DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 11/24/2025 has been entered.
Status of the Claims
Claims 2-4 are canceled.
Claims 1 and 5-16 are pending.
Claims 10-16 are drawn to a non-elected invention and therefore withdrawn from consideration.
Claims 1 and 5-9 are examined herein.
The objection to claim 6 in the Office Action dated 07/24/2025 has been withdrawn in view of Applicant’s amendments.
Claims 1 and 5-9 are rejected.
Priority
Application No. 17/928,516 filed on 11/29/2022 is a 371 of PCT Application No. PCT/KR2022/007757 filed on 05/31/2022 and also claims foreign priority to Korean Application No. KR10-2021-0080363 filed on 06/21/2021.
As stated in the previous Office Action dated 02/11/2025, Should applicant desire
to obtain the benefit of foreign priority under 35 U.S.C. 119(a)-(d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e).
Failure to provide a certified translation may result in no benefit being accorded for the non-English application.
Claim Objections
Claim 5 is objected to because of the following informalities: The claim recites “wherein the second polynucleotide is sgRNA” which should read “wherein the second polynucleotide is a sgRNA”. Appropriate correction is required.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 5-6, and 8-9 are rejected under 35 U.S.C. 103 as being unpatentable over Qi (WO-2021072288-A1) and as evidenced by Ryan (Ryan, S. M., Cane, K. A., DeBoer, K. D., Sinclair, S. J., Brimblecombe, R., & Hamill, J. D. (2012). Structure and expression of the quinolinate phosphoribosyltransferase (QPT) gene family in Nicotiana. Plant Science, 188, 102-110).
Claim 1 is drawn to a plant cell genetically engineered to have reduced expression or activity of at least two quinolinic acid phosphoribosyl transferase (QPT) genes or at least two QPT protein proteins encoded by the at least two OPT genes, compared to a parent cell of the plant cell, wherein the plant cell exhibits a nicotine content reduced by 97% or more compared to the parent cell of the plant cell, wherein the at least two OPT genes comprise a QPT gene originated from N. sylvestris (QPT2s) and a QPT gene originated from N. tomentosiformis (QPT2t), wherein the plant cell is genetically engineered by a CRISPR/Cas system to simultaneously inactivate the QPT2s and QPT2t, wherein the CRISPR/Cas system comprises:
(a) one or more first polynucleotides selected from the group consisting of polynucleotides consisting of the nucleotide sequences of SEQ ID NOs: 9 to 19; or
(b) a second polynucleotide into which at least one of the one or more first polynucleotides is transcribed;
and wherein the parent cell is a cell that has not been artificially manipulated to reduce the expression or activity of the at least two QPT genes or at least two QPT proteins, and is a cell freshly isolated from a plant or a cell culture thereof.
Claim 5 is drawn to the plant cell of claim 1, wherein the second polynucleotide is sgRNA comprising CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA).
Claim 6 is drawn to the plant cell of claim 1, wherein the second polynucleotide targets at least one site in the region consisting of Exons 1 to 8 of the at least two QPT genes.
Claim 8 is drawn to the plant cell of claim 1, wherein the plant is Nicotiana tabacum.
Claim 9 is drawn to a plant comprising the plant cell of claim 1.
Regarding claim 1, Qi teaches a tobacco (Nicotiana tabacum) plant or part thereof comprising one or more mutant alleles in QPT genes QPT2a and QPT2b (claims 1 and 24 of Qi, ¶0025). As evidenced by Ryan, many varieties of Nicotiana tabacum have two QPT2 genes, one from each of Nicotiana sylvestris and Nicotiana tomentosiformis progenitors, designated QPT2a and QPT2b (see results, ¶1-2 of Ryan). Therefore, the QPT2a and QPT2b genes taught by Qi are reasonably interpreted to have originated from Nicotiana sylvestris and Nicotiana tomentosiformis. Qi also teaches wherein said one or more mutant alleles result in one or more of a QPT protein truncation, a non-translatable QPT gene transcript, a non-functional QPT protein, a premature stop codon in a QPT gene, and any combination thereof (claim 18 of Qi) (i.e. reduced expression or activity of the QPT genes). Qi teaches the tobacco plant produces a leaf comprising a nicotine level less than 0.25% of the nicotine level of a leaf from a control tobacco plant not having the one or more mutant alleles (i.e. 99.75% less which is encompassed by “reduced by 97% or more”).
