the target gene… is immediately upstream of [[the]] a PAM sequence”.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-2, 4-6, 9-10, 16, 20, 24, 47, 49-51 and 55 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Burbulla (Burbulla et al., Science Translational Medicine (2019), 11, eaau6870, pages 1-11 and Supplemental Material; of record). Claim 20 is evidenced by Ran (Ran et al., Cell (2013), 154: 1380-1389) and Monteys (Monteys et al., Molecular Therapy (2017), 25: 12-23). Claims 47 and 49 are evidenced by Addgene (pSpCas9n(BB)-2A-GFP, PX461, Plasmid #48140, https://www.addgene.org/48140/ [retrieved August 7, 2025]).
Regarding claims 1, 4-6 and 9-10, Burbulla teaches using CRISPR-Cas9 editing of the PD-associated SNP c.84dupGG in the GBA1 gene in iPSCs (Fig. S2; page 3, ¶1; page 8, ¶5). Burbulla teaches transfecting (i.e., introducing into) iPSCs comprising the SNP with 1) a plasmid encoding SpCas9n (i.e., a recombinant Cas nuclease for inducing a DNA break) and single guide RNAs targeting the SNP (i.e., one or more agents comprising a recombinant nuclease for inducing a DNA break with the GBA1 gene comprising the SNP associated with PD), and 2) an ssODN comprising the SNP correction (page 8, ¶5; Fig S2). Burbulla teaches using ssODNs with right and left homology arms on either side of the mutation correction site for homologous recombination (page 8, ¶5; Fig S2). Burbulla teaches correction of the targeted SNP (i.e., after the integration of the ssODN, the target gene comprises the corrected form of the SNP instead of the SNP) (Fig. S2).
Regarding claim 2, Burbulla teaches that the single guides were chosen so that double stranded nicks occur within 20 base pairs such that each strand was nicked creating a double strand break (page 8, ¶5).
Regarding claim 16, Burbulla teaches the ssODNs were designed with 80 bp, surrounding the left and right side of the mutation correction site for efficient homologous recombination (i.e., only a single mismatch between the ssODN and the target) (page 8, ¶5; Fig S2). Burbulla teaches the sequence of the GBA1-c.84dupG mutant sequence and the ssODN sequence, which was 100% homology to the target site except for the correction site (Fig. S2).
Regarding claim 20, Burbulla teaches the sequence of the GBA1 c.84dupGG SNP and surrounding sequence (Fig S2). Burbulla teaches the site of the nick sites by Cas9n/sgRNA (Fig S2). Burbulla teaches 3 nucleotides toward the 3’ end of the strands opposite the nick sites is the sequence 5’-CAG (i.e., NRG). However, Burbulla is silent on whether the GBA1 sgRNA-targeted sequence comprises a PAM sequence or what the PAM sequence is for SpCas9.
Ran teaches double nicking strategies for Cas9-mediated gene editing (Abstract). Ran teaches the PAM sequence for SpCas9n is located on the strand opposite the nicked strand and three nucleotides toward the 3’ end (Fig 2A,C). Monteys teaches the PAM sequence for SpCas9 is NRG, where R is a purine and G is a guanine (page 13, ¶1). Thus, the SpCas9n/sgRNA-targeted sequence in the GBA1 gene inherently comprises a PAM sequence.
Regarding claim 24, Burbulla teaches the corrected SNP (i.e., only one G instead of two Gs) is the wildtype corrected SNP (Fig S2).
Regarding claims 47 and 49, Burbulla teaches the Cas9 nuclease is the nickase SpCas9n encoded by Addgene no. 48140 (page 8, ¶5). Addgene teaches the SpCas9n encoded by plasmid 48140 is SpCas9(D10A), which can only nick the DNA, which is not a double strand break. Thus, Burbulla’s Cas9 nickase is inherently a recombinant Cas nuclease comprising one or more mutations such that it lacks the ability to induce a DSB by cleaving both strands of dsDNA.
