DETAILED ACTION
1. This action is written in response to applicant’s correspondence filed on 7/28/2026. Applicant has amended claims 1-4, 7-8, 10 and 13. Claims 17-24 were previously withdrawn due to an election/restriction requirement. Claims 1-4 and 7-14 are currently under examination. All the amendments and arguments have been thoroughly reviewed but are found insufficient to place the instantly examined claims in condition for allowance. In view of applicant’s amendments to the claims, the rejections under 35 USC 112 have been withdrawn. However, the rejection under 35 USC 102 is maintained, with modification(s) as necessitated by amendment.
Claim Rejections - 35 USC § 102
2. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
3. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
4. Claims 1 and 7-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Macosko et al. (Cell 2015, 161:1202-1214, with 37 pages of Supplemental Information).
Regarding claim 1
Macosko et al. teach each of the products as specified in (B), (E) and (F). Specifically, Macosko et al. teach each of the following:
(B) an array of polynucleotides (e.g., an array of barcoded primers attached to a microparticle) comprising, from 3' to 5': (a) a 3' hydroxyl group (e.g., the oligo-dT at the 3’-end of each barcoded primer comprises a 3’-hydroxyl group to enable reverse transcription after the barcoded primer hybridizes to the mRNA); (b) a 3' end analyte capture region (e.g., the oligo-dT at the 3’-end of each barcode primer captures mRNA by hybridizing to its poly-A region); (c) optionally a first polymerase chain reaction (PCR) handle sequence; (d) a barcode sequence (BC), wherein the barcode sequence of each of the polynucleotides is the same (e.g., all the barcoded primers on each microparticle has the same “cell barcode”); and a unique molecular identifier sequence (UMI), wherein the UMI of each polynucleotide is different (e.g., each barcoded primer has a different UMI) and wherein the UMI is 3' to the BC; (e) optionally a second PCR handle sequence (e.g., PCR handle (“AAGCAGTGGTATCAACGCAGAGT”) that is 5’ to the cell barcode); and (f) a 5' end analyte capture region (e.g., either “TTTTTTT” (for the embodiment with a second PCR handle sequence) or “TTTTTTTAAGCAGTGGTATCAACGCAGAGT” (for the embodiment without a second PCR handle sequence) can serve as a 5’ end analyte capture region to capture a target containing the corresponding complementary sequence by hybridization. Note that any polynucleotide sequence segment is capable of serving as an analyte capture region because it can hybridize to its corresponding complementary sequence contained in a potential target/analyte.) (see Figures 1-2 and the corresponding paragraphs, as well as the oligonucleotide sequences listed in Table S6);
(E) a plurality of micro-particles each comprising a micro-bead bound to an array of polynucleotides according to (B), wherein the array of each micro-particle has a different BC (e.g., cell barcode) from the array of essentially each other micro-particle (see Figures 1-2 and the corresponding paragraphs);
(F) a fluidic compartment, optionally a microfluidic compartment, comprising a single array of polynucleotides according to (B), and optionally a single cell, a single cell nucleus, a single vesicle, a single cell lysate, a single cell nucleus lysate, or a single vesicle lysate (see Figures 1-2 and the corresponding paragraphs).
Regarding claim 7
The array of polynucleotides according to Macosko et al., wherein the array is bound to a micro-bead (e.g., microparticle or microbead) (see Figures 1-2).
Regarding claim 8
The micro-particle or array of polynucleotides according to Macosko et al., wherein the 3'-end analyte capture region comprises: (a) a polythymidine sequence (e.g., oligo-dT); or (c) a sequence of at least 10 nucleotides (e.g., T30 or oligo-dT of 30 nucleotides) for hybridising to a target polynucleotide analyte (e.g., mRNA) (see Figures 1-2; page 1203, column 2, paragraph 1).