Regarding claim 6, Qi teaches the one or more mutant alleles comprise mutations located in regions including the first, second, or third intron (i.e. wherein the second polynucleotide targets at least one site in the region consisting of exons 1 to 8) (claim 16 of Qi).
Regarding claim 8, Qi teaches the plant is Nicotiana tabacum (claims 1 and 24 of Qi, ¶0025).
Regarding claim 9, the claims of Qi are drawn to a tobacco plant or part thereof comprising the mutations to the QPT2a and QPT2b genes (i.e. therefore the claims of Qi encompass the plant comprising the mutated plant cells) (claims 1 and 24 of Qi, ¶0025).
However, Qi does not explicitly teach in a single embodiment:
wherein the plant cell is genetically engineered by a CRISPR/Cas system to simultaneously inactivate the QPT2s and QPT2t, wherein the CRISPR/Cas system comprises: (a) one or more first polynucleotides selected from the group consisting of polynucleotides consisting of the nucleotide sequences of SEQ ID NOs: 9 to 19; or (b) a second polynucleotide into which at least one of the one or more first polynucleotides is transcribed (remaining limitation of claim 1).
wherein the second polynucleotide is sgRNA comprising CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) (claim 5).
Regarding the remaining limitation of claim 1, in an alternative embodiment, Qi teaches the tobacco plant or plant genome is mutated or edited by a nuclease selected from the group that includes CRISPR/Cas9 nuclease (¶0089). Qi also teaches the genomic sequence of QPT2a and QPT2b (SEQ ID NOs: 3-4 of Qi) which comprise sequences within the region of exon 2 of the genes that have 100% sequence identity to instant SEQ ID NO: 11 (see alignment below) (Table 8F-G).
Regarding claim 5, Qi teaches the CRISPR/Cas9 systems are based on RNA-guided engineered nucleases that use complementary base pairing to recognize DNA sequences at target sites. Qi further teaches CRISPR/Cas9 is derived from a bacterial immune system, and the CRISPR arrays, including the spacers, are transcribed during subsequent encounters with invasive DNA and are processed into small interfering CRISPR RNAs (crRNAs) approximately 40 nt in length, which combine with the trans-activating CRISPR RNA (tracrRNA) to activate and guide the Cas9 nuclease (i.e. the CRISPR/Cas9 system comprises a second polynucleotide that is a sgRNA comprising CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA)) (¶00101-00102).
Qi teaches all of the limitations of the rejected claims in alternative embodiments, but does not disclose a single embodiment having all the limitations. As such, the claims are not rejected as anticipated under 35 USC §102 but are instead rejected as obvious under 35 USC §103. It would have been obvious to combine the teachings of Qi to arrive at the instantly claimed methods with a reasonable expectation of success because Qi teaches a method of mutating the second exon of both QPT2a and QPT2b (originated from N. sylvestris and N. tomentosiformis, respectively) to reduce gene/protein expression and thus reduce nicotine content by up to 99.75% (claims 1, 13, 16 and 24 of Qi). In an alternative embodiment, Qi teaches CRISPR/Cas9 system may be used to produce the mutation(s) (¶0089, 00101-00102), and also teaches the second exons of both QPT2a and QPT2b comprise a sequence with 100% sequence identity to instant SEQ ID NO: 1 (Table 8F-G). Therefore, one having ordinary skill in the art would have a reasonable expectation of success because one of ordinary skill could incorporate use of the CRISPR/Cas9 system to generate the mutations and specifically target the second exons using a sgRNA comprising instant SEQ ID NO: 11 without encountering any special technical difficulties. One having ordinary skill in the art would have been motivated to combine the teachings because it would be prima facie obvious to use the CRISPR/Cas system because it was a known, alternative method to produce the same mutation result in the QPT2a and QPT2b genes. One having ordinary skill in the art would also have been motivated to combine the teachings to use a polynucleotide of SEQ ID NO: 11/ transcribed sgRNA comprising SEQ ID NO: 11 because it was a known and readily available sequence in exon 2 of both QPT2a and QPT2b genes.
Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Qi as applied to claim 1 above, and further in view of Rushton (US Patent Application Publication No. US-20200140875-A1).
Claim 7 is drawn to the plant cell of claim 1, wherein the CRISPR/Cas system comprises: a Cas protein selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl, or a gene encoding the Cas protein; and a nuclear localization signal (NLS) protein or a gene encoding an NLS protein.
Regarding claim 7, Qi teaches the limitations of claim 1 as set forth in the previous obviousness rejection. The teachings of Qi as they are applied to claim 1 are set forth previously herein and are incorporated by reference. Qi also teaches the tobacco plant or plant genome is mutated or edited by a nuclease selected from the group including CRISPR/Cas9 nuclease (i.e. the CRISPR/Cas system comprises a Cas9 protein) (¶0089).
However, Qi does not explicitly teach wherein the CRISPR/Cas system comprises a nuclear localization signal (NLS) protein or gene encoding a NLS protein (remaining limitation of claim 7).
In analogous art related to genome editing methods for producing low-nicotine tobacco products (title), Rushton teaches the Cas9 protein may be expressed in a plant cell as a fusion to a nuclear localization signal (NLS) to ensure delivery into nuclei (¶0070 and claim 15 of Rushton).
It would therefore have been obvious to a person of ordinary skill in the art to modify the invention taught by Qi to include the limitations of Rushton to arrive at the instantly claimed method with a reasonable expectation of success because the inclusion of a NLS into the CRISPR/Cas9 vector could be achieved by one having ordinary skill in the art without encountering any special technical difficulties. One having ordinary skill in the art would have been motivated to do so because Rushton teaches fusing a NLS to Cas9 would ensure delivery into the plant cell nuclei to induce the site-specific double strand breaks in the genomic DNA (¶0070 and claim 15 of Rushton).
Alignments
Alignment of instant SEQ ID NO: 11 with SEQ ID NO: 3 of Qi:
RESULT 31
BJE61429
ID BJE61429 standard; DNA; 5494 BP.
XX
AC BJE61429;
XX
DT 27-MAY-2021 (first entry)
XX
DE Nicotiana tabacum QPT2a nucleotide, SEQ ID:3.
XX
KW QPT2a gene; Quinolinate phosphoribosyltransferase 2a; ds;
KW herbicide resistance; pesticide resistance; pollination.
XX
OS Nicotiana tabacum.
XX
CC PN WO2021072288-A1.
XX
CC PD 15-APR-2021.
XX
CC PF 09-OCT-2020; 2020WO-US055105.
XX
PR 10-OCT-2019; 2019US-0913357P.
XX
CC PA (ALTR ) ALTRIA CLIENT SERVICES LLC.
XX
CC PI Qi D, Kudithipudi C, Shen Y;
XX
DR WPI; 2021-392517/035.
XX
CC PT Tobacco plant, portion used as population of tobacco plants in cured
CC PT tobacco material, tobacco product, reconstituted tobacco, comprises
CC PT mutant alleles in one quinolinate phosphoribosyltransferase gene,
CC PT produces leaf with nicotine level.
XX
CC PS Example 1; SEQ ID NO 3; 71pp; English.
XX
CC The present invention relates to a tobacco plant or part thereof which
CC comprises one or more mutant allele selected from QPT1a, QPT1b, QPT2a and
CC QPT2b, wherein QPT gene comprises polynucleotide sequence of SEQ ID NO:5-
CC 8 (BJE61431-BJE61434) and polypeptide sequence of SEQ ID NO: 9-12
CC (BJE61435-BJE61438). The invention further discloses: (1) a population of
CC tobacco plants; (2) a cured tobacco material, which is derived from
CC tobacco plant; (3) a tobacco blend, a tobacco product, and a
CC reconstituted tobacco which comprises cured tobacco material. The tobacco
CC plant or portion enables to prevent self-pollination of female parents
CC when forming double-cross hybrid; improves nuclease activity, improves
CC cleavage specificity and cleavage activity, increases level of one or
CC more antioxidants, and reduces nicotine levels in tobacco leaves, is
CC herbicide resistance, pest resistance, disease resistance; high yield;
CC high grade index value; curability; curing quality; mechanical
CC harvestability; holding ability; leaf quality; height, plant maturation.
