DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I, Claims 1-9, drawn to a method for diagnosis of presence of colorectal cancer in a subject, prognosis of colorectal cancer patient after surgery, predicting recurrence for a colorectal cancer patient after surgery, and assessing treatment efficacy for a colorectal cancer patient in the reply filed on 10/10/2025 is acknowledged.
Applicant’s election without traverse of the following species in the reply filed on 10/10/2025 is acknowledged:
a) for the tables, Applicant elects Table 3;
b) for the markers, Applicant elects the combination of markers MBSF9, MBSF10, MBSF15, MBSR5, MBSR6, MBSR7, MBSR8, MBSR9, MBSR11 and MBSR16;
c) for the primer sets and probes, Applicant elects the combination of primers and probes for detecting the above combination from Table 4, that is, the combinations of the primer pair of SEQ ID NOs: 10 and 11, the primer pair of SEQ ID NOs: 13 and 14, the primer pair of SEQ ID NOs: 16 and 17, the primer pair of SEQ ID NOs: 19 and 20, the primer pair of SEQ ID NOs: 22 and 23, the primer pair of SEQ ID NOs: 25 and 26, the primer pair of SEQ ID NOs: 28 and 29, the primer pair of SEQ ID NOs: 31 and 32, the primer pair of SEQ ID NOs: 34 and 35, and the primer pair of SEQ ID NOs: 37 and 38, and the combination of probes of SEQ ID NOs: 12, 15, 18, 21, 24, 27, 30, 33, 36 and 39;
d) for PCR primers, extension primers and competitors of tables 9-11, Applicant elects the combination of tables 9-11, for they are directed to PCR primers, extension primers and competitors respectively, and should be used together; specifically, for the PCR primers, Applicant elects the combination of all the sequences listed in table 9, i.e., the combination of SEQ ID NOs: 61-90; for the extension primers, Applicant elects the combination of all the sequences listed in table 10, i.e., the combination of SEQ ID NOs: 91-105; and for the competitors, Applicant elects the combination of all the sequences listed in table 11, i.e., the combination of SEQ ID NOs: 106-120.
Claims 10-18 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Groups II-IV, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/10/2025.
Claims 4 and 6-8 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/10/2025.
Claims Status
Claims 1-18 are pending.
Claims 4, 6-8 and 10-18 are withdrawn.
Claims 1-3, 5 and 9 are currently under examination
Priority
This application is a 35 U.S.C. § 371 national stage filing of International Application No. PCT/CN2020/101835 filed on July 14, 2020, which in turn claims priority to Chinese Application No. 20201045301 1.0, filed May 25, 2020.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-3, 5 and 9 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites “Table 2, Table 3 and Table 8", it is unclear what “Table 2, Table 3 and Table 8” are referring to as the claim should be complete and clear by limitations recited in the claims without referring to any tables or drawings disclosed in the specification. Claims 2-3, 5 and 9 depend from claim 1. See MPEP § 2173.05(s).
Claim 3 recites “Table 4", it is unclear what “Table 4” is referring to as the claim should be complete and clear by limitations recited in the claims without referring to any tables or drawings disclosed in the specification. Claims 4 depend from claim 3. See MPEP § 2173.05(s).
Claim 1 is indefinite over the claim reference or dependence upon a claim that references Table(s) 2, 3 or 8. The claim is unclear as to which database, build, version, etc. the Gene(s), Biomarker name(s) and chromosome location(s) are referring to, which are critical or essential to the practice of the invention but not included in the claims. Claims 2-6 and 9 depend on claim 1. See In re Mayhew, 527 F.2d 1229, 188 USPQ 356 (CCPA 1976).
Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The terms “MBSF9, MBSF10, MBSF15, MBSR5, MBSR6, MBSR7, MBSR8, MBSR9, MBSR11, MBSR16, RD1 and RD2” in claim 1 are used by the claim to mean “markers”, while the accepted meaning is “mortgage backed securities ETF”, “Mindfulness-Based Stress Reduction” and “region of difference 1 of Mtb”. The terms are indefinite because the specification does not clearly redefine the terms. Claims 2-3, 5 and 9 depend on claim 1 and may also include these indefinite terms.
Claim Rejections – Improper Markush
Claims 1-3, 5 and 9 are rejected under the judicially approved ‘‘improper Markush grouping’’ doctrine. (See Federal Register, Vol. 76, No. 27, Wednesday, February 9, 2011, page 7166). This rejection is appropriate when the claim contains an improper grouping of alternatively useable species. See In re Harnisch, 631 F.2d 716, 719–20 (CCPA 1980). A Markush claim contains an ‘‘improper Markush grouping’’ if: (1) the species of the Markush group do not share a ‘‘single structural similarity,’’ or (2) the species do not share a common use. Members of a Markush group share a ‘‘single structural similarity’’ when they belong to the same recognized physical or chemical class or to the same art-recognized class. However, when the Markush group occurs in a claim reciting a process or a combination (not a single compound), it is sufficient if the members of the group are disclosed in the specification to possess at least one property in common which is mainly responsible for their function in the claimed relationship, and it is clear from their very nature or from the prior art that all of them possess this property. See MPEP § 803.02.
