DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
Claims 1 and 5-16 are pending.
Claims 10-16 are withdrawn from consideration for being drawn to a non-elected invention.
Claims 1 and 5-9 are examined herein.
Claims 1 and 5-9 are rejected.
Priority
Application No. 17/928,516 filed on 11/29/2022 is a 371 of PCT Application No. PCT/KR2022/007757 filed on 05/31/2022 and also claims foreign priority to Korean Application No. KR10-2021-0080363 filed on 06/21/2021.
Applicant’s submission of a certified English translation of the foreign application is acknowledged (see Doc Code FR TRANS, dated 04/08/2026).
Claim Objections
This is a new objection, necessitated by Applicant’s amendment(s).
Claim 1 is objected to because of the following informalities: Claim 1 recites “a second polynucleotide into which the first polynucleotides is transcribed” which should read “a second polynucleotide into which the first polynucleotide[[s]] is transcribed”. Appropriate correction is required.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This is a modified rejection from the previous rejection set forth in the Office Action dated 01/09/2026, necessitated by Applicant’s amendments.
Claims 1, 5-6, and 8-9 are rejected under 35 U.S.C. 103 as being unpatentable over Qi (WO-2021072288-A1) and as evidenced by Ryan (Ryan, S. M., Cane, K. A., DeBoer, K. D., Sinclair, S. J., Brimblecombe, R., & Hamill, J. D. (2012). Structure and expression of the quinolinate phosphoribosyltransferase (QPT) gene family in Nicotiana. Plant Science, 188, 102-110).
This is a modified rejection from the previous rejection set forth in the Office Action dated 01/09/2026, necessitated by Applicant’s amendments.
Claim 1 is drawn to a plant cell genetically engineered to have reduced expression or activity of at least two quinolinic acid phosphoribosyl transferase (QPT) genes or at least two QPT protein proteins encoded by the at least two OPT genes, compared to a parent cell of the plant cell, wherein the plant cell exhibits a nicotine content reduced by 97% or more compared to the parent cell of the plant cell, wherein the at least two OPT genes comprise a QPT gene originated from N. sylvestris (QPT2s) and a QPT gene originated from N. tomentosiformis (QPT2t), wherein the plant cell is genetically engineered by a CRISPR/Cas system to simultaneously inactivate the QPT2s and QPT2t, wherein the CRISPR/Cas system comprises:
(a) a first polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13; or
(b) a second polynucleotide into which at least one of the one or more first polynucleotides is transcribed;
and wherein the parent cell is a cell that has not been artificially manipulated to reduce the expression or activity of the at least two QPT genes or at least two QPT proteins, and is a cell freshly isolated from a plant or a cell culture thereof.
Claim 5 is drawn to the plant cell of claim 1, wherein the second polynucleotide is a sgRNA comprising CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA).
Claim 6 is drawn to the plant cell of claim 1, wherein the second polynucleotide targets at least one site in the region consisting of Exons 1 to 8 of the at least two QPT genes.
Claim 8 is drawn to the plant cell of claim 1, wherein the plant is Nicotiana tabacum.
Claim 9 is drawn to a plant comprising the plant cell of claim 1.
Regarding claim 1, Qi teaches a tobacco (Nicotiana tabacum) plant or part thereof comprising one or more mutant alleles in QPT genes QPT2a and QPT2b (claims 1 and 24 of Qi, ¶0025). As evidenced by Ryan, many varieties of Nicotiana tabacum have two QPT2 genes, one from each of Nicotiana sylvestris and Nicotiana tomentosiformis progenitors, designated QPT2a and QPT2b (see results, ¶1-2 of Ryan). Therefore, the QPT2a and QPT2b genes taught by Qi are reasonably interpreted to have originated from Nicotiana sylvestris and Nicotiana tomentosiformis. Qi also teaches wherein said one or more mutant alleles result in one or more of a QPT protein truncation, a non-translatable QPT gene transcript, a non-functional QPT protein, a premature stop codon in a QPT gene, and any combination thereof (claim 18 of Qi) (i.e. reduced expression or activity of the QPT genes). Qi teaches the tobacco plant produces a leaf comprising a nicotine level less than 0.25% of the nicotine level of a leaf from a control tobacco plant not having the one or more mutant alleles (i.e. 99.75% less which is encompassed by “reduced by 97% or more”).