Regarding claims 50-51, Burbulla teaches the iPSCs were derived from skin fibroblasts from two patients with PD carrying the 84GG mutation in GBA1 using key reprogramming factors (i.e., artificially derived) (page 7, ¶6).
Regarding claim 55, Burbulla teaches PCR genotyping and sequencing the GBA1 locus after transfection of the iPSCs with the Cas9/sgRNA/ssODN (i.e., determining whether the cells comprised the integrated ssODN) (page 8, ¶5). Burbulla teaches the edited cells comprise a GBA1 sequence wherein the extra ‘G’ nucleotide is removed (i.e., determining that the cell comprises the integrated ssODN) (Fig S1).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 12 is rejected under 35 U.S.C. 103 as being unpatentable over Burbulla (Burbulla et al., Science Translational Medicine (2019), 11, eaau6870, pages 1-11 and Supplemental Material; of record) as applied to claims 1-2, 4-6, 9-10, 16, 20, 24, 47, 49-51 and 55, in view of Skarnes (Skarnes et al., Methods (2019), 164-165: 18-28).
The teachings of Burbulla are recited above as for claims 1-2, 4-6, 9-10, 16, 20, 24, 47, 49-51 and 55, and incorporated here.
Burbulla does not teaches a Cas9 protein having off target effector activity like HiFiCas9.
Skarnes teaches methods for genome editing in iPSCs using CRISPR/Cas9 technology and ssODNs (Abstract). Skarnes teaches HiFi exhibits reduced off-target cutting compared to Cas9 (Section 3.8). Skarnes teaches the preferred Cas9 nuclease is HiFi Cas9 (Section 3.3).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have use the HiFi Cas9 nuclease taught in Skarnes in the method of Burbulla. It would have amounted to the simple substitution of one Cas9 nuclease for another by known means to yield predictable results. The skilled artisan would have expected that HiFi Cas9 could be used in Burbulla’s method because Skarnes teaches gene editing with HiFi Cas9 in iPSCs, the same type in Burbulla’s method. The skilled artisan would have been motivated to do so because Skarnes teaches HiFi Cas9 has reduced off-target cleavage and characterizes HiFi Cas9 as the “preferred” nuclease for editing iPSCs.
Claims 23, 26, 28, 31-32, 43-44 are rejected under 35 U.S.C. 103 as being unpatentable over Burbulla (Burbulla et al., Science Translational Medicine (2019), 11, eaau6870, pages 1-11 and Supplemental Material; of record) as applied to claims 1-2, 4-6, 9-10, 16, 20, 24, 47, 49-51 and 55, in view of Hanss (Hanss et al., Frontiers in Genetics (2020), 10: 1297, pages 1-9; published January 8, 2020). Claim 23 is evidenced by NEB (MseI, version 2.17.3, https://enzymefinder.neb.com/#!/name/MseI [retrieved August 7, 2025]). Claim 31 is evidenced by dpSNP (rs76763715, https://www.ncbi.nlm.nih.gov/snp/rs76763715 [retrieved August 7, 2025]). This rejection is also directed to the elected species of the rs76763715 SNP. Note that the rejection does not address the claims in numerical order for logistical purposes.
The teachings of Burbulla are recited above as for claims 1-2, 4-6, 9-10, 16, 20, 24, 47, 49-51 and 55, and incorporated here.
Burbulla does not teach the rs76763715 SNP or the GBA1 N370S mutation.
