DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
The preliminary amendment filed April 24, 2023 is acknowledged. Claims 1-19 and 22-26 are pending. Applicant’s election without traverse of 1) Group I, directed to vectors and engineered cells, and 2) the scaffold miR-106a in the reply filed on September 23, 2025 is acknowledged. Claim 22 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Claims 1-19 and 23-26 are under examination.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The disclosure of in the certified copy of GB2006587.6 application, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) for one or more claims of this application. The priority application fails to provide support for the claims under examination, since there is no disclosure therein of miR-18b scaffold that has been modified to reduce the mismatches and/or bulges in the stem region. The first evidence of support for this limitation in claim 14 is in the PCT/EP2021/061755 (filed May 4, 2021). As such, the effective filing date for claim 14 is May 4, 2021. The effective filing date for all other clams is May 4, 2020.
Drawings
The drawings are objected to for two reasons.
First, the figures are referred to as “Figure” in the drawings. MPEP §608.02.V states that according to 37 C.F.R. 1.84(u)(1) “View numbers must be preceded by the abbreviation "FIG.".
Second, the “Figure X” label for FIGs. 2, 5, 12A and 12C are not oriented in the same direction as the view. Rule 37 C.F.R. 1.84(p)(1) indicates that reference characters must be oriented in the same direction as the view so as to avoid having to rotate the sheet.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Interpretation
The claims recite an “RNA interference molecule with a scaffold selected from a miR-106a scaffold, a miR-18b scaffold…”. Each of the recited miRNAs are from the well-known miR-106a-363 miRNA cluster that is expressed as a single transcript and processed by the miRNA processing machinery Drosha and Dicer (See e.g., Calloni et al., Human Gene Therapy Methods (2015), 26:162-174 and Tanzer et al., J. Mol. Biol. (2004), 339: 327-335). The Specification teaches that a “microRNA scaffold minimally consists of a double stranded upper region stem (typically of 18-23 nucleotides), with both sides of the stem region connected by a flexible loop sequence, and the upper stem region typically being processed by Dicer… the microRNA scaffold further comprises a lower stem region and optionally it further comprises 5’ and 3’ flanking sequences or basal segments… guide sequence is inserted in the upper stem region” (page 17, ¶2). However, Fig 1 depicts the “scaffold” as the region comprising the upper-stem/loop structure, which includes the target sequence and the lower stem sequence, which is not completely consistent with the description on page 17. Based on a combination of the description on page 17 and the diagram in Fig 1, a specific “miRNA scaffold” is interpreted as requiring at least the lower stem sequence, and can also include the loop sequence, the upper stem sequence, and the 5’ and 3’ linkers. As such a miR-106a scaffold must include at least the sequence from the lower stem of the native miR-106a sequence, but can also include up to and including the native target sequence, the native loop, and the native 5’ and 3’ linkers. For claims 5-7, the target sequence in the upper stem region must not be the native target sequence that is found in the native miRNA structure.
This broadest reasonable interpretation excludes the prior art reference Das (Genomes and Development (2006), 294: 554-563), which teaches using the flanking sequences in between miR-20b, miR-19b-2, miR-92-2 and miR-363 of the miR106a cluster to express a multiplexed miRNA expression cassette, but does not include the lower stem sequences from any of the miRNA in the cluster (Fig 1; page 556, ¶3-4). Instead, the entire stem/loop sequence the miRNA of interest (miR-30) was cloned adjacent to the flanking sequences (Fig 1; page 556, ¶3-4). This is in contrast to the teachings of Bhaskaran (Nature Protocols (2019), 14: 3538-3553), which are recited below, and who teaches retaining the lower stem sequence along with the flanking sequences when expressing a transgenic miRNA from a miRNA cluster.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 9-10, 14, 19 and 26 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 9 recites “The engineered immune cell of claim 8, wherein the immune cell is… a stem cell, a progenitor cell and an iPSC cell.” Claim 9 is confusing because stem cells, progenitor cells and iPSC cells are not considered immune cells. The Specification even states that stem cells, progenitor cells and iPSCs “are not immune cells as such” (page 16, ¶2). It is not clear if stem cells, progenitor cells and iPSCs are really encompassed by the claim.
To remedy the indefiniteness, it is suggested that claim 8 be amended to recite “which is an engineered immune cell, an engineered stem cell, an engineered progenitor cell, or an engineered iPSC cell” and then delete “stem cells, progenitor cells and an iPSC cell” from claim 9.
