Prosecution Insights
Last updated: April 19, 2026
Application No. 17/920,752

BIFUNCTIONAL MOLECULES AND METHODS OF USING THEREOF

Final Rejection §102§103§112§DP
Filed
Oct 21, 2022
Examiner
GIBBS, TERRA C
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Flagship Pioneering Inc.
OA Round
2 (Final)
64%
Grant Probability
Moderate
3-4
OA Rounds
2y 9m
To Grant
74%
With Interview

Examiner Intelligence

Grants 64% of resolved cases
64%
Career Allow Rate
606 granted / 946 resolved
+4.1% vs TC avg
Moderate +10% lift
Without
With
+10.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 9m
Avg Prosecution
41 currently pending
Career history
987
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
32.8%
-7.2% vs TC avg
§102
18.4%
-21.6% vs TC avg
§112
26.7%
-13.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 946 resolved cases

Office Action

§102 §103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION This Office Action is a response to Applicant’s Amendment and Remarks filed January 13, 2026. Claims 1, 3-16, 18-21 and 24-28 have been canceled. New claims 33-48 are acknowledged. Claims 29-48 are pending in the instant application. Accordingly, claims 29-48 have been examined on the merits as detailed below: The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claim Rejections - 35 USC § 112 In the previous Office Action mailed August 13, 2025, claims 1, 3-10, 12-16, 24-26 and 30-32 were rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. This rejection is moot against claims 1, 3-16, 18-21 and 24-28 in view of Applicant’s Amendment to cancel these claims filed January 13, 2026. This rejection is withdrawn against the remaining claims in view of Applicant’s Amendment to the claims filed January 13, 2026. ****** In the previous Office Action mailed August 13, 2025, claims 1, 11, 18-21 and 27-29 were rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. This rejection is moot against claims 1, 11, 18-21 and 27 in view of Applicant’s Amendment to cancel these claims filed January 13, 2026. This rejection is withdrawn against the remaining claims in view of Applicant’s Amendment to the claims filed January 13, 2026. Claim Rejections - 35 USC § 102 In the previous Office Action mailed August 13, 2025, claims 1, 11, 18-21 and 27 were rejected under 35 U.S.C. 102(a)(1) as being anticipated by Espinoza et al. MOLECULAR THERAPY, Vol. 28, no. 2, 1 February 2020 (2020-02-01), pages 642-652. This rejection is moot in view of Applicant’s Amendment filed January 13, 2026 to cancel claims 1, 11, 18-21 and 27. Non-Statutory Double Patenting In the previous Office Action mailed August 13, 2025, claims 1, 11, 18-21 and 27-29 were rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5, 11, 15, 16, and 25-45 of copending U.S. Application 17/914,307. This rejection is moot in view of Applicant’s Amendment filed January 13, 2026 to cancel claims 1, 11, 18-21 and 27. This rejection is maintained against the remaining claims for the reasons of record set forth in the previous Office Action mailed August 13, 2025. Response to Applicant’s Arguments In response to this rejection, Applicant note that the rejection is provisional in nature and will address the obviousness-type double patenting rejection upon indication that the claims are otherwise allowable. The Examiner acknowledges Applicant’s note and maintains that the claims of copending U.S. Application 17/914,307 overlaps in scope and fully embraces that which is claimed in the instant invention. The rejection is therefore maintained. ****** In the previous Office Action mailed August 13, 2025, claim 29 was rejected on the ground of nonstatutory double patenting as being unpatentable over claim 31 of copending U.S. Application 17/920,769. This rejection is maintained for the reasons of record set forth in the previous Office Action mailed August 13, 2025. Response to Applicant’s Arguments In response to this rejection, Applicant note that the rejection is provisional in nature and will address the obviousness-type double patenting rejection upon indication that the claims are otherwise allowable. The Examiner acknowledges Applicant’s note and maintains that the claim of copending U.S. Application 17/920,769 overlaps in scope and fully embraces that which is claimed in the instant invention. The rejection is therefore maintained. Applicant’s Amendment filed