Hanss teaches transfecting iPSCs that are heterozygous for the GBA1 N370S allele (a gene variant associated with Parkinson’s Disease (PD)) with vectors encoding Cas9 and guide RNAs that target the SNP responsible for the GBA1 N370S allele (page 4, ¶3-4; Figure 1). Hanss teaches that the N370S-causing SNP is rs76763715 causing the c.1226A>G transition (page 2, ¶5). Hanss teaches also introducing a plasmid DNA donor comprising a nucleic acid sequence that is homologous to the GBA1 gene around the rs76763715 SNP and comprising the wild type SNP (page 2, ¶5; Figure 1). Hanss teaches introducing Cas9, the rs76763715-targeting guide RNA, and the donor plasmid DNA with the wild type SNP resulted in correction of the rs76763715 SNP (i.e., the corrected form of GBA1 has an arginine at residue 370) (Figures 1-2; page 4, ¶6). Hanss teaches that the integration of the donor DNA used homology directed repair (page 2, ¶5; Figure 1).
Regarding claims 26, 28 and 32, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used the Cas9/sgRNA/ssODN-editing method of Burbulla to correct the PD-causing, GBA1 N370S-encoding, rs76763615 SNP taught in Hanss. It would have amounted to the simple substitution of an ssODN comprising the corrected SNP for a plasmid donor comprising the corrected SNP. The skilled artisan would have predicted that using an ssODN would be successful for correction of the rs76763615 SNP because Burbulla demonstrates that using an ssODN with homology arms is efficient for gene correction via homology directed repair (HDR) in iPSCs and at the GBA1 locus. Because the prior art recognizes the equivalence of plasmids and ssODNs for the purpose of correcting a SNP via Cas9/sgRNA-mediated, HDR-mediated gene editing, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. MPEP 2144.06.II.
Regarding claim 31, Hanss teaches that the N370S-causing SNP is rs76763715 causing the c.1226A>G transition (page 2, ¶5). Hanss is silent regarding what strand the wildtype A nucleotide is referencing. dbSNP teaches the sequence of the GBA1 locus and the location of the rs76763715 SNP (page 7). dbSNP teaches the coding sequence for GBA1 is on the “lower” strand, which is complementary to the reference strand (page 7). dbSNP teaches that the rs76763715 SNP in reference to the top/reference strand is a T>C variant (pages 1 and 7). Therefore, the rs76763715 correction reported in Hanss would result in the thymine wildtype variant.
Regarding claims 43-44, Hanss teaches the sgRNA targeting sequence (i.e., the crRNA sequence) is CTAGAGCCTCCTGTACCATG (page 4, ¶3; Fig 1), which is homologous to the sequence around the GBA1 rs76763715 SNP (Fig 1A). Hanss teaches there is a PAM sequence adjacent to (i.e., immediately upstream) of the cleaved GBA1 sequence (Fig 1A).
Regarding claim 23, Hanss teaches the donor DNA also comprises a nucleic acid sequence TTAA that is not homologous to the GBA1 locus, which comprises TTAC (Fig 1A). Hanss teaches the purpose of using the nonhomologous TTAA site is for downstream analysis (page 2, ¶5; Fig 2E). Hanss is silent regarding whether the TTAA sequence introduces a restriction site into the target gene that is recognized by a restriction enzyme. NEB teaches that TTAA is the recognition site of the restriction enzyme MseI. Therefore, the donor DNA sequence, which would have been obvious to deliver as an ssODN, would inherently introduce a restriction site into the target gene that is recognized by one or more restriction enzymes.
Claim 52 is rejected under 35 U.S.C. 103 as being unpatentable over Burbulla (Burbulla et al., Science Translational Medicine (2019), 11, eaau6870, pages 1-11 and Supplemental Material; of record) and Hanss (Hanss et al., Frontiers in Genetics (2020), 10: 1297, pages 1-9; published January 8, 2020) as applied to claims 1-2, 4-6, 9-10, 16, 20, 23-24, 26, 28, 31-32, 43-44, 47, 49-51 and 55 above, and further in view of Renaud (Renaud et al., Cell Reports (2016), 14: 2263-2272).
The teachings of Burbulla, Hanss and NEB are recited above and applied as for claims 1-2, 4-6, 9-10, 16, 20, 23-24, 26, 28, 31-32, 43-44, 47, 49-51 and 55. Hanss teaches the donor DNA also comprises a nucleic acid sequence TTAA that is not homologous to the GBA1 locus, which comprises TTAC (Fig 1A).