XX
SQ Sequence 5494 BP; 1629 A; 888 C; 1103 G; 1874 T; 0 U; 0 Other;
Query Match 100.0%; Score 22; Length 5494;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AATACAAGAGTGGAGTCATTAG 22
||||||||||||||||||||||
Db 699 AATACAAGAGTGGAGTCATTAG 720
Alignment of instant SEQ ID NO: 11 with SEQ ID NO: 4 of Qi:
RESULT 27
BJE61430
ID BJE61430 standard; DNA; 4762 BP.
XX
AC BJE61430;
XX
DT 27-MAY-2021 (first entry)
XX
DE Nicotiana tabacum QPT2b nucleotide, SEQ ID:4.
XX
KW QPT2b gene; Quinolinate phosphoribosyltransferase 2b; ds;
KW herbicide resistance; pesticide resistance; pollination.
XX
OS Nicotiana tabacum.
XX
CC PN WO2021072288-A1.
XX
CC PD 15-APR-2021.
XX
CC PF 09-OCT-2020; 2020WO-US055105.
XX
PR 10-OCT-2019; 2019US-0913357P.
XX
CC PA (ALTR ) ALTRIA CLIENT SERVICES LLC.
XX
CC PI Qi D, Kudithipudi C, Shen Y;
XX
DR WPI; 2021-392517/035.
XX
CC PT Tobacco plant, portion used as population of tobacco plants in cured
CC PT tobacco material, tobacco product, reconstituted tobacco, comprises
CC PT mutant alleles in one quinolinate phosphoribosyltransferase gene,
CC PT produces leaf with nicotine level.
XX
CC PS Example 1; SEQ ID NO 4; 71pp; English.
XX
CC The present invention relates to a tobacco plant or part thereof which
CC comprises one or more mutant allele selected from QPT1a, QPT1b, QPT2a and
CC QPT2b, wherein QPT gene comprises polynucleotide sequence of SEQ ID NO:5-
CC 8 (BJE61431-BJE61434) and polypeptide sequence of SEQ ID NO: 9-12
CC (BJE61435-BJE61438). The invention further discloses: (1) a population of
CC tobacco plants; (2) a cured tobacco material, which is derived from
CC tobacco plant; (3) a tobacco blend, a tobacco product, and a
CC reconstituted tobacco which comprises cured tobacco material. The tobacco
CC plant or portion enables to prevent self-pollination of female parents
CC when forming double-cross hybrid; improves nuclease activity, improves
CC cleavage specificity and cleavage activity, increases level of one or
CC more antioxidants, and reduces nicotine levels in tobacco leaves, is
CC herbicide resistance, pest resistance, disease resistance; high yield;
CC high grade index value; curability; curing quality; mechanical
CC harvestability; holding ability; leaf quality; height, plant maturation.
XX
SQ Sequence 4762 BP; 1453 A; 748 C; 968 G; 1593 T; 0 U; 0 Other;
Query Match 100.0%; Score 22; Length 4762;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AATACAAGAGTGGAGTCATTAG 22
||||||||||||||||||||||
Db 669 AATACAAGAGTGGAGTCATTAG 690
Response to Arguments
Applicant argues beginning on p. 6 of remarks dated 11/24/2025 the
following arguments:
Claims 1-2 and 5-9 are rejected under 35 U.S.C. 103 as being unpatentable over Rushton (US Patent Application Publication No. US-20200140875-A1), Hilscher (Hilscher, J., Burstmayr, H., & Stoger, E. (2017). Targeted modification of plant genomes for precision crop breeding. Biotechnology Journal, 12(1), 1600173), Labun (Labun, K., Krause, M., Torres Cleuren, Y., & Valen, E. (2021). CRISPR genome editing made easy through the CHOPCHOP website. Current Protocols, 1(4), e46), and NCBI Accession No. AJ748263 (Nicotiana tabacum QPT2 gene for putative quinolinate phosphoribosyltransferase, exons 1-10, NCBI Accession No. AJ748263, version AJ748263.1, published online 05/29/2012).