January 13, 2026 necessitated a new grounds of rejection as presented below: In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 29, 30, 37, 40, 41, 43 and 46 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Kim et al. (Biotechnol. Prog. 2007 Vol. 23:232-237) as evidenced by PubMed - Folic Acid, downloaded from Folic Acid | C19H19N7O6 | CID 135398658 - PubChem on January 22, 2026. The claims are drawn to a synthetic bifunctional molecule comprising: a first domain comprising an antisense oligonucleotide (ASO), wherein the first domain specifically binds to an RNA sequence of a target ribonucleic acid (RNA); a second domain comprising a small molecule having a molecular weight of 900 daltons or less, wherein the second domain specifically binds to a target polypeptide; and a linker that conjugates the first domain to the second domain. Kim et al. disclose an ODN-PEG-FOL conjugate. See Figure 1. In this example, ODN is the first domain (ASO); FOL is the second domain (small molecule); and PEG is the linker that conjugates the first domain to the second domain. The ASO comprises phosphorothioate-modified oligonucleotides. The ASO sequence is 5’-GAGCTGCACGCTGCCGTC-3' and therefore comprises 30% to 60% GC content. NOTE: FOL is 441 daltons as evidenced by PubMed - Folic Acid, downloaded from Folic Acid | C19H19N7O6 | CID 135398658 - PubChem on January 22, 2026. Therefore, claims 29, 30, 37, 40, 41, 43 and 46 are anticipated by Kim et al. ****** Claims 29, 30, 37, 41, 42, 43, 45 and 46 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by WO 2011126937 A1 (hereinafter, “’937”) as evidenced by Google AI Overview, how many daltons is anisamide? - Google Search downloaded on January 22, 2026. ‘937 teaches an antisense oligonucleotide (AON) conjugated to a small molecule ligand for a membrane bound protein. See pages 1-4, 23, and 59-66 and Figure 1, for example. The ligand is coupled to the antisense oligonucleotide through a linking group, wherein the linker is conjugated at the 5’ end of the AON. An antisense oligonucleotide (Oligo 623) having 2’-O-methyl RNA with a phosphorothioate backbone was conjugated (via diethylene glycol linker) to an anisamide, high affinity ligand for sigma receptors. See page 49. NOTE: Anisamide is 151 daltons as evidenced by Google AI Overview, how many daltons is anisamide? - Google Search downloaded on January 22, 2026. The AON (Oligo 623) is 20 nucleotides in length (GTTATTCTTTAGAATGGTGC, Scheme 1, page 52). ‘937 also teaches that upon adequate delivery oligo 623 to the nucleus, the intron is spliced out and luciferase is expressed. Therefore, claims 29, 30, 37, 41, 42, 43, 45 and 46 are anticipated by WO 2011126937. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 29-31, 37-39 and 41-48 are rejected under 35 U.S.C. 103 as being unpatentable over WO 2011126937 A1 (hereinafter, “’937”). The claims are as described above. ‘937 is relevant and relied upon in its entirety. ‘937 teaches an antisense oligonucleotide (AON) conjugated to a small molecule ligand for a membrane bound protein. See pages 1-4, 23, and 59-66 and Figure 1, for example. The ligand is coupled to the antisense oligonucleotide through a linking group, wherein the linker is conjugated at the 5’ end of the AON. An antisense oligonucleotide (Oligo 623) having 2’-O-methyl RNA with a phosphorothioate backbone was conjugated (via diethylene glycol linker) to an anisamide, high affinity ligand for sigma receptors. See page 49. NOTE: Anisamide is 151 daltons as evidenced by Google AI Overview, how many daltons is anisamide? - Google Search downloaded on January 22, 2026. The AON (Oligo 623) is 20 nucleotides in length (GTTATTCTTTAGAATGGTGC, Scheme 1, page 52). ‘937 also teaches that upon adequate delivery oligo 623 to the nucleus, the intron is spliced out and luciferase is expressed. ‘937 teaches several dozen embodiments in which the antisense oligonucleotide of their invention silences targeted genes (e.g. Erb-B; JNK; JUN; EGFR; Cyclin E; PKC; NFKB, Ras, MEKK, Raf, MYB, etc.), and mutations in tumor suppressor genes, thus treating a subject having a disease or disorder. ‘937 teach the diethylene glycol linker, but does not teach the linker comprising the structures in present claim 31. However, a person of ordinary skill in the art would have been motivated to substitute the diethylene glycol linker of ‘937 with