Although TTAA is palindromic and recognized by a restriction enzyme, Burbulla and Hanss do not teach incorporating the TTAA sequence for the purpose of using the restriction site to identify cells in which the donor DNA was integrated into the targeted site.
Renaud teaches methods for genome editing using CRISPR-Cas9 technology and ssODNs (Abstract). Renaud teaches integrating a PvuII restriction site into the donor ssODN (page 2264, ¶3; Fig 1A). Renuad teaches the purpose of incorporating the PvuII site is to allow “for easy analysis by restriction fragment length polymorphism (RFLP)” (page 2264, ¶3). Renuad teaches isolating DNA from transfected cells and contacting the DNA with PvuII enzyme (Supp. Page 3, ¶3).
It would have been obvious to one skilled in the art to have further modified donor ssODN sequence rendered obvious above so as to include a restriction site that could be used to screen cells for ssODN incorporation by RFLP. It would have amounted to the simple combination of method steps by known means to yield predictable results. The skilled artisan would have predicted that the ssODN rendered obvious above could have additional nucleotide differences between the target DNA so as to introduce a restriction site because Hanss already teaches a donor DNA having three differences can be integrated via HDR. The skilled artisan would have been motivated to do so in order to “easily” screen the corrected cells using RFLP analysis.
Claim 46 is rejected under 35 U.S.C. 103 as being unpatentable over Burbulla (Burbulla et al., Science Translational Medicine (2019), 11, eaau6870, pages 1-11 and Supplemental Material; of record), Hanss (Hanss et al., Frontiers in Genetics (2020), 10: 1297, pages 1-9; published January 8, 2020) and Renaud (Renaud et al., Cell Reports (2016), 14: 2263-2272) as applied to claims 1-2, 4-6, 9-10, 16, 20, 23-24, 26, 28, 31-32, 43-44, 47, 49-52 and 55 above, and further in view of dpSNP (rs76763715, https://www.ncbi.nlm.nih.gov/snp/rs76763715 [retrieved August 7, 2025]), IDT (https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM [retrieved August 7, 2025]), Ran (Ran et al., Cell (2013), 154: 1380-1389) and NEB2 (https://www.neb.com/en-us/products/r0113-bstxi [retrieved August 7, 2025]). This rejection also addresses the elected species of SEQ ID NO 8 (crRNA sequence) and SEQ ID NO 3 (ssODN sequence).
The teachings of Burbulla, Hanss and NEB are recited above and applied as for claims 1-2, 4-6, 9-10, 16, 20, 23-24, 26, 28, 31-32, 43-44, 47, 49-52 and 55. Hanss teaches introducing silent mutations using the donor DNA so as to not disrupt the coding sequence of GBA1 (Figure 1A). Burbulla teaches that guide RNA sequences can be used for designing sgRNA targeting sequences, such as the Zhang Lab CRISPR Design Tool (page 8, ¶5). It is noted that the Zhang Lab tool is not available, but the Zhang lab web page suggests using additional online tools such as IDT (See https://zlab.squarespace.com/guide-design-resources).
Burbulla, Hanss and Renaud do not teach the specific guide RNA sequences and ssODN sequences recited in the claim.
dbSNP teaches the rs76763715 SNP was identified at least as early as 2014 in the 1000 Genomes project (page 5). dbSNP teaches the sequence of the GBA1 locus and the location of the rs76763715 SNP (page 7). dpSNP teaches that the rs76763715 SNP is near intronic DNA (page 7).
IDT teaches one guide RNA targeting sequence when the wildtype GBA1 sequence around the rs76763715 is queried is GGACAAAGGCAAAGAGACAA (page 6).
NEB2 teaches the recognition sequence for BstXI is CCANNNNNTGG (page 1).