Claim 10 recites “wherein the protein of interest is a receptor, particularly a chimeric antigen receptor or a TCR.” The use of “particularly” renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are a required part of the claimed invention or merely a preferred embodiment. See MPEP § 2173.05(d).
Claim 14 recites “the scaffold has been modified to reduce the mismatches and/or bulges in the stem region”. Claim 14 is indefinite because “the stem region” lacks clear antecedent basis. First, “a stem region” is not previously recited in claims 1, 11 or 14. According the Specification, miRNA scaffolds inherently have an “upper-stem” and a “lower stem” (Fig 1). It is not clear if “the stem region” is referring to the upper-stem region, the lower stem region, or the entire stem region. As such there is not clear in which part of the miR-18b scaffold can be modified to reduce mismatches and/or bulges.
Claims 19 and 26 recite “from the group consisting of… a MHC coreceptor gene (e.g., HLA-F, HLA-G),… a heat shock protein (e.g., HSPA1L, HSPA1A, HSPA1B),… regulatory receptors (e.g. NOTCH4)”. The use of “e.g.” and the parentheticals renders the claim indefinite because it is unclear whether the limitation(s) following e.g., or in the parentheticals are a required part of the claimed invention or merely a preferred embodiment. See MPEP § 2173.05(d). For instance, it is not clear if the molecule can be chosen from any MHC receptor gene or if the MHC receptor gene must be HLA-F or HLA-G.
Claim Rejections - 35 USC § 101 – Judicial Exception
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-3, 16-17 and 19 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. The claims are drawn to a “vector… comprising a nucleic acid sequence”. However, the claims do not include elements, when considered separately and in combination, that are sufficient to amount to significantly more than the judicial exceptions as outlined below.
Subject Matter Eligibility Test for Products and Processes – Claims 1 and 2
Step 1 - Is the Claim to a Process, Machine, Manufacture or Composition of Matter? YES
Claims 1-2 are directed to a vector. Thus, the claims are directed to a statutory category (e.g., a product).
Step 2A, Prong One - Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES
Judicial exceptions have been identified by the courts by way of example, including mental processes and natural phenomena. The claims recite 1 judicial exception: a vector suitable for expression in engineered immune cells comprising a nucleic acid sequence encoding at least one RNA interference molecule. For natural products, products that are not “markedly different” than their naturally occurring counterpart are judicial exceptions. See MPEP 2016.04((b). MPEP 2106.04(c) outlines the markedly different analysis.
First, the claims recite a “vector suitable for expression in engineered immune cells comprising a nucleic acid sequence”. The Specification defines “vector” as “a replicon, such as plasmid, phage, cosmid, or virus in which another nucleic acid segment may be operable inserted so as to bring about the replication or expression of the segment”. It is noted that “such as plasmid, phage, cosmid, or virus” is not a requirement of the vector. “Another nucleic acid segment may be operable inserted” is interpreted as a product-by-process, which can result in a native nucleic acid being inserted into its native context, which does not necessarily distinguish the claimed nucleic segment from a naturally occurring one. The Specification does not define “replicon”, which is known in the art as “a linear or circular section of DNA or RNA which replicates sequentially as a unit” (“Replicon.” Merriam-Webster.com Dictionary, Merriam-Webster, https://www.merriam-webster.com/dictionary/replicon. [retrieved October 8, 2025]). Thus, a “vector suitable for expression in engineered immune cells” is interpreted as a piece of nucleic acid that is capable of being replicated and having a gene expressed from it in an engineered immune cell. Any naturally occurring human chromosome is comprised of nucleic acids and is capable of gene expression and being replicated in immune cells.
Second, the claims recite that the nucleic acid sequence encodes at least one RNA interference molecule with a scaffold from miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2, and miR-363. The claim does not require that the “RNA interference molecule” within each of the scaffolds to be different than native miRNA encoded in each of the scaffolds. The Specification teaches that each of the recited miRNAs is natively found on the human X chromosome (pages 35-36). Indeed, Genbank teaches the sequence of the human X chromosome around the miR-106a~miR363 cluster (NC_000023.11, Homo Sapiens chromosome X, GRCh37.p12 Primary assembly, available at least as early as March 26, 2018). Genbank teaches the human X chromosome comprises the sequence of the “precursor_RNA” for miR-106a (i.e., comprising the miR-106a scaffold), which contains the sequence of the “ncRNA” miR-106a (i.e., one RNA interference molecule).
