DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Withdrawn Rejections/Objections
The rejection of claims 3, 5, 50, and 52, under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement, is withdrawn. Amendments to the claims remove the recitation lacking written description.
The rejection of claims 40 and 87, on the basis that it contains an improper Markush grouping of alternatives, is withdrawn. The amendment remove the list of species in both claims.
The objection to claims 57, 59, and 87 for being substantial duplicates of claims 10, 12, and 40 under 37 CFR 1.75 as being a substantial duplicate thereof is withdrawn. The amendments to the claims overcome this objection.
The rejection of claim(s) 1, 2, 6-7,9-10, 12, 40, 48-49, 53, 56-57, 59, and 87, under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Weinstein (US2011/0030072 A1 pub date:2/3/2011 and effectively filed 1/26/2009), is withdrawn. The amendments require chimeric CD94 comprising a human or humanized CD94 extracellular region and an endogenous CD94 cytoplasmic region or chimeric NGK2A comprising a human or humanized NGK2A extracellular region and an endogenous NGK2A cytoplasmic region. Weinstein discloses replace of the whole immunodefiency protein gene in the non-human animal is whole human orthology, not a human-nonhuman chimeric CD94 or NGK2A protein.
The rejection of claim(s) 3 and 5, under 35 U.S.C. 103 as being unpatentable over Weinstein as applied to claims 1, 2, 6-7,9-10, 12, 40 above, and further in view of Chang (US 5, 811, 284 pub date: 9/22/1998), is withdrawn. Weinstein does not disclose the chimeric CD94 or chimeric NGK2A as discussed above and Chang does not supplement the deficiency.
The rejection of claim(s) 50 and 52, under 35 U.S.C. 103 as being unpatentable over Weinstein as applied to claims 48-50, 56-57, 59, and 87 above, and further in view of Houchins (US 6,262,244 pub date: 7/17/2001), is withdrawn. Weinstein does not disclose the chimeric CD94 or chimeric NGK2A as discussed above and Houchins does not supplement the deficiency.
The following new objections/rejections are necessitated by the amendments to the claims:
Claim Objections
Claim 10 is objected to because of the following informalities: Claim 10 is amended to recite, “an MHC class I molecule”. This is grammatically incorrect. Amending the recitation to state “a MHC class I molecule” would be remedial. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-3, 5-7, 10, 12, 40, 48-50, 52-53, 57, 59, and 87 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Independent claim 1 recites, by amendment, “an endogenous CD94 cytoplasmic region”.
Independent claim 48 recites, by amendment, “an endogenous NKG2A cytoplasmic region”.
The term “endogenous” is relative to the its origin. As such, in the context of these claims, it is not apparent to whom the cytoplasmic region is endogenous because the claims do not specify the origin or source. As reading of the specification provides examples wherein “endogenous cytoplasmic region” is endogenous to the non-human animal. If Applicant intends the “endogenous cytoplasmic region” to mean endogenous to the non-human animal, amendment the claims to recite “a CD94 cytoplasmic region endogenous to the non-human animal” in claim 1 and “a NKG2A cytoplasmic region endogenous to the non-human animal” in claim 48.
The remainder of the claims are dependent claims and thus also comprise the indefinite subject matter.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-3, 5-7, 10, 12, 40, 48-50, 52-53, 57, 59, and 87 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for the following:
Claim 1. A genetically-modified, non-human animal whose genome comprises at homozygous replacement of the nucleic acid encoding the extracellular region of the CD94 endogenous to the animal with a nucleic acid encoding a human or a humanized CD94 extracellular region to produce a nucleic acid encoding a chimeric CD94 in the animal, wherein the chimeric CD94 is expressed by the animal in claim of its endogenous CD94 gene; and
Claim 48. A genetically-modified, non-human animal whose genome comprises at homozygous replacement of the nucleic acid encoding the extracellular region of the NKG2A endogenous to the animal with a nucleic acid encoding a human or a humanized NKG2A extracellular region to produce a nucleic acid encoding a chimeric NKG2A in the animal, wherein the chimeric NKG2A is expressed by the animal in claim of its endogenous CD94 gene; and
The specification does not reasonably provide enablement for:
1) a genetically modified animal whose genome comprises the claimed chimeric CD94 and/or NKG2A nucleic acid sequence introduced by random integration, wherein the animal’s endogenous CD94 and/or NKG2A is still expressed; and
2) a genetically modified animal whose genome comprises heterozygous replacement of the animal’s endogenous CD94 and/or NKG2A genes with the claimed chimeric form(s), wherein the animal’s endogenous CD94 and/or NKG2A is still expressed;
3) a genetically modifed animal as claim that only has one cell that expresses the CD94 and/or NKG2A gene.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
While determining whether a specification is enabling, one considers whether the claimed invention provides sufficient guidance to make and use the claimed invention, if not, whether an artisan would require undue experimentation to make and use the claimed invention and whether working examples have been provided. When determining whether a specification meets the enablement requirements, some of the factors that need to be analyzed are: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and whether the quantity of any necessary experimentation to make and use the invention based on the content of the disclosure is “undue”.
Nature of Invention: The claims are directed to genetically modified animals comprising a humanized form of the CD94 and/or NKG2A gene.