Here each methylation marker is considered to be a differentially methylated region of in Table 2, Table 3, and Table 8. The recited alternative species in the groups set forth here do not share a single structural similarity, as each method relies on detection of different DNA methylation regions. Each different DNA methylation region that could be detected is itself located in a separate region of the genome and has its own structure. Different DNA methylation regions are not structurally the same when you consider the sequence required to identify one different DNA methylation region relative to another different DNA methylation region. The different DNA methylation region recited in the Tables referred to in the instant claims, and the methods which detect them, do not share a single structural similarity since each consists of a different DNA methylation region. The only structural similarity present is that all detected methylation positions are part of nucleic acid molecules. The fact that the markers comprise nucleotides or methylated nucleotides per se does not support a conclusion that they have a common single structural similarity because the structure of comprising a nucleotide alone is not essential to the common activity of being correlated with colorectal cancer. The association between the claimed different DNA methylation regions is not considered as ‘property’ as the association is a statistical construct, it is a conclusion based on analysis of a specific population and may not be present in subject outside of the population assayed. While the instant specification asserts different DNA methylation regions have a common function of being correlated with the asserted phenotype, the association between the claimed different DNA methylation region is not clear from their very nature. If the instantly claimed different DNA methylation regions are placed in a group with an equal number of different DNA methylation region the skilled artisan could not differentiate those associated with a phenotype from those that are not associated with a phenotype. Thus, the one of skill in the art could not identify those different DNA methylation regions that are asserted to be associated with the phenotype by their very nature. Thus, the instant claims have not met the requirements of a proper Markush group.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1-2, 5 and 9 are rejected under 35 U.S.C. 103 as being unpatentable over Laird et al. (“Laird”; Patent App. Pub. WO 2014062218 A1, Apr. 25, 2014).
Claim interpretation: Claim 1 recites the limitations “the subject may suffer from colorectal cancer, the subject with colorectal cancer may have poor prognosis after surgery, may be more likely to recur, or may have poor treatment efficacy” and “said methylation marker(s) may be one or more markers selected from Table 2, Table 3 and Table 8.” are considered optional. The limitation clause of “may” is interpreted as optional and thus the subsequent limitation is optional.
Laird discloses “Biomarkers for early detection of colorectal cancer are disclosed. A genome-scale marker discovery method or enhanced nucleic acid detection techniques such as digital MethyLight PCR may be used to identify and verify candidate DNA methylation biomarkers for blood -based detection of colorectal cancer.” (Abstract).
Regarding claim 1, Laird teaches a method wherein “a method of determining a diagnosis of cancer in an individual suspected of having cancer, including obtaining a sample from an individual suspected of having cancer, determining the presence or absence of a high level of expression in the individual relative to a normal baseline standard for a single diagnostic panel” (Pg. 3 ln 25-28). “the cancer is colorectal cancer... includes drawing a blood, serum or plasma sample from the individual… the prognosis provides a therapeutic selection for the prognosed individual, selected from the group consisting of: chemotherapy, radiotherapy, surgery, and combinations thereof… determining the expression level includes detecting methylation.” (Pg. 2, ln 34-37, Pg. 3. ln 5-8) Thus, Laird teaches a method for diagnosis of presence of colorectal cancer in a subject, prognosis of a colorectal cancer patient after surgery, predicting recurrence for a colorectal cancer patient after surgery, and assessing treatment efficacy for a colorectal cancer patient, comprising determining methylation level of cell-free DNA by detecting methylation marker(s) in the said cell-free DNA, wherein when the methylation level in the test subject is higher than the levels in control samples, the subject may suffer from colorectal cancer, the subject with colorectal cancer may have poor prognosis after surgery, may be more likely to recur, or may have poor treatment efficacy, the said methylation marker(s) may be one or more markers selected from Table 2, Table 3 and Table 8.
The teachings of Laird are documented above in the rejection of claims 1 under 35 U.S.C. 103. Claim 2, 5 and 9 depends on claim 1.
Regarding claim 2, “application of Digital PCR to multiplexed MethyLight assays allowed for efficient use of valuable samples by simultaneously analyzing more than one marker” (Pg. 28, ln 5-6). Laird teaches a method wherein “the SEPT9 assay utilizes... plasma” (Pg. 28, ln 32). Laird suggests a DNA methylation marker directed to Septin 9, which reads on one or more markers selected from MBSF9, MBSF10, MBSF15, MBSR5, MBSR6, MBSR7, MBSR8, MBSR9, MBSR11 and MBSR16. Thus, Laird teaches a method wherein the detection of DNA methylation markers is performed by multiplex quantitative methylation specific PCR, with methylation markers selected from any of the following: one or more markers selected from MBSF9, MBSF10, MBSF15, MBSR5, MBSR6, MBSR7, MBSR8, MBSR9, MBSR11 and MBSR16.