Regarding claim 6, Qi teaches the one or more mutant alleles comprise mutations located in regions including the first, second, or third exon (i.e. wherein the second polynucleotide targets at least one site in the region consisting of exons 1 to 8) (claim 16 of Qi).
Regarding claim 8, Qi teaches the plant is Nicotiana tabacum (claims 1 and 24 of Qi, ¶0025).
Regarding claim 9, the claims of Qi are drawn to a tobacco plant or part thereof comprising the mutations to the QPT2a and QPT2b genes (i.e. therefore the claims of Qi encompass the plant comprising the mutated plant cells) (claims 1 and 24 of Qi, ¶0025).
However, Qi does not explicitly teach in a single embodiment:
wherein the plant cell is genetically engineered by a CRISPR/Cas system to simultaneously inactivate the QPT2s and QPT2t, wherein the CRISPR/Cas system comprises: (a) a first polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13; or (b) a second polynucleotide into which the first polynucleotide is transcribed (remaining limitation of claim 1).
wherein the second polynucleotide is sgRNA comprising CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) (claim 5).
Regarding the remaining limitation of claim 1, in an alternative embodiment, Qi teaches the tobacco plant or plant genome is mutated or edited by a nuclease selected from the group that includes CRISPR/Cas9 nuclease (¶0089). Qi also teaches the cDNA sequences of QPT2a and QPT2b (SEQ ID NOs: 7-8 of Qi, respectively) comprise sequences within the region of exon 2 of the genes that have 100% sequence identity to instant SEQ ID NO: 13 (see alignment below) (Table 8A, claim 6 of Qi).
Regarding claim 5, Qi teaches the CRISPR/Cas9 systems are based on RNA-guided engineered nucleases that use complementary base pairing to recognize DNA sequences at target sites. Qi further teaches CRISPR/Cas9 is derived from a bacterial immune system, and the CRISPR arrays, including the spacers, are transcribed during subsequent encounters with invasive DNA and are processed into small interfering CRISPR RNAs (crRNAs) approximately 40 nt in length, which combine with the trans-activating CRISPR RNA (tracrRNA) to activate and guide the Cas9 nuclease (i.e. the CRISPR/Cas9 system comprises a second polynucleotide that is a sgRNA comprising CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA)) (¶00101-00102).
Claims 1, 5-6, and 8-9 are obvious in view of Qi. Based on the above teachings, the product that is the plant cell or plant produced by the method of claim 1 is structurally identical to the plant disclosed by Qi. The MPEP states "[E]ven though product-by-process claims are limited by and defined by the process, determination of patentability is based on the product itself. The patentability of a product does not depend on its method of production. If the product in the product-by-process claim is the same as or obvious from a product of the prior art, the claim is unpatentable even though the prior product was made by a different process." In re Thorpe, 777 F.2d 695, 698, 227 USPQ 964, 966 (Fed. Cir. 1985)” (MPEP 2113.I). Therefore, even though Qi does not teach the method step in claim 1 that is “wherein the plant cell is genetically engineered by a CRISPR/Cas system to simultaneously inactivate the QPT2s and QPT2t, wherein the CRISPR/Cas system comprises: (a) a first polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13; or (b) a second polynucleotide into which at least one of the one or more first polynucleotides is transcribed” (specifically, Qi does not teach using the claimed gRNA), the claims are drawn to a plant cell and a plant produced by the method recited in claim 1, which is obvious in view of the plant taught by Qi. This is because the gRNA of SEQ ID NO: 13 targets exon 2, and therefore the final product of the instant invention is a plant cell or plant with a mutation in exon 2 of QPT2a and QPT2b that reduces expression of these genes and reduces nicotine content by at least 97%. Since Qi teaches a plant cell with mutations in exon 2 of QPT2a and QPT2b that reduces expression of these genes and nicotine content by up to 99.75% (claims 1, 13, 16-18, and 24 of Qi), the claimed plant cell and plant are therefore unpatentable. Additionally, Qi teaches exon 2 of QPT2a and QPT2b is at positions 665-801 and 635-771 of the genomic DNA (or positions 60-196 of the cDNA), thus limiting the mutation to within the 136 bp region. Selecting the particular gRNA to target exon 2 including the gRNA transcribed by SEQ ID NO: 13 would be a matter of experimental design, and Applicant’s data indicates majority of chosen and tested sgRNAs will produce at least some plant cells with mutations induced by the respective gRNAs (spec., p. 26-27, Table 6). For these reasons, the product of the claimed plant in claims 1, 5-6, and 8-9 is obvious in view of Qi.
Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Qi as applied to claim 1 above, and further in view of Rushton (US Patent Application Publication No. US-20200140875-A1).
This is a modified rejection from the previous rejection set forth in the Office Action dated 01/09/2026, necessitated by Applicant’s amendments. This rejection is considered modified because the rejection of amended claim 1 (from which this claim depends) required a modified rejection.
Claim 7 is drawn to the plant cell of claim 1, wherein the CRISPR/Cas system comprises: a Cas protein selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl, or a gene encoding the Cas protein; and a nuclear localization signal (NLS) protein or a gene encoding an NLS protein.
Regarding claim 7, Qi teaches the limitations of claim 1 as set forth in the previous obviousness rejection. The teachings of Qi as they are applied to claim 1 are set forth previously herein and are incorporated by reference. Qi also teaches the tobacco plant or plant genome is mutated or edited by a nuclease selected from the group including CRISPR/Cas9 nuclease (i.e. the CRISPR/Cas system comprises a Cas9 protein) (¶0089).
However, Qi does not explicitly teach wherein the CRISPR/Cas system comprises a nuclear localization signal (NLS) protein or gene encoding a NLS protein (remaining limitation of claim 7).
In analogous art related to genome editing methods for producing low-nicotine tobacco products (title), Rushton teaches the Cas9 protein may be expressed in a plant cell as a fusion to a nuclear localization signal (NLS) to ensure delivery into nuclei (¶0070 and claim 15 of Rushton).
It would therefore have been obvious to a person of ordinary skill in the art to modify the invention taught by Qi to include the limitations of Rushton to arrive at the instantly claimed method with a reasonable expectation of success because the inclusion of a NLS into the CRISPR/Cas9 vector could be achieved by one having ordinary skill in the art without encountering any special technical difficulties. One having ordinary skill in the art would have been motivated to do so because Rushton teaches fusing a NLS to Cas9 would ensure delivery into the plant cell nuclei to induce the site-specific double strand breaks in the genomic DNA (¶0070 and claim 15 of Rushton).
Alignments
Alignment of instant SEQ ID NO: 13 with SEQ ID NO: 7 of Qi:
RESULT 10
BJE61433
ID BJE61433 standard; cDNA; 754 BP.
XX
AC BJE61433;
XX
DT 27-MAY-2021 (first entry)
XX
DE Nicotiana tabacum QPT2a cDNA, SEQ ID:7.
XX
KW QPT2a gene; Quinolinate phosphoribosyltransferase 2a; coding sequence;
KW herbicide resistance; pesticide resistance; pollination; ss.
XX
OS Nicotiana tabacum.
XX
FH Key Location/Qualifiers
FT CDS 1..753
FT /*tag= a
FT /product= "Nicotiana tabacum QPT2a protein"
FT /partial
FT /note= "No stop codon shown"
XX
CC PN WO2021072288-A1.
XX
CC PD 15-APR-2021.
XX
CC PF 09-OCT-2020; 2020WO-US055105.
XX
PR 10-OCT-2019; 2019US-0913357P.
XX
CC PA (ALTR ) ALTRIA CLIENT SERVICES LLC.