Breadth of the Claims: The claims broadly recite, “at least one chromosome comprising a sequence encoding a chimeric… CD94” or “at least one chromosome comprising a sequence encoding a chimeric… NKG2A”. The breadth of this recitation encompasses any one chromosome having one or more copies of the introduced sequence by random integration, many copies of the introduced sequence anywhere in the chromosomal genome by random integration, a targeted insertion of the introduced sequence anywhere in in the genome in one or many chromosomes, a targeted insertion of the introduced sequence into the one or both copies of the animal’s endogenous CD94 gene or NKG2A gene. The claims do not recite that the CD94 gene or the NKG2A gene endogenous to the animal is disrupted and not expressed. As such, breadth of the claims encompasses any of the above described genomic configurations leaving the CD94 gene and/or the NKG2A gene endogenous to the animal intact and expressed by the animal. The breadth of also encompasses disrupting the CD94 gene and/or the NKG2A gene endogenous to the animal wherein it is not expressed by the animal and the chimeric form replaces the expression of the animal’s endogenous counterparts. The claims also recite, “one or more cells expressing the chimeric” CD94 or NKG2A, meaning as little as one cell expressed the chimeric form and the rest express the wildtype form or do not express any form.
Specification Guidance: The specification describes the following (citations from the pre-grant publication):
[0005] Because the amino acid sequences of human CD94 and NKG2A are significantly different from the corresponding proteins in rodents (e.g., the sequence identity between human and mouse CD94 protein sequences is only about 55% (See FIG. 21), and the sequence identity between human and mouse NKG2A protein sequences is only about 42% (See FIG. 23)), antibodies targeting human CD94 or NKG2A protein usually do not recognize mouse CD94 or NKG2A protein, respectively. Therefore, wild-type mice cannot be used to screen and evaluate the efficacy of drugs targeting the NKG2A and its ligand CD94. In order to make pre-clinical trials more effective and minimize the failure rate of research and development, there is an urgent need in the field to develop a humanized non-human animal model of CD94 and/or NKG2A.
[0201] Experimental animal models are an indispensable research tool for studying the effects of these antibodies (e.g., CD94 or NKG2A antibodies). Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish and so on. However, there are many differences between human and animal genes and protein sequences, and many human proteins cannot bind to the animal’s homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments. A large number of clinical studies are in urgent need of better animal models. With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal’s endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening at animal levels.
Working Examples: The specification teaches the following (citations from the pre-grant publication:
Example 1: Mice With Humanized CD94 Gene
[0470] In this example, a non-human animal (e.g., a mouse) was modified to include a nucleotide sequence encoding human CD94 protein, and the obtained genetically-modified non-human animal can express a human or humanized CD94 protein in vivo. The mouse CD94 gene (NCBI Gene ID: 16643, Primary source: MGI: 1196275, UniProt ID: O54707) is located at 129588092 to 129598775 of chromosome 6 (NC_000072.6), and the human CD94 gene (NCBI Gene ID: 3824, Primary source: HGNC: 6378, UniProt ID: Q13241) is located at 10238383 to 10329608 of chromosome 12 (NC_000012.12). The mouse CD94 transcript is NM_010654.4, and the corresponding protein sequence NP_034784.1 is set forth in SEQ ID NO: 1. The human CD94 transcript is NM_001351062.1, and the corresponding protein sequence NP_001337991.1 is set forth in SEQ ID NO: 2. Mouse and human CD94 gene loci are shown in FIG. 1A and FIG. 1B, respectively.
[0471] Genetically modified non-human animals can be generated by several gene editing techniques that are known in the art, including but not limited to, zinc finger nucleases (ZFN), transcription activator-like effector-based nucleases (TALEN), homing endonucleases (megakable base ribozyme), the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system, or other molecular biology techniques. In this example, a nucleotide sequence encoding human CD94 protein was introduced into the endogenous mouse CD94 locus, such that the mouse can express a human or humanized CD94 protein. The method can include insertion of a sequence including a human CD94 gene sequence into the mouse endogenous CD94 locus. For example, the inserted sequence can include a human CD94 DNA or cDNA sequence. It is also possible to include an auxiliary sequence (e.g., a stop codon or a sequence having termination functions, etc.) or to use other methods (e.g., flipping or knocking out) to inactivate the mouse endogenous CD94 gene. The strategy of in situ replacement can also be used, e.g., a direct replacement with human CD94 gene sequence (DNA or cDNA sequence) on the mouse endogenous CD94 gene locus. Here, an in situ replacement strategy of CD94 DNA sequence was used to illustrate how to humanize the mouse CD94 gene.
[0472] Mouse cells can be modified by various gene-editing techniques, for example, replacement of specific mouse CD94 gene sequences with human CD94 gene sequences at the endogenous mouse CD94 locus. For example, under control of a mouse CD94 regulatory element, a 4731 bp sequence spanning from exon 3 (including a part of exon 3) to exon 6 (including a part of exon 6) of the mouse CD94 gene can be replaced with a corresponding 5157 bp sequence spanning from exon 4 (including a part of exon 4) to exon 7 (including a part of exon 7) of the human CD94 gene, to obtain a humanized mouse CD94 gene locus as shown in FIG. 2, thereby humanizing mouse CD94 gene.
[0473] As shown in the schematic diagram of the targeting strategy in FIG. 3, the targeting vector includes an upstream homologous arm, a downstream homologous arm, and a knock-in (KI) fragment including a human CD94 gene sequence. Sequence of the upstream homologous arm (5′ homologous arm, SEQ ID NO: 3; 3601 bp) is identical to nucleotide sequence of 129590135-129593735 of NCBI accession number NC_000072.6, and sequence of the downstream homologous arm (3′ homologous arm, SEQ ID NO: 4; 4488 bp) is identical to nucleotide sequence of 129599166-129603653 of NCBI accession number NC_000072.6. The KI fragment comprises a sequence spanning from exon 4 (including a part of exon 4) to exon 7 (including a part of exon 7) of a human genomic CD94 gene (SEQ ID NO: 5; 5157 bp), which is identical to nucleotide sequence of 10309634-10314790 of NCBI accession number NC_000012.12.