Therefore, the closest naturally occurring counterpart to the claimed vector is the human X chromosome, which comprises the endogenous miR-106a-miR363 cluster, which comprises miR-106a and the miR-106a miRNA interference molecule. Thus, the claimed isolated nucleic acid is not markedly different than its naturally occurring counterpart and constitutes a judicial exception.
Step 2A, Prong Two - Does the Claim Recite an Additional Elements that Integrate the Judicial Exception into a Practical Application? NO
The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception. In this case, the claims do not recite any additional elements that integrate the claimed vector into a practical application.
Step 2B - Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO
The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim (MPEP 2106.05). However, the additional elements, individually and in combination, do not amount to "significantly more". In this case, the claims do not recite any additional elements; therefore, the claims as a whole does not amount to something significantly more than the claimed judicial exception.
Subject Matter Eligibility Test for Products and Processes – Claims 3,
Claim 3 recites “wherein the at least one RNA interference molecule is at least two multiplexed RNA interference molecules”. “Multiplexed RNA interference molecules" is defined as two or more molecules that are simultaneously present for the concomitant downregulation of one or more targets. The Specification teaches that the naturally occurring miR-106a~363 cluster is considered multiplexed. Tanzer teaches that the miRNAs in the naturally occurring miR-106a cluster are simultaneously expressed as one large RNA molecule that are then processed into mature miRNAs by cellular machinery (Tanzer et al., J. Mol. Biol. (2004), 339: 327-335; page 327, ¶1). Tanzer teaches that all the miRNAs in the miR-106a cluster are expressed as one large transcript (Fig 2). Therefore, the naturally occurring miR-106a cluster genes on the X chromosome comprises “at least two multiplexed RNA interference molecules). The claimed vector is still not markedly different that the naturally occurring human X chromosome.
Claim 16 recites “wherein the at least two of the multiplexed RNA interference molecules are directed against the same target”. MiRDB discloses that miR-106a-5p and miR-18b-5p (i.e., one of the two products of the miRNAs) both target the PHC3 gene (https://www.mirdb.org/cgi-bin/search.cgi?searchType=miRNA&full=mirbase&searchBox=MIMAT0000103 and http://mirdb.org/cgi-bin/search.cgi?searchType=miRNA&full=mirbase&searchBox=MIMAT0001412; see also attached miRDB NPL attachment). Therefore, the naturally occurring miR-106a cluster genes comprising miR-106a and miR-18b on the X chromosome comprises “at least two multiplexed RNA interference molecules [that] are directed against the same target”. The claimed vector is still not markedly different that the naturally occurring human X chromosome.
Claim 17 recites “wherein all of the at least two of the multiplexed RNA interference molecules are directed against the same target”. MiRDB discloses that miR-18b-5p targets NEDD9, which is not targeted by miR-106a-5p or miR-106a-3p (https://www.mirdb.org/cgi-bin/search.cgi?searchType=miRNA&full=mirbase&searchBox=MIMAT0004517; see also attached miRDB NPL attachment). MiRDB discloses that miR-106a-5p targets ENPP5, which is not targeted by miR-18b-5p or miR-18b-3p (See https://www.mirdb.org/cgi-bin/search.cgi?searchType=miRNA&full=mirbase&searchBox=MIMAT0004751; see also attached miRDB NPL attachment). Therefore, the naturally occurring miR-106a cluster genes comprising miR-106a and miR-18b on the X chromosome comprises “at least two multiplexed RNA interference molecules [that] are directed against different targets”. The claimed vector is still not markedly different that the naturally occurring human X chromosome.
Claim 19 recites “wherein the at least one interference molecule targets a molecule selected from the group consisting of… TGFBR2”. MiRDB discloses that miR-106a-5p targets TGFBR2 (See attached miRDB NPL attachment page 3). Therefore, the naturally occurring miR-106a cluster genes comprising miR-106a on the X chromosome comprises “at least one interference molecule [that] targets… TGFBR2”. The claimed vector is still not markedly different that the naturally occurring human X chromosome.
To overcome this §101 rejection it is suggested that either 1) the vector is limited to specific kinds of vectors like viral vectors, plasmids, etc, or 2) recite “at least one RNA interference molecule comprises a target sequence within the scaffold that is different from the natural target of the miRNA from which the scaffold originates” from claim 5.
Claim Rejections - 35 USC § 101 – AIA
Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claims 4-15 and 23-26 are rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101).
The claims are drawn to “an engineered cell”. The specification does not provide a limiting definition of a cell, and even includes “engineered human cells” (page 5, 6). The Specification does not expressly exclude cells within a human organism. Thus, the term “an engineered cell” could reasonably be interpreted as encompassing cells within a human organism, which is non-statutory subject matter.