the linker comprising the structures in present claim 31 as presently claimed since they are functional equivalents of each other, and it is obvious to substitute one functional equivalent for another, particularly when they are to be used for the same purpose. See MPEP 2144.06. Furthermore, KSR forecloses that the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. See Board Decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d). Also, see M.P.E.P. §2144.07 which states, "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. ‘937 teach (Oligo 623) comprising 2’-O-methyl RNA with a phosphorothioate backbone, but does not teach locked nucleosides as recited in present claims 38 and 39. However, a person of ordinary skill in the art would have been motivated to substitute the ASO chemical modifications which confer oligonucleotide stability of ‘937 with the ASO chemical modifications which confer oligonucleotide stability recited claims 38 and 39 as presently claimed since they are functional equivalents of each other, and it is obvious to substitute one functional equivalent for another, particularly when they are to be used for the same purpose. See MPEP 2144.06. Furthermore, KSR forecloses that the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. See Board Decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d). Also, see M.P.E.P. §2144.07 which states, "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. Before the effective filing date of the claimed invention, it would have been obvious to devise the synthetic bifunctional molecule comprising: a first domain comprising an antisense oligonucleotide (ASO), wherein the first domain specifically binds to an RNA sequence of a target ribonucleic acid (RNA); a second domain comprising a small molecule having a molecular weight of 900 daltons or less, wherein the second domain specifically binds to a target polypeptide; and a linker that conjugates the first domain to the second domain of the claimed invention as taught and suggested by ‘937. It would have been obvious and one of skill in the art would have expected reasonable success to chemically modify the ASO for the purpose of increasing stability of the ASO and for the purpose of increasing delivery of the oligonucleotide as taught by ‘937. Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed. ****** Claims 29 and 32 are rejected under 35 U.S.C. 103 as being unpatentable over WO 2011126937 A1 (hereinafter, “’937”) as evidenced by Hong et al. (Cancer Res. 2023 Mar 15;83(6):845-860). ‘937 is relevant and relied upon in its entirety and as discussed supra. ‘937 are explicit in teaching: "Small organic molecule" as used herein refers to organic compounds having a molecular weight of more than about 10 Daltons and less than about 5,000 Daltons, of more than about 40 Daltons and less than about 3,000 Daltons, or of more than about 100 Daltons and less than about 2,500 Daltons”. ‘937 teach that exemplary small organic molecules include tegaserod, for example. NOTE: Tegaserod targets the YTHDF1 polypeptide as evidenced by Hong et al. Before the effective filing date of the claimed invention, it would have been obvious to devise the synthetic bifunctional molecule comprising: a first domain comprising an antisense oligonucleotide (ASO), wherein the first domain specifically binds to an RNA sequence of a target ribonucleic acid (RNA); a second domain comprising a small molecule having a molecular weight of 900 daltons or less, wherein the second domain specifically binds to a target polypeptide; and a linker that conjugates the first domain to the second domain of the claimed invention as taught and suggested by ‘937. It would have been obvious and one of skill in the art would have expected reasonable success to make and use the synthetic bifunctional molecule comprising ASO and tegaserod as the small molecule since ‘937 teaches synthetic bifunctional molecules have been developed as and successfully tested for in vitro or in vivo use. Therefore, the subject matter of claims 29 and 32 are obvious over WO 2011126937. ****** Claims 29 and 33-36 are rejected under 35 U.S.C. 103 as being unpatentable over WO 2011126937 A1 (hereinafter, “’937”) in view of Sadar et al. (J Hematol. 