[0474] The upstream of the KI fragment containing the human CD94 gene sequence is directly connected to the 5′ homologous arm, and the connection between the downstream of the human CD94 gene sequence and the mouse CD94 gene locus was designed as: 5′-GAAGATAAAAATCGTTATATCTGTAAGCAACAGCTCATTTAAATGTTTCTTAAGGCA AAGGGTATAGACAAGGAAGGTCC -3′ (SEQ ID NO: 6), wherein the last “T” in sequence “TCATT” is the last nucleotide of the human sequence, and the first “T” of the sequence “TAAAT” is the first nucleotide of the mouse sequence. The mRNA sequence of the engineered mouse CD94 after humanization and its encoded protein sequence are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.
[0475] The CD94 gene targeting vector also included an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase gene, or Neo), and two Frt recombination sites flanking the antibiotic resistance gene, that formed a Neo cassette. The connection between the upstream of the Neo cassette and the mouse CD94 gene locus was designed as: 5′-AAGTATGGTAACATATCATCTGCGGATGAAGCTTGATATCGAATTCCGAAGTTCCTA TTCTCTAGAAAGTATAGGAACTT -3′ (SEQ ID NO: 9), wherein the last “G” of the sequence “GATG” is the last nucleotide of the mouse sequence, and the first “A” of the sequence “AAGC” is the first nucleotide of the Neo cassette. The connection between the downstream of the Neo cassette with the mouse CD94 sequence was designed as 5′-TATTCTCTAGAAAGTATAGGAACTTCATCAGTCAGGTACATAATGGTGGATCCAGGC CTGATGTGGTTTGATTGGTTCTGTTCCT -3′ (SEQ ID NO: 10), wherein the “T” of the sequence “GCCT” is the last nucleotide of the Neo cassette, and the first “G” of the sequence “GATGT” is the first nucleotide of the mouse sequence. In addition, a coding gene with a negative selectable marker (a gene encoding diphtheria toxin A subunit (DTA)) was also inserted downstream of the 3′ homologous arm of the targeting vector.
[0476] The targeting vector used for replacement of a mouse CD94 gene sequence with the corresponding human CD94 gene sequence was constructed, e.g., by restriction enzyme digestion and ligation, or synthesized directly. Mouse and human CD94 DNA were obtained from bacterial artificial chromosome (BAC) clones RP23-208D19 and RP11-282C10, respectively. The constructed targeting vector sequence was preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. The correct targeting vector was electroporated and transfected into embryonic stem cells of C57BL/6 mice. The positive selectable marker gene was used to screen the cells, and the integration of exogenous genes was confirmed by PCR and Southern Blot. Specifically, positive clones identified by PCR were further confirmed by Southern Blot to screen out correct positive clone cells used for blastocyst injection.
[0477] Either the primers CD94-F1 and CD94-R1, or primers CD94-F2 and CD94-R2, were used for PCR amplification, and 9 clones were identified as positive clones with numbers 1-A09, 2-B09, 2-C02, 2-D02, 2-H10, 3-B12, 3-D05, 4-C03, and 4-G06. The positive clones identified by PCR were then verified by Southern Blot. Specifically, genomic DNA of the positive clone cells was digested with BglII, StuI, or DraIII, respectively, and then hybridized with 3 corresponding probes. As shown in FIG. 4, the results indicate that 6 clones (1-A09, 2-B09, 2-C02, 2-H10, 3-B12, and 3-D05) were positive heterozygous clones and no random insertions were detected.
TABLE-US-00005 PCR primers and target band sizes Primer Name Sequence (5′-3′) Fragment size CD94 F1 TTCCTGGCAAGAAATGATACTCCA (SEQ ID NO: 11) 3812 bp R1 ATGCCTCTCTGTGTGAAAAACAAG (SEQ ID NO: 12) CD94 F2 CAGGACATAGCGTTGGCTAC (SEQ ID NO: 13) 5207 bp R2 GGAAGAGCCATCACTGTTAAGGT (SEQ ID NO: 14)
[0478] The following probes were used in Southern Blot assays: [0479] CD94-5′ probe: [0480] F: 5′- ACAAGCCAAACACTAAATTGGCAT -3′ (SEQ ID NO: 15), [0481] R: 5′- GTGGGCCAAGTAGACACTTCCT -3′ (SEQ ID NO: 16); [0482] CD94-3′ probe: [0483] F: 5′- CACAACATTAAGTTTTCCCTCTAGT -3′ (SEQ ID NO: 17), [0484] R: 5′- GATAATCCAGTACTGCCTTGATAGT -3′ (SEQ ID NO: 18); [0485] Neo probe: [0486] F: 5′- GGATCGGCCATTGAACAAGATGG -3′ (SEQ ID NO: 19), [0487] R: 5′- CAGAAGAACTCGTCAAGAAGGCG -3′ (SEQ ID NO: 20).