The rejection may be obviated by requiring that the cell, be an in vitro human cell, or an “isolated” cell for example, as described on page 17 of the Specification.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-4, 8-13, 15-17, 19, 23-24 and 26 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Maude (Maude et al., New England Journal of Medicine (2014), 371: 1507-1517) as evidenced by Genbank (NC_000023.11, Homo Sapiens chromosome X, GRCh37.p12 Primary assembly, available at least as early as March 26, 2018). Claims 3, 11-13 and 15 are further evidenced by Tanzer (Tanzer et al., J. Mol. Biol. (2004), 339: 327-335). Claims 16-17, 19, 23-24 and 26 are evidenced by miRDB (miRDB: an online database for prediction of functional miRNA targets, https://www.mirdb.org/, [retrieved October 9, 2025]).
Claims 1-3, 16-17 and 19 are directed to “vectors suitable for expression in engineered immune cells comprising a nucleic acid sequence”. The Specification defines “vector” as “a replicon… in which another nucleic acid segment may be operable inserted so as to bring about the replication or expression of the segment”. “Another nucleic acid segment may be operable inserted” is interpreted as a product-by-process” which can result in a native nucleic acid being inserted into its native context. Thus, a “vector suitable for expression in engineered immune cells” is interpreted as a piece of nucleic acid that is capable of being replicated and having gene expressed from the nucleic acid in an engineered immune cell. Any naturally occurring human chromosome is comprised of nucleic acids and is capable of gene expression and being replicated in immune cells.
The claims recite that the nucleic acid sequence encodes at least one RNA interference molecule with a scaffold from a miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2, and miR-363. The claim does not require that the “RNA interference molecule” within each of the scaffolds to be different than native miRNA encoded in each of the scaffolds.
Regarding claims 1-2 and 4, Maude teaches autologous human T-cells transduced with a chimeric antigen receptor (CAR) lentiviral vector (i.e., an engineered T cell comprising a first exogenous nucleic acid molecule encoding a protein of interest) (page 1507; Abstract-Methods). Maude is silent about whether the autologous T-cells comprise a replicable nucleic acid that encodes an RNA interference molecule within an miR-106a scaffold.
Genbank teaches the sequence of the human X chromosome around the miR-106a~363 cluster. Genbank teaches the human X chromosome comprises the sequence of the “precursor_RNA” for miR-106a (i.e., comprising the miR-106a scaffold), which contains the sequence of the “ncRNA” miR-106a (i.e., one RNA interference molecule).
Because the X chromosome is capable of being replicated and comprises the miR-106a cluster gene (i.e., comprising the miR-106a scaffold and encoding the miR-106a interference molecule), Maude’s autologous T cells inherently comprise a vector suitable for expression in engineered immune cells (claims 1-2) and a second nucleic acid molecule (claim 4) encoding at least one RNA interference molecule with a miR-106a scaffold.
Regarding claims 3, 11-13 and 15, “multiplexed RNA interference molecules" is defined as two or more molecules that are simultaneously present for the concomitant downregulation of one or more targets. (Specification, page 15). Genbank also teaches the miRNA cluster on the human X chromosome comprises miR-106a, 18b, 20b, 19b2, 92a, and 363 (pages 3-6). Maude and Genbank are silent as to whether the miRNAs in the miR-106a cluster are expressed simultaneously.
Tanzer teaches that the miRNAs in a miRNA cluster are simultaneously expressed as one large RNA molecule that are then processed into mature miRNAs by cellular machinery (page 327, ¶1). Tanzer teaches the miRNA cluster on the human X chromosome comprises 106a, 18, 20, 19b2, 92-2 (Fig 3). Tanzer teaches that all the miRNAs in the miR-106a cluster are expressed as one large transcript (Fig 2). Therefore, the Maude’s autologous T cells inherently comprise a vector suitable for expression in engineered immune cells (claim 3) and a second nucleic acid molecule (claims 11-13 and 15) encoding at least two and three multiplexed RNA interference molecules with at least a miR-106a scaffold and a miR-18b scaffold.
Regarding claims 8-10, as indicated above for claim 1, Maude teaches the engineered cells are autologous T cells (i.e., immune cells) and transfected with a lentiviral vector encoding a chimeric antigen receptor (page 1507; Abstract-Methods).
