DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
Applicant’s submission filed 12 August 2026 has been entered. Claims 1, 16, 20-21, 49, 51, and 58 are pending. Claim 1 has been amended, while claims 2, 4-6, 22-24, 27-29, 39, 41, and 45 have been cancelled without prejudice or disclaimer. Therefore, prosecution on the merits continues for claims 1, 16, 20-21, 49, 51, and 58 as being drawn to the elected invention. All arguments have been fully considered with the status of each prior ground of rejection set forth below.
Status of Prior Rejections/Response to Arguments
RE: Objection to the Specification
The substitute Specification filed 12 August 2026 is acknowledged and entered into the application file. However, the substitute Specification fails to limit the hyperlinks or browser-executable code to the top-level domain. For instance, the top-level domain of the browser-executable code on Page 48 – or “bdbiosciences.com/documents/BD_ReagentsCDMarkerHumanPoster.pdf” – is “bdbiosciences.com”.
Therefore, the objection is maintained.
RE: Rejection of claims 1-2, 4, 16, 20-21, 49, 51, and 58 under 35 USC 102(a)(1) over Mukherjee et al
The cancellation of claims 2 and 4 renders the rejection moot for those claims. For the remaining claims, Applicant’s amendments to independent claim 1 requiring the altered splice acceptor site to comprise an A to G nucleotide substitution which is located in a sequence targeted by a guide RNA that comprises the nucleotide sequence of SEQ ID NO: 3 – which are newly presented limitations – obviate the rejection of record.
Therefore, the rejection is withdrawn.
It is of note, however, that Mukherjee et al do disclose a nucleotide sequence of SEQ ID NO: 50 that has 100% sequence identity to instant SEQ ID NO: 3. See the 35 USC 103 rejection over Mukherjee et al below.
RE: Rejection of claims 1-2, 4, 16, 20-21, 49, 51, and 58 on the grounds of nonstatutory double patenting over claims 1, 5-6, and 11 of US Patent No 11,718,659 B2 in view of Mukherjee et al
The cancellation of claims 2 and 4 renders the rejection moot for those claims. For the remaining claims, Applicant’s amendments to independent claim 1 requiring the altered splice acceptor site to comprise an A to G nucleotide substitution which is located in a sequence targeted by a guide RNA that comprises the nucleotide sequence of SEQ ID NO: 3 – which are newly presented limitations – obviate the rejection of record.
Therefore, the rejection is withdrawn.
New/Maintained Grounds of Rejection
Specification
The substitute Specification filed 12 August 2026 is acknowledged and entered into the application file.
However, the disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code in Pages 48, 118, 120, and 124. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Claim Interpretation
It is of note that although the recitation of a “genetically engineered hematopoietic stem or progenitor cell” is in the preamble of independent claim 1, the disclosure of the genetically engineered hematopoietic stem or progenitor cell is necessary to give life, meaning, and vitality to the claim. Therefore, the preamble is afforded patentable weight and thereby limits the scope of the claim. See MPEP § 2111.02.
Under the broadest reasonable interpretation of instant claims 49, 51, and 58, all of the “optional” limitations are not required.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 16, 20-21, 49, 51, and 58 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Humbert et al (US 2022/0380776 A1). Humbert et al has an effective filing date of 22 October 2019.
Humbert et al disclose systems and methods to selectively protect therapeutic cells by reducing CD33 expression in the therapeutic cells using base editors and targeting non-therapeutic cells with an anti-CD33 therapy (Abstract).
As such, Humbert et al disclose CD34+ hematopoietic stem cells genetically engineered to comprise an altered exon 2 of the endogenous CD33 gene via an adenine base editor system and guide RNA, wherein the adenine base editor system causes an A to G nucleotide substitution within the splice acceptor site – which is targeted by the guide RNA sequence of SEQ ID NO: 12 – resulting in a reduced expression of exon 2 epitope when compared to a wild-type cell (Paragraphs [0051], [0074], [0077], [0105]-[0127], [0503], [0506]; Figures 14, 17). It is of note that SEQ ID NO: 12 of Humbert et al has 100% sequence identity to instant SEQ ID NO: 3. See sequence alignment at end of Office action.