TABLE-US-00006 Restriction Enzyme Probe Wild-type fragment size (WT size) Recombinant sequence fragment size (Targeted size) Bglll CD94-5′Probe 9.3 kb 12.8 kb Stul CD94-3′Probe 13.1 kb 10.4 kb Spel Neo Probe -- 8.4 kb
[0488] The positive clones that had been screened (black mice) were introduced into isolated blastocysts (white mice), and the resulted chimeric blastocysts were transferred to a culture medium for short-term culture and then transplanted to the fallopian tubes of the recipient mother (white mice) to produce the F0 chimeric mice (black and white). The F2 generation homozygous mice were obtained by backcrossing the F0 generation chimeric mice with wild-type mice to obtain the F1 generation mice, and then breeding the F1 generation heterozygous mice with each other. The positive mice were also bred with the Flp transgenic mice to remove the positive selectable marker gene, and then the humanized CD94 homozygous mice expressing humanized CD94 protein were obtained by breeding with each other. The genotype of the progeny mice can be identified by PCR using primers shown in the table below. The identification results of exemplary F1 generation mice (Neo cassette not removed) are shown in FIGS. 5A-5B, and mice labelled CD94-F1-1 was identified as a positive heterozygous clone. Specifically, primers CD94-WT-F and CD94-WT-R were used to amplify a fragment from endogenous mouse CD94 gene (FIG. 5A); primers CD94-WT-F and CD94-Mut-R were used to amplify a fragment from modified mouse CD94 gene (FIG. 5B), to verify whether the CD94 gene targeting vector was correctly inserted into the mouse genome.
TABLE-US-00007 CD94 gene detection primer sequence Primer Sequence (5′-3′) Fragment size (bp) CD94 WT-F TAGTTTCTAGGATCACTCGGTGG (SEQ ID NO: 21) WT: 375 bp WT-R TGCTGTAGAATGAGCTTCTCTGTT (SEQ ID NO: 22) CD94 WT-F TAGTTTCTAGGATCACTCGGTGG (SEQ ID NO: 21) Mut: 391 bp Mut-R ATTCCATCATGCCTCTCTGTGTG (SEQ ID NO: 23) Note: WT stands for wild-type mice; and Mut stands for CD94 gene humanized mice.
[0489] The expression of humanized CD94 protein in CD94 gene humanized heterozygous mice was confirm by flow cytometry. Specifically, one wild-type C57BL/6 mouse (6 weeks old) and one CD94 gene humanized heterozygous mouse (approximately 6-12 weeks old) were selected and the mouse spleens were isolated. Dead spleen cells were stained with vitality dyes (Zombie NIR™, BioLegend) and eliminated by flow cytometry. The live spleen cells were then stained with one of the following combinations of fluorescent dye-labeled antibodies: (1) mNK1.1-PE/Cy7, FITC Rat Anti-Mouse CD3 antibody, and mCD94-APC (FIGS. 6B and 6C); (2) mNK1.1-PE/Cy7, FITC Rat Anti-Mouse CD3 antibody, and hCD94-PE (FIGS. 6D and 6E); or (3) mNK1.1-PE/Cy7, FITC Rat Anti-Mouse CD3 antibody, and APC Rat IgG2a, κ Isotype Ctrl antibody (FIG. 6A), followed by flow cytometry analysis. The results showed that NK cells expressing humanized CD94 protein were detected by the anti-human CD94 antibody in the spleen of the CD94 gene humanized heterozygous mouse (H/+). However, NK cells expressing human or humanized CD94 protein were not detected in the spleen of the wild-type mouse (WT).
Example 2: Mice With Humanized NKG2A Gene
[0490] In this example, a non-human animal (e.g., a mouse) was modified to include a nucleotide sequence encoding human NKG2A protein, and the obtained genetically-modified non-human animal can express a human or humanized NKG2A protein in vivo. The mouse NKG2A gene (NCBI Gene ID: 16641, Primary source: MGI: 1336161, UniProt ID: Q9Z202) is located at 129666015 to 129682852 of chromosome 6 (NC_000072.6), and the human NKG2A gene (NCBI Gene ID: 3821, Primary source: HGNC: 6374, UniProt ID: P26715) is located at 10441673 to 10454685 of chromosome 12 (NC_000012.12). The mouse NKG2A transcript sequence is NM_001136068.2, and the corresponding protein sequence NP_001129540.1 is set forth in SEQ ID NO: 28. The human NKG2A transcript is NM_213658.2, and the corresponding protein sequence NP_998823.1 is set forth in SEQ ID NO: 29. Mouse and human NKG2A gene loci are shown in FIG. 7A and FIG. 7B, respectively.
[0491] Genetically modified non-human animals can be generated by several gene editing techniques that are known in the art, including but not limited to, zinc finger nucleases (ZFN), transcription activator-like effector-based nucleases (TALEN), homing endonucleases (megakable base ribozyme), the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system, or other molecular biology techniques. In this example, a nucleotide sequence encoding human NKG2A protein was introduced into the endogenous mouse NKG2A locus, such that the mouse can express a human or humanized NKG2A protein. The method can include insertion of a sequence including a human NKG2A gene sequence into the mouse endogenous NKG2A locus. For example, the inserted nucleotide sequence can include a human NKG2A DNA or cDNA sequence. It is also possible to include an auxiliary sequence (e.g., a stop codon or a sequence having termination functions, etc.) or to use other methods (e.g., flipping or knocking out) to make the mouse endogenous NKG2A gene unable to express normally. The strategy of in situ replacement can also be used, e.g., a direct replacement with human NKG2A gene sequence (DNA or cDNA sequence of human NKG2A) on the mouse endogenous NKG2A locus. Here, a in situ replacement strategy of NKG2A DNA sequence was used to illustrate how to humanize the mouse NKG2A gene.