Regarding claims 16 and 23, Maude and Genbank are silent as to the targets of the miRNAs in the miR-106a cluster on the X chromosome in the engineered T cells.
miRDB teaches that miR-106a-5p and miR-18b-5p (i.e., one of the two products of the miRNAs) both target the PHC3 gene (pages 3 and 42). Therefore, the vector suitable for expression in engineered immune cells (claim 16) and the second nucleic acid molecule (claim 23) in Maude’s engineered T-cells with the X chromosome inherently comprise at least two multiplexed RNA interference molecules that are directed against the same target.
Regarding claims 17 and 24, Maude and Genbank are silent as to the targets of the miRNAs in the miR-106a cluster on the X chromosome in the engineered T cells.
miRDB teaches that miR-18b-5p targets NEDD9 (page 42), which is not targeted by miR-106a-5p or miR-106a-3p (pages 1-41). MiRDB also discloses that miR-106a-5p targets ENPP5 (page 1), which is not targeted by miR-18b-5p or miR-18b-3p (pages 42-56). Therefore, the vector suitable for expression in engineered immune cells (claim 17) and the second nucleic acid molecule (claim 24) in Maude’s engineered T-cells with the X chromosome inherently comprise at least two multiplexed RNA interference molecules directed against different targets.
Regarding claims 19 and 26, Maude and Genbank are silent as to the targets of the miRNAs in the miR-106a cluster on the X chromosome in the engineered T cells.
miRDB teaches that miR-106a-5p targets TGFBR2 (page 3). Therefore, the vector suitable for expression in engineered immune cells (claim 19) and the second nucleic acid molecule (claim 26) in Maude’s engineered T-cells with the X chromosome inherently comprise an RNA interference molecule that targets TGFBR2.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-13, 15-17, 19, 23-24 and 26 are rejected under 35 U.S.C. 103 as being unpatentable over Bhaskaran (Bhaskaran et al., Nature Protocols (2019), 14: 3538-3553), as evidenced by Chu (Chu et al., Leukemia (2014), 28: 917-927), and in view of Tanzer (Tanzer et al., J. Mol. Biol. (2004), 339: 327-335), Genbank (NC_000023.11, Homo Sapiens chromosome X, GRCh37.p12 Primary assembly, available at least as early as March 26, 2018) and Hux (US 20200063102 A1, published February 27, 2020).
Regarding claim 1, Bhaskaran teaches a detailed protocol for the design, cloning, delivery, and utilization of artificial microRNA clusters for gene therapy purposes (Abstract). Bhaskaran teaches engineering the native MiR-17-92 cluster backbone (i.e., scaffold including the cellular processing sites and spacing sequences) by removing the native hairpin loop and stem portion comprising the targeting sequence, and replacing it with chimeric hairpins targeting a gene of interest (Figs 1 and 3; page 3540, ¶2). Bhaskaran teaches choosing the miR-17-92 cluster because it has the highest number (six) of miRNA hairpins within the shortest DNA segment (~800 bp) allowing for a high number of miRNA combinations within the packaging capacity of delivery vectors (page 3540, #2 and ¶3). Bhaskaran teaches that other miRNA clusters could work in a similar manner (page 3540, #2). Bhaskaran teaches for in vitro applications, a third lentiviral vector pCDH-CMV-MCS-EF1-copGRP was used (page 3542, ¶3). Bhaskaran teaches “This protocol is easy to execute and takes advantage of the modular structure of microRNA genes. Accordingly, microRNA clusters can be dissected in silico into their functional components and rearranged into chimeric transgenes able to overexpress groups of multiple microRNAs. Because it is based on features that are common to all microRNAs, our method is generally applicable to any microRNA of interest, and consequently very versatile.” (page 3539, ¶2).
Bhaskaran does not teach using the miR106a-363 cluster as a scaffold. Bhaskaran does not teach delivering the multiplexed artificial miRNAs to engineered immune cells in vectors that can be expressed in engineered immune cells.
Chu teaches that the pCDH-CMV-MCS-EF1-copGRP vector can be delivered to NK cells for the expression of chimeric antigen receptors (CARs) (page 918, ¶4-5). Therefore, Bhaskaran’s vector used to deliver and express the multiplexed miRNA array using a native miRNA cluster scaffold was inherently a vector suitable for expression in engineered immune cells.
Tanzer teaches that the miRNAs in a miRNA cluster are simultaneously expressed as one large RNA molecule that are then processed into mature miRNAs by cellular machinery (page 327, ¶1). Tanzer teaches the miRNA cluster on the human X chromosome comprises 106a, 18, 20, 19b2, 92-2 (Figs 1 and 3). Tanzer teaches that all the miRNAs in the miR-106a cluster are expressed as one large transcript (Fig 2). Tanzer teaches the miR-106a cluster on the X chromosome in humans consists of five miRNAs spanning ~750 nucleotides (Fig 1).
