Prosecution Insights
Last updated: April 19, 2026
Application No. 17/928,105

Systems and Methods for Stable and Heritable Alteration by Precision Editing (SHAPE)

Non-Final OA §101§102§103§112
Filed
Nov 28, 2022
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The General Hospital Corporation
OA Round
1 (Non-Final)
59%
Grant Probability
Moderate
1-2
OA Rounds
3y 10m
To Grant
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allow Rate
104 granted / 177 resolved
-1.2% vs TC avg
Strong +63% interview lift
Without
With
+62.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
56 currently pending
Career history
233
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
14.3%
-25.7% vs TC avg
§112
29.4%
-10.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 177 resolved cases

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status Applicant’s amendments filed June 22, 2023 are acknowledged. Claims 1-3, 9-10, 16-18, 21-31 and 37 are pending and under examination. Drawings The drawings are objected to because the text in FIGs. 1, 2, 12, 13B, 14B, 15B, 16B, 17B, 18B, 22 and 23 is not sufficient to provide satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.” In the instant case, the text in the above FIGs is light grey or otherwise not sufficiently dense and dark to permit satisfactory reproduction characteristics. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The use of the term Phusion®, Qubit®, TruSeq®, Quantifluor®, LightCycler®, Transit®, and MiSeq®, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections Claim 3 is objected to because of the following informalities: Claim 3 recites “(e) the candidate regulatory sequence motif is a hybridization target for endogenous noncoding RNAs, where the sequence motif that may or may not exist in the genome of interest”, which is grammatically incorrect. The “that” after “motif” should be deleted. Additionally, to maintain terminology it is suggested that “the sequence motif” be replaced with “the candidate regulatory sequence motif”. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-3, 9-10, 16-18, 21-31 and 37 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 1 and 21 are indefinite for two reasons. First, claims 1 and 22 recite “one or more candidate regulatory motif sequences with regulatory potential in the selected cell type”. The phrase “regulatory potential” renders the claims indefinite because it is not clear what defines a region as having regulatory potential. The Specification does not define “regulatory potential” in terms of precise or relative sequence similarity/identity to another sequence. It’s not clear if a sequence must have previously been shown to be capable of gene regulation for it to be considered potentially regulatory or if mere sequence similarity to a consensus sequence is sufficient to be considered potentially regulatory. As such the genus of “candidate regulatory motif sequences” is undefined. Second, claims 1 and 21 recite “selecting a sequence of a putative region of the target gene, preferably where the putative regulatory region is in a promoter…” Use of “preferably” renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d). Claims 2-3, 9-10, 16-18, 22-31 and 37 are rejected for depending from claim 1 or claim 21 and not remedying the indefiniteness. Claim 18 recites “(a) the CRISPR-Cas domain is used with a gRNA… comprises a sequence complementary to a sequence of the target cis-regulatory element of interest”. “The cis-regulatory element of interest” lacks clear antecedent basis. Claim 18 depends from claims 17 and 1, neither of which recite or inherently require a cis-regulatory element. Although most regulatory elements are in cis – meaning on the same molecule – with the genetic element they regulate, it is not absolute or inherent that the putative regulatory region be in cis with the unnamed/unclaimed gene target. Additionally, “of interest” renders the claim indefinite because “of interest” is a subjective term. What one would consider “of interest,” another may not. The metes and bounds of the claims are unclear with regard to the cis-regulatory elements that are of interest. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 37 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below: Nature of the Invention and Breadth of Claims Claim 37 is drawn to a method of treating or reducing the risk of a condition disease that is caused by “overexpression of the target gene” by administering a “genetic modifier identified using the method of claim 1”. Claim 1 recites a method of identifying a genetic modifier, such as a Cas9-based genome editor, that can incorporate a regulatory sequence, such as an enhancer sequence, into a regulatory region, such as promoter, of a target gene. “The target gene” recited twice in claim 37 is interpreted as referring back to “the target gene” recited in claim 1. As such, the administered genetic modifier must increase the expression of the target gene by targeting a regulatory region in the target gene, which then must treat or reduce the risk of a disease that is caused by overexpression of the target gene. In other words, claim 37 recites increased expression of an already overexpressed gene to result in treatment or reduction of risk a disease. Accordingly, enablement of the method requires one skilled in the art to know or predict a gene that when overexpressed causes a disease, and then increase the expression of the target gene even more to treat the disease. Incorporating sequence motifs into gene promoters to increase gene expression is well-known in the art (see e.g., the prior art rejections below). However, it is not predictable that increasing the expression of a gene whose overexpression causes a disease, would treat the disease for the reasons below. Guidance in the Specification The specification states “methods for treating or reducing risk of a condition or a disease in a subject, wherein the condition or the disease is caused, at least in part, by overexpression of the target gene, the method comprising administering to the subject an effective amount of a genetic modifier identified using a method as described herein, under conditions sufficient to increase the target gene expression in the cell, thereby treating or reducing risk of the condition or the disease in the subject.” (page 7, lines 11-16). The Specification also teaches methods of altering expression of disease-related target genes (page 72) and lists diseases that are caused by haploinsufficiency (i.e., insufficient expression) (Table 5) and caused by non-coding mutations (Table 6). Table 6 lists some disease associated SNPs that are predicted to result in increased enhancer activity or gain of an enhancer, both of which would be predicted to overexpress the associated gene in the disease state. However, the Specification does not disclose 1) what the diseases the gain-of-enhancer activity are linked to, or 2) how increasing expression of those genes would treat any undisclosed or generic disease. The Specification provides working examples on incorporating TF-binding sites into the MYOD1 locus (pages 179-180) and in the HBB, IL2RA, HER2 and EpCAM promoters (page 181). However, there is no evidence in the specification or the art that increasing expression of MYOD1 in cells that already overexpress MYOD1 can treat or prevent any disease. Accordingly, in light of the specification, it is highly unpredictable that increasing expression of a target gene whose overexpression causes a disease can treat and/or prevent a disease caused by the overexpression. State of the Prior Art In 2022, Tsai reviews the state of the art concerning the tools for manipulation of gene expression for clinical purposes (Tsai et al., Journal of Translational Medicine (2022), 20: 535, pages 1-21). Tsai teaches a variety of human diseases are defined by modifications in gene expression patterns including upregulation (i.e., overexpression) (page 1, ¶1). However, unlike the claimed method, Tsai teaches that to treat the disease, it is crucial to rewire aberrant gene expression “back to physiological conditions” (page 2, ¶2). Increasing expression of a gene whose overexpression causes the disease would be considered the exact opposite of bringing cells “back to physiological conditions”. A thorough search of the prior and contemporary art found no example of increasing gene expression would treat a disease that is caused by the overexpression of that same gene. Thus, in view of the prior art, it would be highly unpredictable how one skilled in the art could treat and/or prevent a disease by increasing expression of a target gene whose overexpression causes the disease. Experimentation Required In order to practice the invention, one skilled in the art would need to identify diseases that are caused by gene overexpression, design genetic modifiers to further increase expression of the causative gene and determine whether such increased expression is likely to result in treatment and/or prevention of the genus of diseases. However, given that 1) no such treatment has ever been developed and 2) the general understanding in the art for treating diseases causes by overexpression of a gene is to decrease the causative gene’s expression, it would be considered undue experimentation to discover and then deliver such a genetic modifier. Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant, and the lack of working examples of gene editing in eukaryotic cells, it is the conclusion that an undue experimentation would be required to make and use the invention as claimed. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-3, 9-10, and 16-18 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. The claims are drawn to methods for identifying genetic modifiers by comparing, selecting, and identifying sequences, which are abstract ideas. However, the claims do not include elements, when considered separately and in combination, that are sufficient to amount to significantly more than the judicial exceptions as outlined below. Subject Matter Eligibility Test for Products and Processes – Claim 1 Step 1 - Is the Claim to a Process, Machine, Manufacture or Composition of Matter? YES Claim 1 is directed to a method of identifying a genetic modifier and comprises a series of steps. Thus, the claims are directed to a statutory category (e.g., a process). Step 2A, Prong One - Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES Abstract ideas have been identified by the courts by way of example, including mental processes and natural correlations. Claim 1 recites 5 judicial exceptions: selecting a sequence, comparing the sequence to a provided sequence, identifying sequences based on sequence similarities during the comparison, determining changes that can be made in the sequence, and identifying a genetic modifier that can be used to bring about the desired change. Although the claims recite that “optionally” the identifying can be made with an algorithm, which could use a computer, the use of the algorithm is optional. Additionally, MPEP 2106.04(a)(2).III.C indicates a claim that requires a computer may still recite a mental process. In this case identifying a genetic modifier that is a CRISPR/Cas9 effector merely requires finding a short PAM sequence, like 5’-NGG, and recording the 20 upstream nucleotides that would be used to engineer the targeting sequence in the guide RNA. Step 2A, Prong Two - Does the Claim Recite an Additional Elements that Integrate the Judicial Exception into a Practical Application? NO The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception. In this case, once the genetic modifier is identified, there is no step that requires the use of the genetic modifier. Therefore, none of the steps that recite mental processes are integrating into a practical application. Step 2B - Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim (MPEP 2106.05). However, the additional elements, individually and in combination, do not amount to "significantly more". Claim 1 only recites one additional step/element: providing one or more candidate regulatory motif sequences with regulatory potential. However, providing, studying, inserting and manipulating regulatory motifs is well known in the art. For instance, Lee teaches the cis-regulatory element that a CRX transcription factor binds to promote photoreceptor-specific gene expression (Lee et al., Gene Therapy (2010), 17: 1390-1399; Abstract). Lee teaches providing the CRX-binding sequence, and manipulating the positions in the binding sequence to determine residues that drive high gene expression (Figure 1). Therefore, the claim does not amount to something significantly more than the judicial exceptions. Subject Matter Eligibility Test for Products and Processes – Dependent Claims Claims 2-3 merely limit or further define the candidate regulatory sequences that are provided and compared. The claims do not recite a practical application or any additional step or element that that amounts to significantly more than the judicial exceptions. Claims 9-10 merely limit or further define the putative sequences that are used to compare to the candidate sequences. The claims do not recite a practical application or any additional step or element that that amounts to significantly more than the judicial exceptions. Claims 16-18 limit the capability and structure of the genetic modifiers and still encompass CRISPR/Cas9 nuclease and base editors. However, because the engineering principles of guide RNA design for base editors and prime editors are known and can be performed by the human mind without the aid of a computer, the “identification” step is still considered a judicial exception. The claims still do not recite a practical application of administering the genetic modifiers or any additional step or element that that amounts to significantly more than the judicial exceptions. Claim Rejections - 35 USC § 102 - Garst The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-3, 9-10, 16-18 and 21-25 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Garst (Garst et al., Nature biotechnology (2017), 35: 48-55 and Online Methods and Supplemental Material). Regarding claim 1, Garst teaches using CRISPR/Cas9 (i.e., a genetic modifier) based genome engineering to incorporate changes in promoter sequences (Abstract; Supp Fig 1b). Garst teaches providing UP and CAP promoter elements (i.e., one or more candidate regulatory motif sequence that can regulate transcription) (Supp Fig 1, Supp Table 1; Online