[0492] Mouse cells can be modified by various gene-editing techniques, for example, replacement of specific mouse NKG2A gene sequences with human NKG2A gene sequences at the endogenous mouse NKG2A locus. For example, under control of a mouse NKG2A regulatory element, a 3438 bp sequence spanning from exon 2 (including a part of exon 2) to exon 6 (including a part of exon 6) of the mouse NKG2A gene can be replaced with a corresponding 3934 bp sequence spanning from exon 4 (including a part of exon 4) to exon 8 (including a part of exon 8) of the human NKG2A gene, to obtain a humanized mouse NKG2A locus as shown in FIG. 8, thereby humanizing mouse NKG2A gene.
[0493] As shown in the schematic diagram of the targeting strategy in FIG. 9, the targeting vector includes an upstream homologous arm, a downstream homologous arm, and a knock-in (KI) fragment including a human NKG2A gene sequence. Sequence of the upstream homologous arm (5′ homologous arm, SEQ ID NO: 30; 4052 bp) is identical to nucleotide sequence of 129682351-129678300 of NCBI accession number NC_000072.6, and sequence of the downstream homologous arm (3′ homologous arm, SEQ ID NO: 31; 4631 bp) is identical to nucleotide sequence of 129674508- 129669878 of NCBI accession number NC_000072.6. The KI fragment comprises a sequence spanning from exon 4 (including a part of exon 4) to exon 8 (including a part of exon 8) of a human genomic NKG2A gene (SEQ ID NO: 32; 3934 bp), which is identical to nucleotide sequence of 10450487-10446554 of NCBI accession number NC_000012.12.
[0494] The upstream of the KI fragment containing the human NKG2A gene sequence is directly connected to the 5′ homologous arm, and the connection between the downstream of the human NKG2A gene sequence and the mouse NKG2A gene locus was designed as: 5′-TCAATAATATATCATTGTAAGCATAAGCTTTGAAACACCTGCACTGG-3′ (SEQ ID NO: 33), wherein the last “T” in sequence “GCTT” is the last nucleotide of the human sequence, and the “T” of the sequence “TGAA” is the first nucleotide of the mouse sequence. The mRNA sequence of the engineered mouse NKG2A after humanization and its encoded protein sequence are shown in SEQ ID NO: 34 and SEQ ID NO: 35, respectively.
[0495] The targeting vector also included an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase gene, or Neo), and two Frt recombination sites flanking the antibiotic resistance gene, that formed a Neo cassette. The connection between the upstream of the Neo cassette and the mouse NKG2A gene locus was designed as: 5′-ATTGCCAGTTGTATATTGCAACTTCAGCTTCTGTAGTACATTTGGGTCGAATTCCGAA GTTCCTATTCTCTAGAAAGTAT -3′ (SEQ ID NO: 36), wherein the “C” of the sequence “GGTC” is the last nucleotide of the mouse sequence, and the “G” of the sequence “GAAT” is the first nucleotide of the Neo cassette. The connection between the downstream of the Neo cassette with the mouse NKG2A sequence was designed as 5′-AGGAACTTCATCAGTCAGGTACATAATTAGGTGGATCCACCCACTTTTAGTCAATAA GTAATATTATATA -3′ (SEQ ID NO: 37), wherein the last “C” of the sequence “ATCC” is the last nucleotide of the Neo cassette, and the “A” of the sequence “ACCC” is the first nucleotide of the mouse sequence. In addition, a coding gene with a negative selectable marker (a gene encoding diphtheria toxin A subunit (DTA)) was also inserted downstream of the 3′ homologous arm of the targeting vector.
[0496] The targeting vector used for replacement of a mouse NKG2A gene sequence with the corresponding human NKG2A gene sequence was constructed, e.g., by restriction enzyme digestion and ligation, or synthesized directly. Mouse and human NKG2A DNA were obtained from bacterial artificial chromosome (BAC) clones RP23-164F1 and RP11-653F19, respectively. The constructed targeting vector sequence was preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. The correct targeting vector was electroporated and transfected into embryonic stem cells of C57BL/6 mice. The positive selectable marker gene was used to screen the cells, and the integration of exogenous genes was confirmed by PCR and Southern Blot. Specifically, positive clones identified by PCR were further confirmed by Southern Blot to screen out correct positive clone cells used for blastocyst injection.
[0497] The positive clones that had been screened (black mice) were introduced into isolated blastocysts (white mice), and the resulted chimeric blastocysts were transferred to a culture medium for short-term culture and then transplanted to the fallopian tubes of the recipient mother (white mice) to produce the F0 chimeric mice (black and white). The F2 generation homozygous mice were obtained by backcrossing the F0 generation chimeric mice with wild-type mice to obtain the F1 generation mice, and then breeding the F1 generation heterozygous mice with each other. The positive mice were also bred with the Flp transgenic mice to remove the positive selectable marker gene, and then the humanized NKG2A homozygous mice expressing humanized NKG2A protein were obtained by breeding with each other. The genotype of the progeny mice can be identified by PCR using primers shown in the table below.