XX
CC PI Qi D, Kudithipudi C, Shen Y;
XX
DR WPI; 2021-392517/035.
DR P-PSDB; BJE61437.
XX
CC PT Tobacco plant, portion used as population of tobacco plants in cured
CC PT tobacco material, tobacco product, reconstituted tobacco, comprises
CC PT mutant alleles in one quinolinate phosphoribosyltransferase gene,
CC PT produces leaf with nicotine level.
XX
CC PS Claim 6; SEQ ID NO 7; 71pp; English.
XX
CC The present invention relates to a tobacco plant or part thereof which
CC comprises one or more mutant allele selected from QPT1a, QPT1b, QPT2a and
CC QPT2b, wherein QPT gene comprises polynucleotide sequence of SEQ ID NO:5-
CC 8 (BJE61431-BJE61434) and polypeptide sequence of SEQ ID NO: 9-12
CC (BJE61435-BJE61438). The invention further discloses: (1) a population of
CC tobacco plants; (2) a cured tobacco material, which is derived from
CC tobacco plant; (3) a tobacco blend, a tobacco product, and a
CC reconstituted tobacco which comprises cured tobacco material. The tobacco
CC plant or portion enables to prevent self-pollination of female parents
CC when forming double-cross hybrid; improves nuclease activity, improves
CC cleavage specificity and cleavage activity, increases level of one or
CC more antioxidants, and reduces nicotine levels in tobacco leaves, is
CC herbicide resistance, pest resistance, disease resistance; high yield;
CC high grade index value; curability; curing quality; mechanical
CC harvestability; holding ability; leaf quality; height, plant maturation.
XX
SQ Sequence 754 BP; 240 A; 120 C; 192 G; 202 T; 0 U; 0 Other;
Query Match 100.0%; Score 22; Length 754;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCCACCAAGAATACAAGAGTGG 22
||||||||||||||||||||||
Db 85 GCCACCAAGAATACAAGAGTGG 106
Alignment of instant SEQ ID NO: 13 with SEQ ID NO: 8 of Qi:
RESULT 11
BJE61434
ID BJE61434 standard; cDNA; 754 BP.
XX
AC BJE61434;
XX
DT 27-MAY-2021 (first entry)
XX
DE Nicotiana tabacum QPT2b cDNA, SEQ ID:8.
XX
KW QPT2b gene; Quinolinate phosphoribosyltransferase 2b; coding sequence;
KW herbicide resistance; pesticide resistance; pollination; ss.
XX
OS Nicotiana tabacum.
XX
FH Key Location/Qualifiers
FT CDS 1..753
FT /*tag= a
FT /product= "Nicotiana tabacum QPT1b protein"
FT /partial
FT /note= "No stop codon shown"
XX
CC PN WO2021072288-A1.
XX
CC PD 15-APR-2021.
XX
CC PF 09-OCT-2020; 2020WO-US055105.
XX
PR 10-OCT-2019; 2019US-0913357P.
XX
CC PA (ALTR ) ALTRIA CLIENT SERVICES LLC.
XX
CC PI Qi D, Kudithipudi C, Shen Y;
XX
DR WPI; 2021-392517/035.
DR P-PSDB; BJE61438.
XX
CC PT Tobacco plant, portion used as population of tobacco plants in cured
CC PT tobacco material, tobacco product, reconstituted tobacco, comprises
CC PT mutant alleles in one quinolinate phosphoribosyltransferase gene,
CC PT produces leaf with nicotine level.
XX
CC PS Claim 6; SEQ ID NO 8; 71pp; English.