Methods, ¶4-6). Garst teaches designing a library of gRNAs that can incorporate the UP element into 3794 different promoter sequences (i.e., selecting a sequence of a putative regulatory region, that is a promoter, of a target gene) (Supp Fig 1, Supp Tables 1-2; Online Methods, ¶4-6). Garst teaches comparing the UP element to the target promoter regions and determining that the UP element is not present (i.e., has no identity) to the targeted insertion site (Supp Fig 1). Garst teaches that the entire UP element is to be inserted into the targeted promoters (i.e., determining the sequence alterations needed to make the putative regulatory region match the candidate regulatory motif sequence) (Supp Fig 1). Garst teaches designing (i.e., identifying) the sgRNA needed to direct Cas9 to the targeted promoters and integrate the UP element sequence (Supp Tables 1-2; Online Methods, ¶4-6). Regarding claim 2, Garst teaches the UP elements affect gene transcription (Online Methods, ¶4, 6). Regarding claim 3, Garst also teaches libraries incorporating the CAP element (i.e., a candidate regulator sequence motif) into promoters that don’t normally have them (Supp Fig 1, Supp Tables 1-2; Online Methods ¶4,6). Garst teaches that CAP elements recruit the endogenous transcription factor CAP to the promoter (Online methods, ¶4,6). Regarding claims 9-10, Garst teaches the targeted regions for the UP and CAP elements are in the promoter regions within 66 nucleotides of the target genes (i.e., have the potential to modify expression of the target gene at the pre-transcriptional level) (Online Methods, ¶4, 6). Regarding claim 16, Garst teaches the CRISPR/Cas9 genetic modifier introduced the UP and CAP elements (i.e., a specific sequence motif) in the targeted promoters (Supp Fig 1; Online Methods, ¶4,6). Regarding claim 17-18, Garst teaches the genetic modifier is Cas9 (i.e., a CRISPR-Cas domain) and guide RNAs (gRNAs) that target (i.e., have a sequence complementary) to the targeted promoter (Supp Fig 1; Online Methods, ¶4,6; Supp Tables 1-2). Regarding claim 21, the teachings of Garst are recited as for claim 1-3, 9-10 and 16-18 and incorporated here. Briefly, Garst teaches incorporating UP and CAP elements that are regulator motifs not present in the targeted promoters, using the genetic modifier Cas9/sgRNAs. Garst teaches contacting bacterial cells with Cas9, sgRNAs as a targeting cassette to incorporate the UP or CAP elements in the selected promoters (Online Methods, ¶ 4, 6, 13-15). Regarding claim 22, Garst teaches using “automated CREATE design software” (i.e., an algorithm) to design the promoter libraries taking into account the transcriptional start site and canonical recognition sequences for the UP elements from publicly available databases (i.e., identifying differences between the UP or CAP elements in the targeted promoter) (Online Methods, ¶6). Regarding claim 23, the teachings of Garst are recited as for claim 1-3, 9-10 and 16-18 and incorporated here. Briefly, Garst teaches incorporating additional UP element regulatory motifs in targeted promoters, using the genetic modifier Cas9/sgRNA. Garst teaches the UP elements directly recruit the alpha subunit of RNA Polymerase (i.e., a method for altering expression of a target gene to increase the target gene expression in the cell) (Online Methods, ¶6). Regarding claim 24, “heterotopic activation of a target gene expression” is interpreted as increased expression of a target gene beyond what is normally achieved in the cell. The teachings of Garst are recited as for claim 1-3, 9-10 and 16-18 and incorporated here. Briefly, Garst teaches incorporating CAP element regulatory motifs in targeted promoters, using the genetic modifier Cas9/sgRNAs. Garst teaches the CAP elements bind to CRP, a transcriptional activator that is active in low glucose (i.e., a method for altering expression of a target gene to increase the target gene expression in the cell when glucose is low) (Online Methods, ¶6). Garst teaches selecting cells based on growth in M9 media + 0.2% glucose (i.e., low glucose to increase heterotopic gene expression of target genes that normally do not contain CAP promoter sites) (Online Methods, page 2, ¶7). Regarding claim 25, Garst teaches incorporating the UP element and CAP element as a single motif (Supp Fig 1). Claim Rejections - 35 USC § 102 - Ambavaram Claims 1-2, 9-10, 16-18, 21-25 and 28 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Ambavaram (US 20220235364 A1, priority to at least May 13, 2020). Regarding claim 1, Ambavaram teaches designing Cas9/gRNA systems and donor DNAs for homologous recombination (i.e., a genetic modifier) based on the sequence of a target promoter (i.e., selecting a sequence of a putative regulatory region) and a known enhancer (i.e., providing a candidate regulatory motif) (Fig 5). Ambavaram teaches comparing