TABLE-US-00008 PCR primers and target band sizes Primer Sequence (5′-3′) Fragment size (bp) NKG2A F1 ATGCCAGAGGGGAGTACTAATTGCC (SEQ ID NO: 38) Mut: 4187 bp R1 TGGGTTTTCTGGGTACCACACCATT (SEQ ID NO: 39) NKG2A F2 TTGATCCCTGATGCTAGGGTCCCAG (SEQ ID NO: 40) Mut: 3339 bp R2 CTGACACCTGTTGTTGAATTAGCGA (SEQ ID NO: 41) NKG2A F1 ATGCCAGAGGGGAGTACTAATTGCC (SEQ ID NO: 38) Mut: 1919 bp R3 TGCATCAGAAGCGAATACTTTCAACA (SEQ ID NO: 42) NKG2A F3 AGGGGGACTACTCTGTTGAGTGTTCA Mut: 1909 bp (SEQ ID NO: 43) R2 CTGACACCTGTTGTTGAATTAGCGA (SEQ ID NO: 41)
[0498] CRISPR/Cas gene editing technology was used to obtain the NKG2A gene humanized mice. The target sequences are important for the targeting specificity of sgRNAs and the efficiency of Cas9-induced cleavage. Specific sgRNA sequences were designed and synthesized that recognize the 5′ end targeting site (sgRNA1-sgRNA8) and 3′ end targeting site (sgRNA9-sgRNA15). The 5′ end targeting sites are located on exon 2, and the 3′ end targeting sites are located on exon 6 of the mouse NKG2A gene. The targeting site sequence of each sgRNA on the NKG2A gene locus is as follows:
TABLE-US-00009 sgRNA targeting site sequences on NKG2A gene sgRNA number Targeting site sequence (5′-3′) Sequence SEQ ID NO sgRNA1 GGCACTTCCAGTCATTAAAGTGG SEQ ID NO: 44 sgRNA2 AAAAGCATGCTTACATGGTGTGG SEQ ID NO: 45 sgRNA3 CCTTGATAGGAAGTTTTGAAAGG SEQ ID NO: 46 sgRNA4 TAAACTAAACTGTCCTTGATAGG SEQ ID NO: 47 sgRNA5 CCAGCAATGAGTTTCTCTGGAGG SEQ ID NO: 48 sgRNA6 GAAACTCATTGCTGGTACCCTGG SEQ ID NO: 49 sgRNA7 GTACCAGCAATGAGTTTCTCTGG SEQ ID NO: 50 sgRNA8 CCTCCAGAGAAACTCATTGCTGG SEQ ID NO: 51 sgRNA9 TGCTTCTGCATAAAGCCTGCTGG SEQ ID NO: 52 sgRNA10 GCTTCTGCATAAAGCCTGCTGGG SEQ ID NO: 53 sgRNA11 TGACTTTCATGACTGTCGTTAGG SEQ ID NO: 54 sgRNA12 TTCAGCTTCTGTAGTACATTTGG SEQ ID NO: 55 sgRNA13 TCAGCTTCTGTAGTACATTTGGG SEQ ID NO: 56 sgRNA14 TATTACTTATTGACTAAAAGTGG SEQ ID NO: 57 sgRNA15 AATCTCTTTCACTGATCTCATGG SEQ ID NO: 58
[0499] The UCA kit was used to detect the activities of sgRNAs. As shown in FIGS. 10A-10B and the table below, the results showed that the sgRNAs had different activities. sgRNA1 and sgRNA15 were selected for subsequent experiment. Embryonic stem cells of C57BL/6 mice can be transfected with the NKG2A gene targeting vector, together with sgRNA1, sgRNA15, and Cas9 mRNA. The correct positive clones can also be screened.
TABLE-US-00010 sgRNA activity test results 5′ end targeting site detection result 3′ end targeting site detection result Con. 1.00±0.09 Con. 1.00±0.05 PC 198.56±12.12 PC 37.70±1.58 sgRNA-1 126.17±3.32 sgRNA-9 50.92±2.98 sgRNA-2 4.62±0.17 sgRNA-10 62.10±5.52 sgRNA-3 14.21±1.53 sgRNA-11 30.50±2.57 sgRNA-4 10.94±0.68 sgRNA-12 3.34±0.34 sgRNA-5 NA sgRNA-13 6.38±0.46 sgRNA-6 76.99±5.54 sgRNA-14 5.24±0.31 sgRNA-7 28.49±0.68 sgRNA-15 24.36±0.24 sgRNA-8 25.13±1.22 / /
[0500] The expression of humanized NKG2A protein in the positive mice was confirmed, e.g., using the Fluorescence-Activated Cell Sorting (FACS) method, and the detection was performed as follows. One wild-type C57BL/6 mouse and one NKG2A gene humanized heterozygous mouse were selected. The mouse spleen cells were stained with Brilliant Violet 510™ anti-mouse CD45 (an anti-mouse CD45 antibody), PE/Cy™ 7 Mouse anti-mouse NK1.1 (an anti-mouse NK cell surface antigen antibody), and either one of: (1) mNKG2A-PE (using PE Mouse IgG2b, κ Isotype Ctrl Antibody as an isotype control (ISO)) (FIGS. 20A-20C), or (2) monalizumab in combination of Alexa Fluor® 647-conjugated AffiniPure F(ab′)2 Fragment Goat Anti-Human IgG, Fcy fragment Specific (using Alexa Fluor® 647 Mouse IgG1, κ Isotype Ctrl (FC) as an isotype control (ISO)) (FIGS. 20D-20E), followed by flow cytometry detection. The results showed that no humanized NKG2A protein expression, but only mouse NKG2A protein expression, was detected in wild-type C57BL/6 mice (FIG. 20B and FIG. 20E). By contrast, both mouse NKG2A protein and humanized NKG2A protein expression were detected in NKG2A gene humanized heterozygous mice (FIG. 20C and FIG. 20F). The above experiments showed that NKG2A gene humanized mice expressing humanized NKG2A protein in vivo can be established using the methods described herein, and the mice can be stably passed without random insertions.