XX
CC The present invention relates to a tobacco plant or part thereof which
CC comprises one or more mutant allele selected from QPT1a, QPT1b, QPT2a and
CC QPT2b, wherein QPT gene comprises polynucleotide sequence of SEQ ID NO:5-
CC 8 (BJE61431-BJE61434) and polypeptide sequence of SEQ ID NO: 9-12
CC (BJE61435-BJE61438). The invention further discloses: (1) a population of
CC tobacco plants; (2) a cured tobacco material, which is derived from
CC tobacco plant; (3) a tobacco blend, a tobacco product, and a
CC reconstituted tobacco which comprises cured tobacco material. The tobacco
CC plant or portion enables to prevent self-pollination of female parents
CC when forming double-cross hybrid; improves nuclease activity, improves
CC cleavage specificity and cleavage activity, increases level of one or
CC more antioxidants, and reduces nicotine levels in tobacco leaves, is
CC herbicide resistance, pest resistance, disease resistance; high yield;
CC high grade index value; curability; curing quality; mechanical
CC harvestability; holding ability; leaf quality; height, plant maturation.
XX
SQ Sequence 754 BP; 233 A; 122 C; 197 G; 202 T; 0 U; 0 Other;
Query Match 100.0%; Score 22; Length 754;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCCACCAAGAATACAAGAGTGG 22
||||||||||||||||||||||
Db 85 GCCACCAAGAATACAAGAGTGG 106
Response to Arguments
Applicant remarks on p. 6 of remarks dated 04/08/2026 the
following:
Upon entry of the present amendment, claims 1 and 5-16 will be pending in this
application. Claims 10-16 have been withdrawn from consideration by the Examiner. By this Amendment, claims 1 and 5 are amended and new claim 17 is presented. Support for the amendments to the claims may be found throughout the original application, for example, in claim 1. No new matter is added.
In view of the foregoing amendments and following remarks, reconsideration and allowance are respectfully requested.
Examiners response:
The claims are not found allowable for the reasons outlined previously herein and further explained below.
It is noted that Applicant has mentioned above that “new claim 17 is presented”. It appears Applicant intended to submit a new claim with the amended claims. However, no claim 17 is present in the claim sheet dated 04/08/2026, nor in any other document submitted 04/08/2026.
Applicant remarks beginning on p. 6 of remarks dated 04/08/2026 the
following arguments:
Priority Document
Submitted herewith is, upon information and behalf, an accurate English-language translation of the certified copy of the priority document (KR 10-2021-0080363) to perfect priority. As is evident from the translation of KR 10-2021-0080363 attached hereto, the pending claims are fully supported by KR 10-2021-0080363. Accordingly, the pending claims are entitled to the benefit of the June 21, 2021 filing date of KR 10-2021-0080363.
Examiner’s response:
Applicant’s submission of a certified English translation of the foreign application is acknowledged (see Doc Code FR TRANS, dated 04/08/2026). The instant application receives priority to Korean Application No. KR10-2021-0080363 filed on 06/21/2021.
Applicant remarks beginning on p. 7 of remarks dated 04/08/2026 the
following arguments:
Claim Objection
The Office Action objects to claim 5 for an informality. Claim 5 is amended according to the Examiner's helpful suggestion. Accordingly, reconsideration and withdrawal of the objection are respectfully requested.
Examiner’s response:
In view of Applicant’s amendment, the previous objection to claim 5 has been withdrawn.
Applicant remarks beginning on p. 7 of remarks dated 04/08/2026 the
following arguments:
Claim Rejections - 35 U.S.C. 103
1. Claims 1 and 5-9 are Patentable because the Prior Art Sequence is Non- Functional, whereas the Claimed Sequences are Working Embodiments.
The Office rejected claim 1 based on the finding that a specific sequence previously recited in the claim, SEQ ID NO: 11, shares 100% identity with a genomic region disclosed in Qi (see Office Action, page 7 and 10). The Office argued that because the gene sequence was known in Qi, selecting a guide RNA targeting that gene would be obvious.
Applicant respectfully submits that this reasoning relies on impermissible hindsight because it assumes that any sequence selected from the gene would function as a guide RNA. Applicant's own specification demonstrates this assumption is incorrect.
As shown in Table 6 of the Specification, the Applicant tested multiple guide RNAs. Crucially, the specific sequence identified by the Office in the prior art, SEQ ID NO: 11 (sg3), failed to induce mutations in any of the 50 tested samples (0% efficiency). Thus, the embodiment relied upon by the Examiner to reject the claim is a non-working embodiment. A person of ordinary skill in the art, looking at Qi, would not have a reasonable expectation of success in selecting a functional guide RNA because even "obvious" candidates (like SEQ ID NO: 11) fail.