Applicant respectfully traverses the rejection and submits herewith a Declaration under 37 C.F.R. § 1.132 (the "Rule 132 Declaration") to provide experimental evidence demonstrating that the claimed invention exhibits an unexpected synergistic effect not suggested or predicted by the prior art.
As detailed in the Rule 132 Declaration and supported by the experimental results reproduced in Table 10 of the present application, the simultaneous inactivation of the Nicotiana sylvestris-derived QPT2s gene and the Nicotiana tomentosiformis-derived QPT2t gene leads to a dramatic and unexpected reduction in nicotine content to 0.6 mg/g, representing a reduction of approximately 97 % compared to wild-type plants (24.55 mg/g).
In contrast, inactivation of either gene alone-QPT2s (KO) or QPT2t (KO)-produced no meaningful or only a minor reduction (25.98 mg/g and 20.12 mg/g, respectively).
The data therefore establish that the combined inactivation of QPT2s and QPT2t yields an effect far greater than the sum of the individual effects, evidencing a synergistic interaction between the two QPT2 homologs.
This outcome was wholly unpredictable in view of the cited prior art, which only discloses manipulation of individual QPT genes and does not suggest that simultaneous inactivation of two distinct QPT2 homologs from N. sylvestris and N. tomentosiformis would virtually abolish nicotine biosynthesis.
Under MPEP §716.02(c), such experimental evidence of unexpected and superior results is sufficient to rebut a prima facie case of obviousness.
Accordingly, the data presented in the Rule 132 Declaration demonstrate that the claimed invention achieves a new and surprising result that a person of ordinary skill in the art would not have reasonably expected based on the teachings of the cited references.
In view of the Rule 132 Declaration and supporting data of Table 10, Applicant
respectfully submits that the evidence of unexpected synergistic effect overcomes the prima facie case of obviousness.
Applicant therefore respectfully requests withdrawal of the § 103 rejection and reconsideration of the claims for allowance.
This argument has been fully considered and is found not persuasive for
the following reason(s):
In view of Applicant’s amendments, which now require for the first time that expression of both QPT2s and QPT2t in a plant are reduced, therefore limiting the plant to a Nicotiana sylvestris x Nicotiana tomentosiformis cross (i.e. N. tabacum), a new rejection has been made under 35 USC 103 in view of Qi (see rejection above).
Regarding Applicant’s argument of surprising results, this is not found persuasive. With regard to Applicant’s argument that Applicant has offered evidence of unexpected and unobvious results, pursuant to MPEP 716.02(b), the evidence relied upon should establish "that the differences in results are in fact unexpected and unobvious and of both statistical and practical significance." Ex parte Gelles, 22 USPQ2d 1318, 1319 (Bd. Pat. App. & Inter. 1992) (Mere conclusions in appellants’ brief that the claimed polymer had an unexpectedly increased impact strength "are not entitled to the weight of conclusions accompanying the evidence, either in the specification or in a declaration."); Ex parte C, 27 USPQ2d 1492 (Bd. Pat. App. & Inter. 1992) (Applicant alleged unexpected results with regard to the claimed soybean plant, however there was no basis for judging the practical significance of data with regard to maturity date, flowering date, flower color, or height of the plant.). In the instant case Applicant alleges inactivation of both QPT2s and QPT2t genes leads to an unexpected result of reduced nicotine content by approximately 97% compared to wild-type plants. The results do not appear unexpected and unobvious. Applicant provides evidence that inactivation of both QPT2s and QPT2t results in significantly lower nicotine content than inactivation of either QPT2s or QPT2t alone (see declaration, Table 10). However, this does not appear to be of practical significance because In the prior art, Ryan teaches nicotine is produced in roots of N. tabacum (p. 103, ¶2). In other prior, Qi teaches nicotine biosynthesis involves the formation of nicotinate mononucleotide, which is later converted into nicotine, and the formation of nicotinate mononucleotide is catalyzed by quinolinate phosphoribosyl transferase (QPT) (¶00185). Qi teaches depending on the variety, up to four genes encoding QPT ( QPT1a , QPT1b , QPT2a , and QPT2b) are present in the tobacco (Nicotiana tabacum) genome (¶00185, Fig. 1). Qi also teaches in Fig. 2 the RNA expression of four QPT genes in TN90 roots (¶0018, Fig. 2) and notes that of the four QPT genes, QPT2a and QPT2b represent two major QPT genes (¶00185, Fig. 2). Because both QPT2a and QPT2b are the major QPT genes highly expressed in the TN90 tobacco roots where nicotine biosynthesis occurs and both genes are involved in the conversion of quinolate to the nicotine precursor nicotianate mononucleotide (i.e. the genes provide alternate pathways to carry out the conversion) (¶0026), it does not appear unexpected that knockout of both QPT2a and QPT2b genes would result in significantly reduced nicotine content. Therefore, the results do not appear unexpected and unobvious.