Example 3: Generation of Double- or Multi-Gene Humanized Mice
[0501] The CD94 gene humanized mice generated in Example 1 and the NKG2A gene humanized mice generated in Example 2 can also be used to generate double- or multi-gene humanized mouse model. For example, in Example 2, the embryonic stem (ES) cells used for blastocyst microinjection can be selected from the CD94 gene humanized positive clone cells in Example 1, thereby generating NKG2A and CD94 double-gene humanized mice. In addition, it is also possible to breed the homozygous or heterozygous NKG2A and/or CD94 gene humanized mice obtained by the methods described herein with other genetically modified homozygous or heterozygous mice, and the offspring can be screened. According to Mendel’s law, it is possible to generate double-gene or multi-gene modified heterozygous mice comprising humanized NKG2A and/or CD94 genes and other genetic modifications. Then the heterozygous mice can be bred with each other to obtain homozygous double-gene or multi-gene humanized mice.
[0502] For example, NKG2A/CD94 double-gene humanized mice (B-hCD94/hNKG2A) can be generated using the above method. Because mouse NKG2A and CD94 genes are both located on chromosome 6, after obtaining the CD94 gene humanized positive ES cells, the method as described in Example 2 was performed to conduct a second round of targeting. Afterwards, the positive offspring can be screened, thereby generating NKG2A/CD94 double-gene humanized mice.
[0503] RT-PCR can be used to detect the expression of humanized NKG2A mRNA and humanized CD94 mRNA in NKG2A/CD94 double-gene humanized mice. Specifically, three wild-type C57BL/6 mice (7 weeks old) and three NKG2A/CD94 double-gene humanized homozygous mice (7 weeks old) were selected and mouse spleen was isolated after euthanasia. Total RNA from the spleen was extracted and then reverse transcribed into cDNA using a reverse transcription kit, followed by PCR amplification. The primer sequence are shown in the table below.
TABLE-US-00011 RT-PCR detection primer sequences and target fragment sizes Primer Primer sequence (5′-3′) Target fragment size hCD94-RT-PCR-F2 CCAGCATTTACTCCAGGACCC (SEQ ID NO: 24) Mut: 288 bp hCD94-RT-PCR-R2 GGAGAGTGCAGAGCCATTCT (SEQ ID NO: 25) mCD94-RT-PCR-F1 AGTTTCTAGGATCACTCGGTGG (SEQ ID NO: 26) WT: 452 bp mCD94-RT-PCR-R1 TGCAGTGCTCTGGCCTGATA (SEQ ID NO: 27) hNKG2A-RT-PCR-F1 CTCGCAGCTCCATTTCAGTC (SEQ ID NO: 59) Mut: 245 bp hNKG2A-RT-PCR-R1 CAGGGAAGAATTGTTGTGCCT (SEQ ID NO: 60) mNKG2A-RT-PCR-F1 ATGCAGAACTGAAGGTGGCA (SEQ ID NO: 61) WT: 661 bp mNKG2A-RT-PCR-R1 TCTGCTGTGAGACCAGAAGC (SEQ ID NO: 62) GAPDH-F TCACCATCTTCCAGGAGCGAGA (SEQ ID NO: 63) WT: 479 bp GAPDH-R GAAGGCCATGCCAGTGAGCTT (SEQ ID NO: 64)
[0504] As shown in FIG. 11, the test results showed that in wild-type C57BL/6 mouse cells, expression of mouse NKG2A and CD94 mRNA was detected, but expression of humanized NKG2A and CD94 mRNA was not detected. By contrast, in humanized NKG2A/CD94 double-gene humanized homozygous mouse cells, expression of humanized NKG2A and CD94 mRNA was detected, but expression of mouse NKG2A and CD94 mRNA was not detected.
[0505] Further, flow cytometry was used to detect the in vivo expression of NKG2A and CD94 proteins in NKG2A/CD94 double-gene humanized mice. Specifically, one wild-type C57BL/6 mouse (9 weeks old) and one NKG2A/CD94 double-gene humanized homozygous mouse (9 weeks old) were selected and mouse spleen was isolated after euthanasia.
[0506] The spleen cells were stained with anti-mouse CD45 antibody Brilliant Violet 510™ anti-mouse CD45 and mNK1.1-PE/Cy7, together with (1) mCD94-APC; (2) hCD94-PE; (3) mNKG2A-PE; and/or (4) monalizumab in combination with Alexa Fluor® 647-conjugated AffiniPure F(ab′)2 Fragment Goat Anti-Human IgG, Fcy fragment Specific. APC Mouse IgG2a, κ Isotype Ctrl Antibody, PE Mouse IgG2b, κ Isotype Ctrl Antibody, or APC Rat IgG2a, κ Isotype Ctrl Antibody were used as isotype controls. As shown in FIGS. 12A-12H, 13A-13H, and 14A-14H, the results showed that in wild-type C57BL/6 mice, mouse NKG2A protein and CD94 protein were detected, but humanized NKG2A protein and CD94 protein were not detected. By contrast, in NKG2A/CD94 double-gene humanized homozygous mice, humanized NIG2A protein and CD94 protein were detected, but mouse NKG2A and CD94 were not detected.