In contrast, Applicant has amended claim 1 to limit the guide RNA polynucleotide to SEQ ID NO: 13 (sg5), which achieved a mutation rate of 36% (18/50).
By deleting the non-working sequence (SEQ ID NO: 11) found in the prior art and limiting the claim to the specific working embodiment (SEQ ID NO: 13), Applicant claims a specific selection invention. The prior art discloses the "haystack" (the whole gene), but it does not disclose or suggest these specific "needles" (functional guide RNAs). The fact that SEQ ID NO: 11 failed confirms that selecting a functional sequence is not a matter of routine optimization but requires inventive selection.
Examiner’s response:
Examiner acknowledges Applicant’s trials and findings that determine some gRNAs do not induce mutations, whereas SEQ ID NO: 13 does induce a mutation and at a higher rate (spec. Table 6, and Applicant’s declaration dated 04/08/2026).
However, because the examined claims are drawn to a plant cell, the patentability of the claims is based on the product itself. Because the product of the plant cell is what is being examined for patentability, the structure of the instantly claimed plant cell and plant are obvious in view of Qi.
The claimed plant cell/ plant is required to be genetically engineered using CRISPR and the polynucleotide of SEQ ID NO: 13 to inactivate QTP2s and QTP2t (via a mutation) to reduce nicotine content in the plant cell and plant. However, the structure of the plant cell does not require the specified CRISPR/Cas system be physically present in the cell. For example, the CRSIPR/Cas system may be transiently expressed and eventually degraded by the cell, leaving behind only a single mutation. Thus, all that is structurally required by the plant cell/ plant is essentially a mutation that inactivates QPT2s and QPT2t, which reduces the nicotine content by at least 97%. This structure is not different from the structure taught by Qi. This is because the gRNA of instant SEQ ID NO: 13 targets exon 2, and therefore the final product of the instant invention is a plant cell with a mutation in exon 2 of QPT2a and QPT2b that results in reduced expression of these genes and reduce nicotine content by at least 97%. Since Qi also teaches a plant cell with mutations in exon 2 of QPT2a and QPT2b that reduces expression of these genes and nicotine content by up to 99.75% (claims 1, 13, 16-18, and 24 of Qi), the claimed plant cell and plant are therefore unpatentable.
Therefore, the instantly claimed structure of the plant cell and plant are obvious in view of Qi regardless of sgRNA choice because Qi teaches using CRISPR/Cas to knockout (via mutations) both QPT2s and QPT2t in exon 2 to reduce nicotine content by 99.75% in plant cells/ plants (see 103 rejection above).
Applicant remarks beginning on p. 8 of remarks dated 04/08/2026 the
following arguments:
Claim Rejections - 35 U.S.C. 103
2. Unexpected Synergistic Results (97% Nicotine Reduction) Linked to SEQ ID NO: 13.
As detailed in the previously submitted Rule 132 Declaration and Table 10 of the Specification, the specific mutant line generated using SEQ ID NO: 13 (Mutant No. 9, derived from sg5) exhibited a dramatic and unexpected 97% reduction in nicotine content compared to the wild type. As argued previously, this result is synergistic and far superior to the reduction achieved by knocking out either QPT2 gene individually.
The Office previously argued that the evidence of unexpected results was not commensurate with the scope of the claims because the claims were broad. In response, Applicant has narrowed the scope to the exact specific sequence (SEQ ID NO: 13) responsible for the unexpected data.
Additionally, with respect to the Office's position that, in view of WO 2021/072288 Al disclosing the full-length sequences of the QPT2a and QPT2b genes (SEQ ID NOs: 3-4), and that the claimed sequence is included within such full-length sequences, there would have been no technical difficulty in selecting the claimed sequence as an sgRNA, it should be noted that the target genes QPT2a and QPT2b each have full-length sequences spanning several thousand base pairs.