Further, even if Applicant can make such a showing, MPEP 716.02(c) provides that the evidence of unexpected results must be weighed against evidence supporting prima facie obviousness in making a final determination of the obviousness of the claimed invention. MPEP 716.02(c) directs the examiner to MPEP 716.01(d), which establishes that although the record may establish evidence of secondary considerations which are indicia of nonobviousness, the record may also establish such a strong case of obviousness that the objective evidence of nonobviousness is not sufficient to outweigh the evidence of obviousness. Newell Cos. v. Kenney Mfg. Co., 864 F.2d 757, 769, 9 USPQ2d 1417, 1427 (Fed. Cir. 1988), cert. denied, 493 U.S. 814 (1989); Richardson-Vicks, Inc., v. The Upjohn Co., 122 F.3d 1476, 1484, 44 USPQ2d 1181, 1187 (Fed. Cir. 1997) (showing of unexpected results and commercial success of claimed ibuprofen and pseudoephedrine combination in single tablet form, while supported by substantial evidence, held not to overcome strong prima facie case of obviousness). The showing, when made, must outweigh the rationale in support of a finding of prima facie obviousness provided in the 103 rejection(s). As described above, both QPT2a and QPT2b are the two major genes involved in the conversion of quinolate to the nicotine precursor nicotianate mononucleotide (i.e. the genes provide alternate pathways to carry out the conversion). Therefore, it would be expected that inactivation of either the QPT2a or QPT2b gene (but not both) would not significantly decrease nicotine content because the genes are both involved in producing the nicotine precursor from quinolate. Alternatively, inactivation of both genes would be expected to significantly reduce nicotine content because their simultaneous inactivation would be expected to inhibit the conversion of quinolate to the nicotine precursor nicotianate mononucleotide, and therefore inhibit nicotine production. Furthermore, although the evidence provided by the Applicant has practical and statistical significance, the evidence is deemed to be outweighed by the teachings of Qi which provides a direct motivation to make plants encompassed by Applicants claims without the need to reference another document (see single reference 103 rejection previously herein). In view of the foregoing, Applicant’s evidence is not deemed to outweigh the basis for the rejection.
Finally, MPEP 716.02(d) provides that whether the unexpected results are the result of unexpectedly improved results or a property not taught by the prior art, the "objective evidence of nonobviousness must be commensurate in scope with the claims which the evidence is offered to support." In other words, the showing of unexpected results must be reviewed to see if the results occur over the entire claimed range. In re Clemens, 622 F.2d 1029, 1036, 206 USPQ 289, 296 (CCPA 1980). In this case, the scope of the claims appears commensurate with the evidence.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA N STOCKDALE whose telephone number is (703)756-5395. The examiner can normally be reached M-F 8:30-5:00 CT.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
JESSICA N. STOCKDALE
Examiner
Art Unit 1663
/JESSICA NICOLE STOCKDALE/Examiner, Art Unit 1663
/CHARLES LOGSDON/Primary Examiner, Art Unit 1662