Regarding claim 9
The micro-particle or array of polynucleotides according to Macosko et al., wherein the PCR handle sequence(s) are at least 15 nucleotides in length (see the PCR handle sequence (“AAGCAGTGGTATCAACGCAGAGT”) of “Barcoded Bead SeqA” or “Barcoded Bead SeqB” listed in Table S6).
Regarding claim 10
The micro-particle or array of polynucleotides according to Macosko et al., wherein the BC is 10-14 nucleotides (e.g., 12 nucleotides) in length and/or the UMI is 6 to 10 nucleotides (e.g., 8 nucleotides) in length (see Figure 1).
Regarding claim 11
The array of polynucleotides according to Macosko et al., wherein the 3' end analyte capture region is hybridised to a polynucleotide analyte (e.g., mRNA) (see Figure 2, panel A).
Regarding claim 12
The array of polynucleotides according to Macosko et al., wherein the 3' end analyte capture region is bound to analyte (e.g., mRNA), optionally wherein the analyte is mRNA (see Figure 2, panel A).
Regarding claim 13
The array of polynucleotides according to Macosko et al., wherein: (i) the 3' end analyte capture regions are polythymidine (e.g., oligo-dT) and the analytes comprise mRNA bound to the polythymidines; and (iii) the 3' end capture regions are polynucleotide (e.g., oligo-dT) sequences and the analytes comprise polynucleotides (e.g., mRNAs) hybridised to the polynucleotide capture regions (see Figure 2, panel A; page 1203, column 1, last paragraph).
Regarding claim 14
The array of polynucleotides according to Macosko et al., wherein the analytes bound to the polynucleotides of the array are from a single cell or cell nuclei (see Figure 2, panel A).
Allowable Subject Matter
5. Claims 2-4 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Response to Arguments
6. Applicant’s amendments and arguments filed 7/28/2026 have been fully considered. In view of applicant’s amendments to the claims, the rejections under 35 USC 112 have been withdrawn. However, the rejection under 35 USC 102 is maintained, with modification(s) as necessitated by amendment. Applicant’s argument(s) directed at the maintained rejection is not persuasive.
Applicant argues that “Macosko does not disclose an array of polynucleotides additionally comprising a 5’ end analyte capture region” (see page 11 of applicant’s response filed 7/28/2026).
This is not found persuasive because, as discussed in the rejection above, Macosko et al. teach each and every structural element required by the array of polynucleotides as recited in (B) of claim 1. Since a second PCR handle sequence is only optional in (B) of claim 1, the array of polynucleotides taught by Macosko et al. meets the structural element of “a 5’ end analyte capture region” in the following two ways: (1) for the embodiment with a second PCR handle sequence, “TTTTTTT” at the 5’-end of each polynucleotide (or barcoded primer) can serve as a 5’ end analyte capture region to capture a target containing the corresponding complementary sequence (“AAAAAAA”) by hybridization, while “AAGCAGTGGTATCAACGCAGAGT” (which is immediately 3’ to “TTTTTTT” at the 5’-end) is the PCR handle sequence; (2) for the embodiment without the optional second PCR handle sequence, “TTTTTTTAAGCAGTGGTATCAACGCAGAGT” at the 5’-end of each polynucleotide (or barcoded primer) can serve as a 5’ end analyte capture region to capture a target containing the corresponding complementary sequence by hybridization (see the sequence for “Barcoded Bead SeqA” or “Barcoded Bead SeqB” as listed in Table S6). Please note that any polynucleotide sequence segment is capable of serving as an analyte capture region (in a hybridization-based target/analyte capturing approach) because it can hybridize to its corresponding complementary sequence contained in a potential target/analyte.
Conclusion
7. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KAIJIANG ZHANG whose telephone number is (571)272-5207. The examiner can normally be reached Monday - Friday, 8:30 am - 5 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Heather Calamita can be reached at 571-272-2876. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KAIJIANG ZHANG/Primary Examiner, Art Unit 1684
Prosecution Insights