Genbank teaches the sequence of the human X chromosome of the miR-106a~363 cluster. Genbank teaches the human X chromosome comprises a cluster of 6 miRNA within the span of 900 nucleotides and includes all of the miRNAs reported in Tanzer and additionally miR-363.
Hux teaches viral vectors comprising the coding sequence for chimeric antigen receptors (CAR) and RNA interfering shRNAs (Fig 1). Hux teaches transfecting T cells with the vectors comprising the CAR coding sequence and shRNAs targeted to B2M ([0324]-[0325]; Fig 13). Hux teaches including two copies of the B2M-targeting shRNAs ([0324], [0329]; Fig 13). Hux teaches the lentiviral vectors having two copies of the B2M shRNA had lower expression of B2M on their surface ([0324]; Fig 13). Hux teaches screening B2M shRNAs to find which are most effective at reducing B2M expression in immune cells using lentiviral vectors ([0303]-[0305]).
Regarding claims 1-3, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have engineered the known miR106a-363 cluster scaffold (i.e., at least two multiplexed RNA interference molecules) by inserting RNA interference sequences against B2M and then cloned into lentiviral vectors for delivery and expression of the artificial miRNAs with the chimeric antigen receptors in immune cells. It would have amounted to the simple substitution of one know miRNA cluster for another and the combination of prior art elements according to known methods to yield predictable results. The skilled artisan would have predicted that the miR106a-363 cluster could have been used to create artificial miRNAs because Bhaskaran teaches that any known miRNA cluster that is small enough for viral vector delivery could be used. The skilled artisan would have been motivated to specifically use the miR106a-363 cluster backbone because Tanzer and GenBank provide the evidence that the miR106a-363 cluster fits the parameters taught by Bhaskaran: 3-6 miRNAs within less than 1 kb of nucleotides. Because Bhaskaran teaches that the general protocol is “easy to execute” it would have been entirely predictable that a miR-106a cluster scaffold and an RNA interference molecule targeting B2M could be used to knockdown B2M expression in engineered NK or T cells. The skilled artisan would also have been motivated to use two different RNA-interfering sequences to target B2M because Hux demonstrates that 1) shRNAs can have variable knockdown efficiency and 2) expressing two shRNAs targeting the same gene increases knockdown efficiency in immune cells.
Regarding claims 4 and 11, Hux teaches that the lentiviral vectors comprise the coding sequence for CARs (i.e., a first exogenous nucleic acid molecule encoding a protein of interest) (Fig 1, [0310], [0324]). The obviousness of using the miR106a-363 cluster for expression of B2M-inhibiting RNAs is recited above as for claim 1.
Regarding claim 5, in the cell rendered obvious for claim 4 above, the miR-106a scaffold would comprise Hux’s B2M-targeted RNA interference molecule (ie., the RNA interference molecule comprises a target sequence within the scaffold that is different from the scaffold’s natural target sequence).
Regarding claim 6, Hux teaches the B2M-targeted shRNA is SEQ ID NO 2, which has the sequence gtaccggaggtttgaagatgccgcatttctcgagaaatgcggcatcttcaaacctttttttg. Based on the inverted complementarity of the sequence, the stem of the RNA hairpin produced by transcription (i.e., the targeted sequence) would comprise agguuugaagaugccgcauuuc and gaaaugcggcaucuucaaaccu, which is 21 nucleotides.
Regarding claim 7, the targeted sequence above – gaaaugcggcaucuucaaaccu – is 100% complementary to the B2M mRNA (i.e., the RNA interfere molecule is directed against a target in the engineered cell through bae pair complementarity of the target sequence) (See BLAST results in the OA Appendix).
Regarding claims 8-10, as indicated above for claims 1 and 4, Hux teaches an engineered T and NK immune cells with a nucleic acid encoding a chimeric antigen receptor.
Regarding claim 12, Bhaskaran teaches that up to 3 and up to 6 miRNAs encoded using a native miRNA cluster engineered to express different targeting sequences (Fig 3). It would have been obvious to have expressed an additional B2M-targeting sequence in the engineered miR-106a-363 cluster rendered obvious above for claims 4 and 11. The skilled artisan would have predicted that a third B2M-targeteing sequence could be included because Bhaskaran teaches up to six transgenic targeting sequences can be included and GenBank teaches there are six miRNAs in the cluster. The skilled artisan would have been motivated to do so to reduce B2M expression even further in Hux’s CAR T cells and NK cells.