[0507] Further, immuno-phenotyping of leukocytes and T cells in the spleen of wild-type C57BL/6 mice and NKG2A/CD94 double-gene humanized homozygous mice was performed by flow cytometry. The immuno-phenotyping detection results of leukocytes and T cells in the spleen are shown in FIG. 15 and FIG. 16, respectively. The results showed that leukocyte subtypes, e.g., T cells, B cells, NK cells, CD4+ T cells, CD8+ T cells, granulocytes, DC cells, macrophages, and monocytes in NKG2A/CD94 double-gene humanized homozygous mice had comparable levels as compared to those in wild-type C57BL/6 mice (FIG. 14). The results also showed that the percentages of T cell subtypes, e.g., CD4+ T cells, CD8+ T cells, and Treg cells in NKG2A/CD94 double-gene humanized homozygous mice, were comparable with those detected in wild-type C57BL/6 mice (FIG. 15). The above results indicate that modification (e.g., humanization) of the mouse NKG2A/CD94 gene did not affect the differentiation, development, and distribution of leukocytes in the lymphatic tissues of mice.
[0508] The above results showed that NKG2A/CD94 double-gene humanized mice expressing humanized NKG2A protein and humanized CD94 protein can be successfully constructed.
[0509] In addition, the CD94 and/or NKG2A gene humanized mice as described herein can also be used to generate triple- or multi-gene humanized mice. For example, NKG2A/CD94/PD-1 triple-gene humanized mice can be generated. Because mouse PD-1 gene is located on chromosome 1, NKG2A/CD94 double-gene humanized mice can be selected for breeding with PD-1 gene humanized mice, and the positive offspring can be screened, thereby generating NKG2A/CD94/PD-1 triple-gene humanized mice.
Thus, while the specification contemplates broader embodiments of the claimed genetically engineered non-human animals, the specification only provide specific guidance to replacing the forms of CD94 and NKG2A genes endogenous to the animal with a human or humanized chimeric form, wherein the wild-type form is not expressed and the chimeric form is expressed in immune cells in place of the endogenous form. Further the specification expressly states that the wild-type CD94 and NKG2A gene and protein sequences in non-human animal used for clinical animal models is divergent from the human forms of CD94 and NKG2A and as a result fail to predictably serve as clinically relevant models for human as desired. As such, the specification states that models that non-human animal models expressing wildtype CD94 and/or NKG2A fail to be predictably enabled for their express intended use.
State of the Art: Zhu et al. (NATURE COMMUNICATIONS (2019) 10:1845 |https://doi.org/10.1038/s41467-019-09716-7, pp. 1-13) reports, “ The phenotype of a genetic mouse model—transgenic or genomically humanised—is not always predictable, but when unexpected outcomes arise, such models can provide valuable insight from studying the mechanism of why the observed outcome is different from expectation. As an example, to model myotonic dystrophy, the 3ʹ end of the Dmpk (dystrophia myotonica protein kinase) gene was humanised, including the addition of 84 CTG repeats in the 3ʹ-UTR, which leads to pathology in humans. In Dmpk-humanised mice, however, this repeat number failed to produce a pathogenic phenotype.” See page 9, col 2, last paragraph). “Similarly, in larger-scale humanising of the introns and exons of a gene, the mouse environment (chromosomal or cellular) may cause unexpected phenotypes. Currently, this is unpredictable and must be assessed on a case-by-case basis…. For example, the large-scale humanisation of the α globin locus (knocking-in 117 kb of human DNA, deleting 85kb of syntenic mouse DNA) resulted in significantly reduced expression (40% of mouse α globin expression levels) of α globin from the humanised locus”. See Zhu et al p 10, col 1, paragraph 1. “Genome architecture can be disrupted by scars in the genomic landscape (i.e., introduction of exogenous sequences that could, for example, disrupt promoters or enhancers and affect gene regulation). An experiment to humanise rhodopsin included fusion of green fluorescent protein (GFP) at the C-terminal end, in order to visualise Rhodopsin-expressing cells in the retina with high sensitivity; however, the GFP fusion generated a recessive allele, unexpectedly causing death of rod photoreceptor cells”. See p. 10, col 1, paragraph 2. “Importantly, we also wish to highlight the need to work with
a wild-type genomically humanised animal as a control, where possible, when studying genomically humanised mutants. This is to ensure that unexpected phenotypes that derive from the human DNA per se are distinguished from those associated
with the mutation, in particular when introducing many kb- or Mb-sized stretches of DNA.”. See p. 10, col 1, second to last paragraph. As such, Zhu et al. also highlights the unpredictable impact the gene editing to humanizing genes in non-human models.
As such, the specification teaches need to humanize CD94 and/or NKG2A genes in an animal model in a manner that the endogenous CD94 and NKG2A genes are not expressed and replaced with humans forms is requisite to the animal model serving as a clinically representative model for humans and will fails to be so if the endogenous form continue to be expressed. Further the art teaches that phenotype of transgenic animals modified by random insertion or targeted replacement is unpredictable.
As such, the breadth of the claims to a genetically modified non-human animal comprising a chimeric CD94 and/or NKG2A introduced by random integration or by targeted insertion leaving the endogenous forms intact and expressed lack enablement because the specification solely provides specific guidance to knockin non-human animal that replace the endogenous extracellular region of CD94 and/or NKG2A with the human resulting in a chimeric CD94 and/or NKG2A being expressed and the endogenous forms not being expressed. The specification further teaches that broader embodiments where the endogenous forms continue to be expressed while fail to serve the expressed intended use of non-human animal model representative of human conditions. The art further teaches making such humanized animal models are unpredictable in phenotype and fail to adequately supplement the shortcomings of the specification. As such, the breadth of the claims is not enabled.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARCIA STEPHENS NOBLE whose telephone number is (571)272-5545. The examiner can normally be reached M-F 9-5:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at 571-272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
MARCIA S. NOBLE
Primary Examiner
Art Unit 1632
/MARCIA S NOBLE/Primary Examiner, Art Unit 1632
Prosecution Insights