Regarding the sgRNA targeting site, Ran teaches ssODN integration efficiencies using a SpCas9 nuclease with different guide RNA sequences and their distances from the HDR insertion site (Figure 4D). Ran teaches a cleavage site 32 nucleotides away from the nucleotide insertion site results in HDR integration (Figure 4D, see sgRNA 20 with Cas9 nuclease). Regarding the ssODN sequence, Burbulla teaches 80 nt of homology on either side of the correcting/nonhomologous sequence (page 8, ¶5). Ran teaches the ssODN has approximately 100 nt of homology on 5’ and 3’ of the inserted/nonhomologous sequence (Fig 4D).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used a sgRNA with SEQ ID NO 3 and an ssODN comprising SEQ ID NO 8 in the method of editing the rs76763715 SNP in the GBA1 gene using ssODNs and screening by RFLP analysis rendered obvious above. It would have amounted to designing sgRNAs and ssODN for targeting SNPs using known parameters to yield predictable results.
Regarding the sgRNA sequence, it would have been predictable that a sgRNA having a crRNA with SEQ ID NO 8 could be used in the method because the IDT online tool, that the Zhang Lab suggests, returns a targeting sequence with SEQ ID NO 8 as a suggested sgRNA. Additionally, Ran teaches that a sgRNA sequence that recruits Cas9 to cleave up to 32 bp away from the insertion site results in efficient integration of the ssODN. As such, the skilled artisan would predict that SEQ ID NO 8 would promote integration of an ssODN harboring the corrected nucleotide since an sgRNA with SEQ ID NO 8 would mediate Cas9 cleavage 25 bp from the corrected nucleotide (see dbSNP, page 7, arrow). From the choices provided by the IDT tool, the skilled artisan would have been motivated to try a sgRNA with SEQ ID NO 8 because it cleaves in an intronic region, and any indel formation at the cleavage site would not affect the coding sequence.
Regarding the ssODN sequence, the skilled artisan would predict that ssODN comprising SEQ ID NO 3 would promote rs76763715 SNP correction because SEQ ID NO 3 is nearly 100% homologous to the GBA1 sequence flanking the SNP. One would have been motivated to try SEQ ID NO 3 such that it incorporated a “g” as a nonhomologous nucleotide for the purpose of incorporating a novel restriction site at the edited locus. There are a finite number of restriction enzyme recognition sequences, all of which are well known in the art as evidenced by the NEB catalogue, of which two are specifically cited in this office action. The skilled artisan would have been motivated to specifically engineer the a>g so as to only introduce a silent mutation that would not affect the coding sequence of GBA1, as taught by Hanss.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-2, 4-6, 9-10, 12, 16, 20, 23-24, 26, 28, 31-32, 43-44, 46-47, 49-52 and 55 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-6, 9, 12, 15-16, 19-20, 23-24, 26, 28-33, 35-38 and 41 of copending Application No. 17/920711 in view of Hanss (Hanss et al., Frontiers in Genetics (2020), 10: 1297, pages 1-9; published January 8, 2020) and Burbulla (Burbulla et al., Science Translational Medicine (2019), 11, eaau6870, pages 1-11 and Supplemental Material; of record). Claim 46 is rejected further in view of dpSNP (rs76763715, https://www.ncbi.nlm.nih.gov/snp/rs76763715 [retrieved August 7, 2025]), IDT (https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM [retrieved August 7, 2025]), Ran (Ran et al., Cell (2013), 154: 1380-1389) and NEB2 (https://www.neb.com/en-us/products/r0113-bstxi [retrieved August 7, 2025])