to sequence of the promoter region to the enhancer and determining that the enhancer is not present in the promoter (Fig 5). Ambavaram teaches inserting the enhancer upstream of the promoter sequence would result in the promoter comprising/matching the enhancer sequence (Fig 5C). Ambavaram teaches designing/identifying guide target C and the promoter enhancer insertion cassette (Fig 5B). Regarding claim 2, Ambavaram teaches enhancer insertion upregulates transcription of the target polynucleotide (i.e., regulatory potential to affect expression at the pre-transcriptional level) ([0227]). Regarding claims 9 and 10, Ambavaram teaches inserting the enhancer sequence in the gene promoter (i.e., the regulatory region insertion site has the potential to modify expression of the target gene at the pre-transcriptional level) (Fig 5). Regarding claims 16-18, Ambavaram teaches using CRISPR/Cas9 nuclease (i.e., a CRISPR-Cas domain) to insert the enhancer sequence in the gene promoter (i.e., modification of the target genomic region) (Fig 5). Ambavaram teaches the guide RNA is designed to comprise a sequence that is complementary to the region upstream of the target gene (FIG 3). Regarding claim 21, the teachings of Ambavaram are recited as for claim 1-2, 9-10 and 16-18 and incorporated here. Briefly, Ambavaram teaches designing Cas9/gRNA systems and donor DNAs for homologous recombination (i.e., a genetic modifier) based on the sequence of a target promoter (i.e., a putative regulatory region) and a known enhancer (i.e., providing a candidate regulatory motif) (Fig 5). Ambavaram teaches delivering the Cas9/sgRNA/donor DNA components to plant cells ([0133]-[0134], [0338]). Regarding claim 22, the “algorithm” required to compare the regulatory regions and candidate motifs, identify differences between the two, and compare the differences between the two and modifications that can be made by genetic modifiers, is not limited by the claim or defined by the Specification. The BRI of “algorithm” is a series of steps or commands. Ambavaram teaches each of the steps in the method of claim 21 as described above. Ambavaram also compares the differences between the promoter that is lacking the enhancer sequence and the enhancer sequence (Fig 5). Thus, Ambavaram teaches using as series of steps to identify the Cas9/sgRNA and donor DNA template used to introduce enhancer into the plant promoter. Regarding claim 23, the teachings of Ambavaram are recited as for claim 1-2, 9-10 and 16-18 and incorporated here. Briefly, Ambavaram teaches designing Cas9/gRNA systems and donor DNAs for homologous recombination (i.e., a genetic modifier) based on the sequence of a target promoter (i.e., a putative regulatory region) and a known enhancer (i.e., providing a candidate regulatory motif) (Fig 5). Ambavaram teaches incorporating enhancers into promoters to increase gene expression of the target gene ([0227]). Regarding claim 24, “heterotopic activation of a target gene expression” is interpreted as increased expression of a target gene beyond what is normally achieved in the cell. The teachings of Ambavaram are recited as for claim 1-2, 9-10 and 16-18 and incorporated here. Briefly, Ambavaram teaches designing Cas9/gRNA systems and donor DNAs for homologous recombination (i.e., a genetic modifier) based on the sequence of a target promoter (i.e., a putative regulatory region) and a known enhancer (i.e., providing a candidate regulatory motif) (Fig 5). Because Ambavaram teaches the enhancer is not normally present in the promoter sequence of the target gene, incorporation of the enhancer is considered as encompassed by heterotopic activation. Regarding claim 25, Ambavaram teaches incorporating a single enhancer sequence (i.e., a single motif) (Fig 5). Regarding claim 28, Ambavaram teaches genome editing in plant cells (i.e., eukaryotic cells) ([0338]). Claim Rejections - 35 USC § 102 - Liu Claims 1-3, 9-10, 16-18, 21-25 and 27-31 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Liu (WO 2019079347 A1, published April 25, 2019). Claim 3 is evidenced by Wienert (Wienert et al., Blood (2017), 130: 803-807). Regarding claim 1 and 28-30, Liu teaches methods using Cas9 and guide RNAs (i.e., genetic modifiers) to generate promoter mutations that increase gene expression of a target gene (Abstract). Liu teaches that humans with the genetic condition hereditary persistence of fetal hemoglobin (HPFH) are resistant to some b-globin diseases like sickle-cell disease ([0276]). Liu teaches in HPHF human subjects, the promoter of the HBG1 and HBG2 genes allows sustained expression of fetal hemoglobin in cells (i.e., providing a candidate regulator motif sequence with regulatory potential in a eukaryotic, mammalian, human cell type) ([0276]). Liu teaches the HBHF HBG1/2 promoter and the wildtype HBG1/2 promoters (i.e., a putative