Regarding claims 13 and 15, in the cell rendered obvious for claim 4 above, the miR-106a cluster scaffold would comprise at least both miR-106a and miR-20b.
Regarding claims 16 and 23, “the same target” can be interpreted as the same target sequence, or more broadly as the same target gene. Hux teaches using two identical B2M-targeting shRNAs (i.e., targets the same target sequence in the same target gene), increases B2M knockdown ([0331]).
It would have been obvious to one skilled in the art to have included the same B2M-targeting sequence at two different miRNAs in the miR-106a cluster because Hux teaches dual copies of the same RNA interfering sequence can have additive effects to increase desired B2M knockdown.
Regarding claims 17 and 24, “directed to different targets” can be interpreted as a different target sequence in the same gene. Hux teaches screening up to five B2M shRNAs that have different efficacies for B2M knockdown ([0305]).
It would have been obvious to one skilled in the art to have included two different B2M-targeting sequences at two different miRNAs in the miR-106a cluster because Hux teaches that shRNAs can have varying efficacies. The skilled artisan would have been motivated to use two different targeting sequences for the purposes of increasing the efficiency of B2M knockdown by additive effects of the RNA interfering sequences that are less than 100% efficient.
Regarding claims 19 and 26, as indicated above for claims 1 and 4, Hux teaches RNA interfering molecules targeting B2M.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-13, 15-19 and 23-26 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5, 7-8, 10-17 and 20-22 of copending Application No. 17608335. Claims 5-7 are rejected in view of Calloni (Calloni et al., Human Gene Therapy Methods (2015), 26: 162-174).
Copending claim 1 recites an engineered cell comprising: a first exogenous nucleic acid molecule encoding a protein of interest, and a second nucleic acid molecule encoding at least two multiplexed miRNA molecules. Copending claim 11 recites wherein at least one of the miRNA molecules comprises a scaffold sequence from the miR- 106a~363 cluster (i.e., a miR-106a scaffold, a miR-18b scaffold, a miR-20b scaffold, a miR-19b-2 scaffold, a miR-92-2 scaffold and a miR-363 scaffold). Copending claim 5 recites wherein the first and second nucleic acid molecule are present in one vector. Copending claim 12 recites wherein all of the at least two miRNA molecules comprise a miR scaffold sequence. Copending claim 13 recites wherein at least two of the multiplexed miRNA molecules are directed against the same target. Copending claim 13 recite wherein at least two of the multiplexed miRNA molecules are identical. Copending claim 16 recites wherein all of the at least two multiplexed miRNA molecules are directed against different targets. Copending claim 17 recites wherein the molecule targeted by the at least two multiplexed miRNA molecules is selected from: a MHC class I gene, a MHC class II gene, a MHC coreceptor gene and others. Copending claims 2-4 recite the cell is an engineered immune cell, including T cells, and the protein of interest is a TCR. Therefore, the copending claims anticipate examined claims 1-4, 8-11, 13, 15-19 and 23-26.
The copending claims do not recite the targeting sequence of the miRNA is different from scaffold’s native targeting sequence, the length of the targeting sequence, or that the targeting sequence and target sequence are complementary (claims 5-7). The copending claims do not recite at least three multiplexed miRNAs (claim 12).
Regarding claims 5-7, Calloni reviews the state of the art for artificial miRNAs (amiRNAs) using a native miRNA scaffold/backbone. Calloni teaches that to make amiRNA, the native target sequence of a miRNA is removed and replaced with a sequence that targets a mRNA of interest through complementary base pairing (page 162, ¶2; Fig 1). Calloni teaches the targeting sequence is ~ 22 nucleotides in length. It would have been obvious to one skilled in the art to have removed the native sequence from the copending miRNA scaffolds and replaced with a targeting sequence that is 22 nucleotides in length and targets through base pairing. It would have amounted to designing the copending artificial miRNAs in known ways to yield predictable results. The skilled artisan would have predicted that the targeting sequence could be designed as such and been motivated to do so because Calloni teaches those are the standard ways to design amiRNAs.
Regarding claim 12, it would have been obvious to one skilled in the art to have modified the copending multiplexed miRNA array by including at least three multiplexed miRNA. One would have once envisaged “three multiplexed miRNAs” from the copending “at least two multiplexed miRNAs” because three is a single integer greater than two.