Accordingly, while an enormous number of potential sgRNA sequences of about 20-26 bp in length could theoretically be generated therefrom, as shown in Table 6 of the present specification, even sgRNAs that are theoretically designed to target the QPT2 gene do not necessarily induce mutations. For example, certain sgRNAs (e.g., sgl and sg3) do not induce any mutations at all, despite being designed to target the QPT2 gene. Moreover, there is no discernible rule or trend governing mutation induction.
In view of these considerations, deriving the claimed sgRNA sequence, which exhibits a markedly superior mutation-inducing effect, cannot be considered straightforward.
Examiner’s response:
Regarding Applicant’s argument of surprising results, this is not found persuasive. With regard to Applicant’s argument that Applicant has offered evidence of unexpected and unobvious results, pursuant to MPEP 716.02(b), the evidence relied upon should establish "that the differences in results are in fact unexpected and unobvious and of both statistical and practical significance." Ex parte Gelles, 22 USPQ2d 1318, 1319 (Bd. Pat. App. & Inter. 1992) (Mere conclusions in appellants’ brief that the claimed polymer had an unexpectedly increased impact strength "are not entitled to the weight of conclusions accompanying the evidence, either in the specification or in a declaration."); Ex parte C, 27 USPQ2d 1492 (Bd. Pat. App. & Inter. 1992) (Applicant alleged unexpected results with regard to the claimed soybean plant, however there was no basis for judging the practical significance of data with regard to maturity date, flowering date, flower color, or height of the plant.). In the instant case Applicant alleges inactivation of both QPT2s and QPT2t genes using SEQ ID NO: 13 leads to an unexpected result of reduced nicotine content by approximately 97% compared to wild-type plants.
The results do not appear unexpected and unobvious. Applicant provides evidence that inactivation of both QPT2s and QPT2t using SEQ ID NO: 13 results in significantly lower nicotine content than inactivation of either QPT2s or QPT2t alone (see declaration dated 11/24/2025, Table 10). However, this does not appear to be of practical significance because in the prior art, Ryan teaches nicotine is produced in roots of N. tabacum (p. 103, ¶2). In other prior, Qi teaches nicotine biosynthesis involves the formation of nicotinate mononucleotide, which is later converted into nicotine, and the formation of nicotinate mononucleotide is catalyzed by quinolinate phosphoribosyl transferase (QPT) (¶00185). Qi teaches depending on the variety, up to four genes encoding QPT ( QPT1a , QPT1b , QPT2a , and QPT2b) are present in the tobacco (Nicotiana tabacum) genome (¶00185, Fig. 1). Qi also teaches in Fig. 2 the RNA expression of four QPT genes in TN90 roots (¶0018, Fig. 2) and notes that of the four QPT genes, QPT2a and QPT2b represent two major QPT genes (¶00185, Fig. 2). Because both QPT2a and QPT2b are the major QPT genes highly expressed in the TN90 tobacco roots where nicotine biosynthesis occurs and both genes are involved in the conversion of quinolate to the nicotine precursor nicotianate mononucleotide (i.e. the genes provide alternate pathways to carry out the conversion) (¶0026), it does not appear unexpected that knockout of both QPT2a and QPT2b genes would result in significantly reduced nicotine content. Specifically with respect to SEQ ID NO: 13 being the effector that leads to a mutation and 97% reduction in nicotine content, this is not unexpected or unobvious because it is a mutation that leads to inactivation/knockout of the genes and thus reduced nicotine content. Applicant’s data indicates most gRNAs designed and tested were able to induce mutations in QPT2s and QPT2t in at least a subset of the 50 tissue cultures. The specific gRNA is a matter of experimental design choice, and as just described, many of the gRNAs would be expected to induce a mutation in at least some of the plant cells/ plants and as a result greatly reduce nicotine content in the plant cell(s). Therefore, the results do not appear unexpected and unobvious.