Copending claim 1 recites A method of correcting a gene variant associated with Parkinson's Disease, the method comprising: introducing, into an induced pluripotent stem cell (iPSC), one or more agents comprising a recombinant nuclease for inducing a DNA break within an endogenous target gene in the cell, wherein the target gene is human LRRK2 and comprises a single nucleotide polymorphism (SNP) that is associated with Parkinson's Disease; and introducing into the cell a single-stranded DNA oligonucleotide (ssODN), wherein the ssODN is homologous to the target gene and comprises a corrected form of the SNP, wherein (i) the introducing of the one or more agents and the ssODN results in homology- directed repair (HDR) and integration of the ssODN into the target gene; and (ii) after the integration of the ssODN into the target gene, the target gene comprises the corrected form of the SNP instead of the SNP. Copending claim 2 recites wherein the DNA break is a double strand break (DSB) at a cleavage site within the endogenous target gene. Copending claim 3 recites wherein the recombinant nuclease is capable of cleaving both strands of double stranded DNA. Copending claims 4-6, 9-10 and 12 recite the recombinant nuclease is a Cas nuclease and a single guide RNA, the Cas is a Cas9 that has reduced off-target effector activity. Copending claim 16 recites wherein the ssODN comprises a nucleic acid sequence that is at least 80% substantially homologous to a targeting sequence in the target gene, wherein the targeting sequence comprises the SNP, and (ii) is not homologous to the targeting sequence at the nucleotide of the SNP. Copending claim 20 recites wherein the targeting sequence comprises a protospacer adjacent motif (PAM) sequence. Copending claim 23 recites wherein the ssODN comprises a nucleic acid sequence that comprises one or more nucleotides that are not homologous to the corresponding nucleotides of the targeting sequence, and wherein the one or more nucleotides comprises one or more nucleotides that introduce a restriction site into the target gene that is recognized by one or more restriction enzymes. Copending claim 24 recites wherein the corrected form of the SNP is not associated with PD and/or is a wildtype form of the SNP. Copending claim 31 recites wherein the sgRNA comprises a CRISPR targeting RNA (crRNA) sequence that is homologous to a sequence in the target gene that includes the cleavage site. Copending claims 32 recites wherein the sequence in the target gene that includes the cleavage site is immediately upstream of the PAM sequence. Copending claim 33 recites wherein the recombinant nuclease lacks the ability to induce a DSB by cleaving both strands of double stranded DNA. Copending claim 35 recites wherein (a) the recombinant nuclease is a Cas nuclease comprising one or more mutations such that the Cas nuclease is converted into a nickase that lacks the ability to cleave both strands of a double stranded DNA molecule; and/or (b) the recombinant nuclease is a Cas nuclease comprising one or more mutations such that the Cas nuclease is converted into a nickase that is able to cleave only one strand of a double stranded DNA molecule. Copending claims 36-37 recite wherein the iPSC is artificially derived from a non-pluripotent cell from a subject having Parkinson’s Disease. Copending claim 41 recites wherein, after integration of the ssODN into the target gene, the method further comprises determining whether the cell comprises an integrated ssODN.
The copending claims do not recite the target gene is GBA1 or the rs76763715 N370S-causing SNP or the specific sgRNA or ssODN sequences recited in instant claim 46.
Hanss teaches transfecting iPSCs that are heterozygous for the GBA1 N370S allele (a gene variant associated with Parkinson’s Disease (PD)) with vectors encoding Cas9 and guide RNAs that target the SNP responsible for the GBA1 N370S allele (page 4, ¶3-4; Figure 1). Hanss teaches that the N370S-causing SNP is rs76763715 causing the c.1226A>G transition (page 2, ¶5). Hanss teaches also introducing a donor DNA comprising a nucleic acid sequence that is homologous to the GBA1 gene around the rs76763715 SNP and comprising the wild type SNP (page 2, ¶5; Figure 1). Hanss teaches introducing Cas9, the rs76763715-targeting guide RNA, and the plasmid comprising the donor DNA with the wild type SNP resulted in correction of the rs76763715 SNP (i.e., the corrected form of GBA1 has an arginine at residue 370) (Figures 1-2; page 4, ¶6). Hanss teaches that the integration of the donor DNA used homology directed repair (page 2, ¶5; Figure 1).