Regarding claim 5, Laird teaches a method wherein “labeled with different fluorophores… specific colored PCR outcomes that allowed distinguishing hits from each of these markers when they were run together (multiplex).” (Pg. 23 ln 10-12). Thus, Laird teaches a method wherein the detection of DNA methylation markers is by multiplex quantitative methylation specific PCR with DNA methylation markers dividing into two or more groups, with probes labeled with different fluorescence for each group and the internal control.
Regarding claim 9, Laird teaches a method wherein “obtaining a sample includes drawing a blood, serum or plasma sample from the individual” (Pg. 2, ln 34-37). Thus, Laird teaches a method wherein the said sample is selected from body fluids, blood, serum, plasma, urine, saliva, sweat, sputum, semen, mucus, tear, lymphatic fluid, amniotic fluid, interstitial fluid, pulmonary lavage fluid, cerebrospinal fluid, stool and tissues.
Claims 1-3 are rejected under 35 U.S.C. 103 as being unpatentable over Laird et al. (“Laird”; Patent App. Pub. WO 2014062218 A1, Apr. 25, 2014) in view of Zhao et al. (“Zhao”; Patent App. Pub. WO 2019233102A1, Dec. 12, 2019, English translation provided).
The teachings of Laird are documented above in the rejection of claims 1-2, 5 and 9 under 35 U.S.C. 103. Claim 3 depends on claim 2, which depends on claim 1. Laird does not explicitly teach the limitations of claim 3.
Zhao discloses “A primer and probe set for the diagnosis, detection, or screening of colorectal cancer, comprising amplification primers, a Blocker primer, and a probe for SEPT9, and amplification primers, a Blocker primer, and a probe for SDC2. The forward primer of SEPT9 is selected from any one of SEQ ID NOs: 1-25, the reverse primer of SEPT9 is selected from any one of SEQ ID NOs: 26-51, the Blocker primer of SEPT9 is selected from any one of SEQ ID NOs: 52-67, and the probe of SEPT9 is selected from any one of SEQ ID NOs: 68-90. The forward primer of SDC2 is selected from any one of SEQ ID NOs: 91-117, the reverse primer of SDC2 is selected from any one of SEQ ID NOs: 118-143, the Blocker primer of SDC2 is selected from any one of SEQ ID NOs: 144-156, and the probe of SDC2 is selected from any one of SEQ ID NOs: 157-174. In comparison with the prior art, methylation levels of SEPT9 and SDC2 can be simultaneously detected to screen, detect, or diagnose early colorectal cancer.” (Abstract).
Regarding claim 3, Zhao teaches a method wherein “primers and probe sets for colorectal cancer diagnosis, detection or screening, including amplification primers for SEPT9, Blocker primers and probes” (Pg. 3 ln 5-6).
PNG
media_image1.png
113
304
media_image1.png
Greyscale
PNG
media_image2.png
118
327
media_image2.png
Greyscale
Zhao teaches a method wherein “SEQ ID NO:27 TCGCGCGAAAAACAACGACGA” (Pg. 6, Table 12) which aligns with SEQ ID NO: 10 and “SEQ ID NO:72 GTTAACCGCGAAATCCGA” (Pg. 7, Table 12) which aligns with SEQ ID NO: 11. Zhao teaches a method wherein “contains a set of internal reference gene primer probe sets, wherein the internal reference gene is ACTB” (Pg. 3, ln 16). Thus, Zhao teaches a method wherein the said multiplex quantitative methylation specific PCR uses primers and probes for the DNA methylation markers in claim 2 and primers and probe for the internal control ACTB, wherein the said primers and probes comprise the sequences listed in Table 4, or sequences with at least 80% identity to those listed in Table 4.
Laird and Zhao are both considered to be analogous to the claimed invention because they are in the same field of diagnosis, detection or screening of colorectal cancer. Therefore, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method for diagnosis of presence of colorectal cancer in a subject as taught by Laird to incorporate the method of primers towards methylation markers in SEPTIN 9 as taught by Zhao and provide multiplex quantitative methylation specific PCR using primers and probes for the DNA methylation markers and internal control ACTB. Furthermore, designing probes and regions that are characteristic of nucleic acids of SEPTIN 9 methylation biomarkers which are equivalents to those taught in the art is considered to require only routine experimentation. The ordinary artisan would have been motivated at the time of filing to modify the composition of one or more biomarkers taught by Zhao to include equivalent probes that detect SEPTIN 9 biomarkers, according to other listed primers in Table 4. Doing so would allow for diagnosis of presence of colorectal cancer in a subject.
Conclusion
No claims are in condition for allowance.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KENDRA R VANN-OJUEKAIYE whose telephone number is (571)270-7529. The examiner can normally be reached M-F 9:00 AM- 5:00 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at (571)272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KENDRA R VANN-OJUEKAIYE/Examiner, Art Unit 1682
/WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682