2019;8(1):1-10). ‘937 is relevant and relied upon in its entirety and as discussed supra. ‘937 are explicit in teaching: "Small organic molecule" as used herein refers to organic compounds having a molecular weight of more than about 10 Daltons and less than about 5,000 Daltons, of more than about 40 Daltons and less than about 3,000 Daltons, or of more than about 100 Daltons and less than about 2,500 Daltons”. However, ‘937 does not teach the small molecule is ibrutinib. Sadar et al. teach the efficacy of an ibrutinib-based regimen in chronic lymphocytic leukemia. See Abstract, for example. Also, see Table 1. NOTE: Ibrutinib targets the polypeptides EIF4E and BTK as evidenced by Del Papa et al. (Clin Cancer Res (2019) 25 (24): 7540-7553) and Sadar et al., respectively. The present Specification discloses and identifies that a derivative of Ibrutinib is Ibrutinib-MPEA. A person of ordinary skill in the art would have been motivated to substitute ibrutinib of Sadar et al. with ibrutinib-MPEA as presently claimed since they are functional equivalents of each other, and it is obvious to substitute one functional equivalent for another, particularly when they are to be used for the same purpose. See MPEP 2144.06. Furthermore, KSR forecloses that the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. See Board Decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d). Also, see M.P.E.P. §2144.07 which states, "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. Before the effective filing date of the claimed invention, it would have been obvious to devise the synthetic bifunctional molecule comprising: a first domain comprising an antisense oligonucleotide (ASO), wherein the first domain specifically binds to an RNA sequence of a target ribonucleic acid (RNA); a second domain comprising a small molecule having a molecular weight of 900 daltons or less, wherein the second domain specifically binds to a target polypeptide; and a linker that conjugates the first domain to the second domain of the claimed invention as taught and suggested by ‘937. It would have been obvious for a person of ordinary skill in the art to modify the teachings of ‘937 to include ibrutinib as the small molecule for the purpose of additive effects of inhibiting leukemia with ASO targeted to Ras, MEKK, Raf, MYB, etc., for example. It would have been obvious and one of skill in the art would have expected reasonable success to make and use the synthetic bifunctional molecule comprising ASO and ibrutinib as the small molecule since ‘937 teaches synthetic bifunctional molecules have been developed as and successfully tested for in vitro or in vivo use. Therefore, the subject matter of claims 29 and 33-36 are obvious over WO 2011126937 in view of Sadar et al. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the Examiner should be directed to Terra C. Gibbs whose telephone number is 571-272-0758. The Examiner can normally be reached from 8 am - 5 pm M-F. If attempts to reach the Examiner by telephone are unsuccessful, the Examiner's supervisor, Ram Shukla can be reached on 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free)? If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO's Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO's Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO's PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199. /TERRA C GIBBS/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Oct 21, 2022
Application Filed
Aug 10, 2025
Non-Final Rejection — §102, §103, §112
Nov 11, 2025
Interview Requested
Dec 03, 2025
Examiner Interview Summary
Jan 13, 2026
Response Filed
Jan 27, 2026
Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600998
Large Scale Synthesis of Messenger RNA
2y 5m to grant Granted Apr 14, 2026
Patent 12590129
LIVER-SPECIFIC REGULATORY NUCLEIC ACID SEQUENCES
2y 5m to grant Granted Mar 31, 2026
Patent 12590305
COMPLEMENT COMPONENT C5 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Mar 31, 2026
Patent 12584128
COMPOSITIONS FOR MODULATING ATAXIN 2 EXPRESSION
2y 5m to grant Granted Mar 24, 2026
Patent 12569561
DOUBLE STRANDED OLIGONUCLEOTIDE CONSTRUCT COMPRISING ANDROGEN RECEPTOR SPECIFIC SEQUENCE, AND COMPOSITION FOR PREVENTING HAIR LOSS AND PROMOTING HAIR GROWTH COMPRISING SAME
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
64%
Grant Probability
74%
With Interview (+10.4%)
2y 9m
Median Time to Grant
Moderate
PTA Risk
Based on 946 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month