regulatory region of the HBG1/2 genes) are different at the -198 position (comparing the sequence of the putative regulatory region to the candidate regulatory motif) ([0276]). Liu teaches that a 198T[Wingdings font/0xE0]C in the HBG1 and HBG2 promoters are needed to convert the wildtype promoter to the HPHF b-globin disease resistant promoter (i.e., the candidate motif) ([0276]). Liu teaches designing an sgRNA to be used with a Cas9-based adenine-base editor to make the genetic change in the wild type HBG1/2 promoters to match the HPHF HMG1/2 promoters ([0276]). Regarding claim 2, Liu teaches that the 198T[Wingdings font/0xE0]C mutations in the HMG1/2 promoters increase expression of fetal hemoglobin in adults ([0276]). Regarding claim 3, Liu is silent as to the role of the 198T[Wingdings font/0xE0]C motif in transcriptional activation of HBG1 and HBG2. Wienert teaches the KLF1 transcription factor binds to the 198T[Wingdings font/0xE0]C mutation in the gamma-globin gene in HPHF patients and drives expression of the 198T[Wingdings font/0xE0]C promoter (Abstract; page 803, ¶2; Fig 2I). Therefore, Liu’s 198T[Wingdings font/0xE0]C motif incorporated into the wildtype HBG1/2 promoters inherently incorporated a transcription factor binding sequence that recruits endogenous transcription factors within a cell. Regarding claim 9, Liu teaches the HBG1/2 promoters control transcription of the HBG1/2 genes (i.e., the putative regulator region can modify the target gene expression at the pre-transcriptional level ([0276]). Regarding claim 10, as indicated above for claim 1, the regulatory region that is provided is the HBG1/2 promoters ([0276]). Regarding claims 16-18, as indicated above for claim 1, Liu teaches a CRISPR/Cas9/sgRNA-mediated base editor to introduce the 198T[Wingdings font/0xE0]C modification ([0276]). Liu teaches the sgRNA comprises a targeting sequence complementary to the HBG1/2 promoter around the -198 position ([0276]; FIGs 6 and 15). Regarding claim 21, the teachings of Liu are recited as for claim 1-3, 9-10 and 16-18 and incorporated here. Briefly, Liu teaches incorporating an 198T[Wingdings font/0xE0]C modification (i.e., a candidate regulator motif) into the wild type HMG1/2 promoter (i.e., a putative regulatory region) by designing and using the genetic modifier Cas9/sgRNAs. Liu teaches contacting HEK293 cells with the dCas9-ABE and sgRNAs targeted to the HBG1/2 promoters ([0029]-[0030], [0276], FIGs 6, 14 and 15). Regarding claim 22, the “algorithm” required to compare the regulatory regions and candidate motifs, identify differences between the two, and compare the differences between the two and determine modifications that can be made by genetic modifiers, is not limited by the claim or defined by the Specification. The BRI of “algorithm” is a series of steps or commands. Liu teaches each of the steps in the method of claim 21 as described above. Liu also compares the differences between the wild type HBG1/2 promoters and HPHF HBG1/2 promoters and determines that the -198T[Wingdings font/0xE0]C alternation can be made by the available dCas9 adenine base editors ([0276]; Fig 14-15). Thus, Liu teaches using a series of steps to identify the dCas9-ABE used to introduce the -198T[Wingdings font/0xE0]C motif. Regarding claims 23-24, the teachings of Liu are recited as for claim 1-3, 9-10, 16-18 and 21 and incorporated here. Liu teaches the -198T[Wingdings font/0xE0]C alteration increases the expression of fetal hemoglobin ([0276]). Liu teaches in adult cells fetal hemoglobin is not expressed in wild type cells, but by incorporating the -198T[Wingdings font/0xE0]C alteration in the HBG1/2 promoters, fetal hemoglobin is expressed in adult cells (i.e., heterotopic activation of a target gene in an adult cell) ([0276]). Regarding claim 25, Liu teaches incorporating the -198T[Wingdings font/0xE0]C alteration as single motif in each of the HBG1 and HBG2 promoters ([0276]; FIG 14). Regarding claim 27, Liu teaches using Cas9-ABE/sgRNA to introduce two edits, one in each of HBG1 and HBG2 promoters ([0276], FIG 14). Regarding claim 31, the teachings of Liu are recited as for claim 1-3, 9-10, 16-18 and 21 and incorporated here. Liu teaches incorporating the -198T[Wingdings font/0xE0]C alteration in the HBG1/2 promoters to increase expression of fetal hemoglobin in adult cells for the purpose of treating hemoglobinopathies, such as sickle cell disease ([0276]). Because sickle cell disease is caused in part by a lack of sufficient wildtype oxygen-binding hemoglobin like gamma/fetal hemoglobin, sickle cell disease is interpreted as being caused in part by insufficient expression of fetal hemoglobin. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 26 is rejected under 35 U.S.C. 103 as being unpatentable over Liu (WO 2019079347 A1, published April 25, 2019) as applied to claims 1-3, 9-10, 16-18, 21-25 and 27-31 above, and further in view of Orkin (Orkin and Bauer, Annual Review of Medicine (2019), 70: 257-271), Wang (Wang et al., Cell Research (2020), 30: 276-278, published January 7, 2020) and Slaymaker (US 20210252118 A1, priority to at least February 13, 2020). The teachings of Liu are recited above as for claims 1-3, 9-10, 16-18, 21-25 and 27-31, which are incorporated here. Liu also teaches a sgRNA sequence used to incorporate the HPFH HMG1/2 -198T[Wingdings font/0xE0]C motif into the wild type HMG1/2 promoter comprises GUGGGGAAGGGGCCCCCAAG (Fig 14). Liu does not teach editing the same target gene in two different locations to affect the expression of the target gene. Orkin teaches a comparison between the wildtype HMG1 promoter and the HMG1 promoter in patients with hereditary persistence of fetal hemoglobins (HPFH) patients (Figure 2). Orkin teaches that mutating two cytosines at the -114 and -115 positions (i.e., a candidate regulatory motif sequence confers the HPFH phenotype by removing a BCL11A binding site (Figure 2). Orkin teaches that Cas9-based base editing can be used in therapy for sickle cell disease (page 266, ¶1). Wang teaches a strategy for increasing expression of the HBG1/2 genes by targeting the BCL11A binding site in the HBG1/2 promoter with Cas9/sgRNA-mediated editing (page 276, ¶1). Wang teaches designing sgRNAs that can target the BCL11A binding site (i.e., a putative regulatory region) so that it no longer resembles the BCL11A binding site (i.e., alter it to a candidate regulatory motif sequence) (Fig 1a and h). Wang teaches using a Cas9 cytosine base editor to mutate two cytosines to disrupt the BCL11A binding site in the HMG1/2 promoter (Fig 1h). Wang teaches that changing the CC motif to a T/A/G motif by base editing increased the gamma globin production to 40% (Fig 1i). Wang teaches the sgRNA targeting sequence is CTTGACCAATAGCCTTGACA (Fig 1a). Slaymaker also teaches methods of altering the expression of the HMG1/2 genes to increase fetal hemoglobin expression by incorporating HPFH-linked regulatory motifs into the HMG1/2 promoters ([0183], [0187], [0215], FIG 7A). Slaymaker teaches a list of sgRNA targeting sequences to incorporate HPFH motifs into the wild type HMG1/2 promoter (Table 10). Slaymaker teaches one such sgRNA sequence that can be used to edit the -198 position in HMG1/2 with an adenine base editor is GUGGGGAAGGGGCCCCCAAG (Table 10). Slaymaker teaches one sgRNA sequence that can be used with cytosine base editors or adenine base editors to affect the -114 and -115 BCL11A-binding site is CUUGACCAAUAGCCUUGACA (Table 10). Slaymaker teaches that bae editor systems can be capable of editing multiple bases (i.e., multiplexing) in the same the gene ([0563]). Slaymaker teaches multiple editing can comprise using one or more base editor systems with a plurality of guide polynucleotides ([0563]). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used two Cas9 base editors to incorporate both the -198T[Wingdings font/0xE0]C and the -114/-115 non-CC motifs of the HPFH HMG1/2 promoter sequence into the wild type HMG1/2 promoter. It would have amounted to the simple combination of incorporating known regulatory motifs into known promoters by known means to yield predictable results. The skilled artisan would have predicted that two different base editors with two different sgRNAs could be used to contact the cells to make both edits because 1) each base editor was demonstrated to be effective at producing the intended edit individually and 2) Slaymaker teaches that base editors can be used during multiplex editing and used to generate multiple edits in a single gene. Additionally, Slaymaker lists the two sgRNAs that are used in Liu’s and Wang’s base editing methods. The skilled artisan would have been motivated to incorporate both HPFH regulatory motifs into the HMG1/2 promoters to increase the overall expression of gamma globin for the treatment of hemoglobinopathies, which is a known therapy as indicated by all cited references. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Nov 28, 2022
Application Filed
Jun 12, 2025
Response after Non-Final Action
Sep 18, 2025
Non-Final Rejection — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12454686
In Vitro Cleavage of DNA Using Argonaute
2y 5m to grant Granted Oct 28, 2025
Patent 12448630
CRISPR-CAS SYSTEMS AND USES THEREOF
2y 5m to grant Granted Oct 21, 2025
Patent 12442052
ANALYSIS OF POLYNUCLEOTIDES
2y 5m to grant Granted Oct 14, 2025
Patent 12435321
CRISPR/CAS12J ENZYME AND SYSTEM
2y 5m to grant Granted Oct 07, 2025
Patent 12416011
BIOCONTAINMENT/BIOCONTROL SYSTEM AND METHODS
2y 5m to grant Granted Sep 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+62.6%)
3y 10m
Median Time to Grant
Low
PTA Risk
Based on 177 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month