Burbulla teaches using CRISPR-Cas9 editing of the PD-associated SNP c.84dupGG in the GBA1 gene in iPSCs (Fig. S2; page 3, ¶1; page 8, ¶5). Burbulla teaches transfecting (i.e., introducing into) iPSCs comprising the SNP with 1) a plasmid encoding SpCas9n and single guide RNAs targeting the SNP, and 2) an ssODN comprising the SNP correction (page 8, ¶5; Fig S2). Burbulla teaches using ssODNs with right and left homology arms on either side of the mutation correction site for homologous recombination (page 8, ¶5; Fig S2). Burbulla teaches correction of the targeted SNP (Fig. S2).
Regarding claims 1-2, 4-6, 9-10, 12, 16, 20, 23-24, 26, 28, 31-32, 43-44, 47, 49-52 and 55, it would have been obvious to use the copending method to correct the rs76763715 SNP taught in Hanss. It would have amounted to using the copending method to correct a different PD-causing mutation by known means to yield predictable results. The skilled artisan would have predicted that the copending method using an ssODN could be used to correct the rs76763715 SNP because Burbulla teaches the Cas9/sgRNA/ssODN HDR methods can be used to correct PD-causing mutations in the GBA1 gene. One would have been motivated to do so because Hanss teaches the rs76763715 SNP is risk factor for developing PD.
Regarding claim 46, dbSNP teaches the rs76763715 SNP was identified at least as early as 2014 in the 1000 Genomes project (page 5). dbSNP teaches the sequence of the GBA1 locus and the location of the rs76763715 SNP (page 7). dpSNP teaches that the rs76763715 SNP is near intronic DNA (page 7). IDT teaches one guide RNA targeting sequence when the wildtype GBA1 sequence around the rs76763715 is queried is GGACAAAGGCAAAGAGACAA (page 6). NEB2 teaches the recognition sequence for BstXI is CCANNNNNTGG (page 1).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have further used a sgRNA with SEQ ID NO 3 and an ssODN comprising SEQ ID NO 8 in the variation of the copending method of editing the rs76763715 SNP in the GBA1 gene using ssODNs and screening by RFLP analysis rendered obvious above. It would have amounted to designing sgRNAs and ssODN for targeting SNPs using known parameters to yield predictable results. Regarding the sgRNA sequence, it would have been predictable that a sgRNA having a crRNA with SEQ ID NO 8 could be used in the obvious variation of the copending method because the IDT online tool, that Burbulla and the Zhang Lab suggests, returns that sgRNA targeting sequence as a suggested sgRNA. Additionally, because Ran teaches that a sgRNA sequence that recruits Cas9 to cleave up to 32 bp away from the insertion site results in efficient integration of the ssODN, the skilled artisan would predict that SEQ ID NO 8 would promote integration of an ssODN harboring the corrected nucleotide since an sgRNA with SEQ ID NO 8 would mediate Cas9 cleavage 25 bp from the corrected nucleotide (see dbSNP, page 7, arrow). From the choices provided, the skilled artisan would have been motivated to try a sgRNA with SEQ ID NO 8 because it cleaves in an intronic region, and any indel formation at the cleavage site would not affect the coding sequence.
Regarding the ssODN sequence, the skilled artisan would predict that ssODN comprising SEQ ID NO 3 would promote rs76763715 SNP correction because SEQ ID NO 3 is nearly 100% homologous to the GBA1 sequence flanking the SNP. One would have been motivated to try SEQ ID NO 3 such that it incorporated a “g” as a nonhomologous nucleotide for the purpose of incorporating a novel restriction site at the edited locus. There are a finite number of restriction enzyme recognition sequences, all of which are well known in the art as evidenced by the NEB catalogue, of which two are specifically cited in this office action. The skilled artisan would have been motivated to specifically engineer the a>g so as to only introduce a silent mutation that would not affect the coding sequence of GBA1, as taught by Hanss.
This is a provisional nonstatutory double patenting rejection.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Examiner, Art Unit 1635