Further, even if Applicant can make such a showing, MPEP 716.02(c) provides that the evidence of unexpected results must be weighed against evidence supporting prima facie obviousness in making a final determination of the obviousness of the claimed invention. MPEP 716.02(c) directs the examiner to MPEP 716.01(d), which establishes that although the record may establish evidence of secondary considerations which are indicia of nonobviousness, the record may also establish such a strong case of obviousness that the objective evidence of nonobviousness is not sufficient to outweigh the evidence of obviousness. Newell Cos. v. Kenney Mfg. Co., 864 F.2d 757, 769, 9 USPQ2d 1417, 1427 (Fed. Cir. 1988), cert. denied, 493 U.S. 814 (1989); Richardson-Vicks, Inc., v. The Upjohn Co., 122 F.3d 1476, 1484, 44 USPQ2d 1181, 1187 (Fed. Cir. 1997) (showing of unexpected results and commercial success of claimed ibuprofen and pseudoephedrine combination in single tablet form, while supported by substantial evidence, held not to overcome strong prima facie case of obviousness). The showing, when made, must outweigh the rationale in support of a finding of prima facie obviousness provided in the 103 rejection(s). As described in the 103 rejection, Qi teaches a plant cell and plant of which the structures of the products are obvious in view of Qi alone. In view of the foregoing, Applicant’s evidence is not deemed to outweigh the basis for the rejection.
Finally, MPEP 716.02(d) provides that whether the unexpected results are the result of unexpectedly improved results or a property not taught by the prior art, the "objective evidence of nonobviousness must be commensurate in scope with the claims which the evidence is offered to support." In other words, the showing of unexpected results must be reviewed to see if the results occur over the entire claimed range. In re Clemens, 622 F.2d 1029, 1036, 206 USPQ 289, 296 (CCPA 1980). In this case, the scope of the claims appears commensurate with the evidence.
Applicant remarks beginning on p. 10 of remarks dated 04/08/2026 the
following arguments:
Claim Rejections - 35 U.S.C. 103
3. Rule 132 Declaration
As discussed during the recent Examiner Interview of April 6, 2025, and in response to the Examiner's request for additional evidence, Applicant submits herewith a Declaration under 37 C.F.R. § 1.132 (the "Rule 132 Declaration") by inventor Hyoseok Seo. This Rule 132 Declaration provides experimental evidence confirming that the specific claimed guide RNA sequence (SEQ ID NO: 13) was the determinative factor for successful mutation induction and that appropriate experimental controls were implemented, further demonstrating that the claimed plant cell exhibits an unexpected synergistic effect (a 97% reduction in nicotine content) not suggested or predicted by the prior art.
In summary, Applicant has established:
1. Criticality: The selection of SEQ ID NO: 13 is critical because other sequences in the same gene (e.g., SEQ ID NO: 11) failed to work.
2. Unexpected Results: The selection of SEQ ID NO: 13 results in a synergistic phenotype (97% reduction) that creates a superior low-nicotine plant.
For these reasons, the claimed invention is not obvious over Qi. Withdrawal of the rejection is respectfully requested.
Examiner’s response:
Examiner acknowledges Applicant’s trials and findings that determine some gRNAs do not induce mutations, whereas SEQ ID NO: 13 does induce a mutation and at a higher rate than others tested (spec. Table 6, and Applicant’s declaration dated 04/08/2026). However, the claims are drawn to a plant cell or plant with a mutation in exon 2 of QPT2a and QPT2b, and the structure of this plant cell and plant is obvious in view of Qi (see 103 rejection above and previous response to arguments). The evidence with regard to SEQ ID NO:13’s superior performance is not material to claims that do not require a construct comprising SEQ ID NO:13 as part of the claimed structure.
Conclusion and Inquiries
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA N STOCKDALE whose telephone number is (703)756-5395. The examiner can normally be reached M-F 8:30-5:00 CT.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
JESSICA N. STOCKDALE
Examiner
Art Unit 1663
/JESSICA NICOLE STOCKDALE/Examiner, Art Unit 1663
/CHARLES LOGSDON/Primary Examiner, Art Unit 1662
Prosecution Insights