This is a provisional nonstatutory double patenting rejection.
Claims 1-13, 15-17, 19, 23-34 and 26 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13 and 16-22 of copending Application No. 18558906. Claims 6-7, 16-17, 19, 23-34 and 26 are rejected in view of Calloni (Calloni et al., Human Gene Therapy Methods (2015), 26: 162-174).
Copending claim 1 recites a nucleic acid molecule comprising at least one RNA interference molecule with an engineered scaffold, wherein the engineered scaffold comprises a lower stem region and an upper stem/loop region, and wherein the lower stem region of the scaffold is that of a miR scaffold from the miR-17 family cluster, and wherein at least part of the upper stem/loop region of the scaffold has been engineered to differ from a wild-type sequence. Copending claim 2 recites wherein the lower stem region of the engineered scaffold is selected from… a miR-106a scaffold, a miR-18b scaffold, a miR-20b scaffold, a miR-19b-2 scaffold, a miR-92-2 scaffold, a miR-363 scaffold. Copending claim 1 recites wherein the at least one RNA interference molecule are at least two multiplexed RNA interference molecules. Copending claim 5 recites a nucleic acid molecule comprising at least two RNA interference molecules with different scaffolds (i.e., a multiplexed RNA interference molecule), wherein the at least two different scaffolds have a lower stem region of a miR scaffold from the miR-17 family cluster; and wherein at least one RNA interference molecule has a chimeric scaffold wherein at least part of the upper stem/loop region is not from the same miR scaffold as the lower stem region, and wherein the at least part of the upper stem/loop region is selected from… a miR-106a scaffold, a miR-20b scaffold. Copending claim 6 recites A vector suitable for expression in engineered immune cells comprising a nucleic acid molecule of claim 1. Copending claim 8 recites an engineered cell comprising: a first exogenous nucleic acid molecule encoding a protein of interest, and a second nucleic acid molecule comprising at least two RNA interference molecules with different scaffolds… wherein the at least part of the upper stem/loop region is selected from… a miR-106a scaffold, a miR-20b scaffold. Copending claims 9-11 recite wherein the engineered cell is an engineered immune cell, including a T cell and wherein the protein of interest is a receptor, particularly a chimeric antigen receptor or a TCR. Copending claims 12-13 recite wherein the at least one RNA interference molecule is at least two and at least three multiplexed RNA interference molecules under control of one promoter (i.e., at least two multiplexed RNA interference molecules). Therefore, the copending claims anticipate examined claims 1-5, 8-13 and 15. The copending claims recite A method of treating cancer, comprising administering to a subject in need thereof a suitable dose of cells according to claims 7-8, thereby improving at least one symptom.
The copending claims do not recite the length of the targeting sequence (claim 6), that the targeting sequence and target sequence are complementary (claim 7), the targets of the miRNAs (claims 19 and 26), or that the multiplexing targets the same or different targets (claims 16-17 and 23-24).
Regarding claims 6-7, 16-17, 19, 23-34 and 26, Calloni reviews the state of the art for artificial miRNAs (amiRNAs) using a native miRNA scaffold/backbone. Calloni teaches that to make amiRNA, the native target sequence of a miRNA is removed and replaced with a sequence that targets a mRNA of interest through complementary base pairing (page 162, ¶2; Fig 1). Calloni teaches the targeting sequence is ~ 22 nucleotides in length (page 162, ¶2). Calloni teaches designing amiRNAs with targeting sequences to knockdown a variety of targets including TGFB1 and genes involved in the progression of cancer (page 169). Calloni teahces combining amiRNAs to target a gene encoding an antitumoral protein (i.e., the targeted sequence was different sequence but in the same target) (page 169, column 1). It would have been obvious to one skilled in the art to have removed the native sequence from the copending miRNA scaffolds and replaced with a targeting sequence that is 22 nucleotides in length and targets through base pairing. It would have amounted to designing the copending artificial miRNAs in known ways to yield predictable results. The skilled artisan would have predicted that the targeting sequence could be designed as such and been motivated to do so because Calloni teaches those are the standard ways to design amiRNAs. It also would have been obvious to use the copending engineered cells with the multiplexed amiRNAs to target different sequences in the same oncogenic protein, and been motivated to do so, because Calloni teaches that targeting the same gene with multiple amiRNAs is a viable method to target cancer cells. The skilled artisan would have been motivated to specifically target the genes in examined claims 19 and 26 because many of those listed are well known genes that are overexpressed during cancer.
This is a provisional nonstatutory double patenting rejection.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is enco