Humbert et al further disclose a method of treating a hematopoietic malignancy, wherein an effective amount of a chimeric antigen receptor comprising an antigen-binding fragment specific for CD33 is administered to a human subject suffering from the hematopoietic malignancy in combination with a population of the genetically engineered hematopoietic stem cells (Paragraphs [0008], [0024]-[0025], [0034], [0282], [0299], [0302], [0307], [0329]-[0331], [0434]-[0435]). Humbert et al further disclose that the hematopoietic malignancy is Hodgkin's lymphoma, non-Hodgkin's lymphoma, leukemia, or multiple myeloma (Paragraphs [0008], [0433], [0448], [0465]).
Accordingly, Humbert et al anticipate the claims as follows:
Regarding claims 1, 16, and 21: Humbert et al disclose CD34+ hematopoietic stem cells (claim
16) genetically engineered to comprise an altered exon 2 of the endogenous CD33 gene via an adenine base editor system and guide RNA, wherein the adenine base editor system causes an A to G nucleotide substitution within the splice acceptor site – which is targeted by the guide RNA sequence of SEQ ID NO: 12 – resulting in a reduced expression of exon 2 epitope when compared to a wild-type cell. As SEQ ID NO: 12 of Humbert et al has 100% sequence identity to instant SEQ ID NO: 3, this therefore reads on the genetically engineered hematopoietic stem or progenitor cell of instant claim 1 and population thereof of instant claim 21.
Regarding claim 20: Following the discussion of claim 1, Humbert et al further disclose that the adenine base editor system is an ABE8e system (Paragraphs [0074], [0077]). As this is the same base editor system utilized within the instant disclosure, the genetically engineered hematopoietic stem cells will inherently not comprise a mutation in any predicated off-target sites. See Pages 40, 79, 94-95 of the instant disclosure and MPEP See MPEP § 2112.01(I). This therefore reads on the genetically engineered hematopoietic stem or progenitor cell of the instant claim.
It is also of note that Humbert et al disclose that the base editing systems do not cause off-target effects (Paragraph [0481]).
Regarding claims 49 and 51: Following the discussion of claim 1, Humbert et al further disclose a method of treating a hematopoietic malignancy, wherein an effective amount of a chimeric antigen receptor comprising an antigen-binding fragment specific for CD33 (claim 51) is administered to a human subject suffering from the hematopoietic malignancy in combination with a population of the genetically engineered hematopoietic stem cells (claim 49). This therefore reads on the method of the instant claims.
Regarding claim 58: Following the discussion of claim 49, Humbert et al further disclose that the hematopoietic malignancy is Hodgkin's lymphoma, non-Hodgkin's lymphoma, leukemia, or multiple myeloma. This therefore reads on the method of the instant claim.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 16, 20-21, 49, 51, and 58 are rejected under 35 U.S.C. 103 as being unpatentable over Mukherjee et al (WO 2019/046285 A1, of record on IDS filed 30 November 2022).
Mukherjee et al is considered prior art under 35 USC 102(a)(1), with a publication date of 07 March 2019. It is of note that this publication date is greater than one year prior to the effective filing date of the instant invention.
Regarding claims 1 and 16: Mukherjee et al disclose compositions and methods relating to agents that target a lineage-specific cell-surface antigen and a population of hematopoietic cells that are deficient in the lineage-specific cell-surface antigen for immunotherapy of hematological malignancies (Abstract).
As such, Mukherjee et al disclose CD34+ hematopoietic stem cells genetically engineered to comprise an altered exon 2 of the endogenous CD33 gene via a modified CRISPR/Cas9 base editor system in combination with guide RNA sequences, wherein the CRISPR/Cas9 base editor system causes an A to G nucleotide substitution within the splice acceptor site, resulting in a reduced expression of exon 2 epitope when compared to a wild-type cell (Pages 3-6, 8-9, 48-49, 54-59).
Mukherjee et al further disclose a synthetic polynucleotide sequence of SEQ ID NO: 50 having 100% sequence identity to instant SEQ ID NO: 3 (Sequence Listing Page). See sequence alignment at end of Office action.
Mukherjee et al fail to reduce to practice or otherwise exemplify an engineered CD34+ hematopoietic stem cell comprising an altered exon 2 splice acceptor site of the endogenous CD33 gene, wherein the altered splice acceptor site comprises an A to G nucleotide substitution located in a sequence targeted by a guide RNA sequence comprising SEQ ID NO: 3, as required by instant claim 1.
Therefore, it would have been prima facie obvious to have modified the engineered CD34+ hematopoietic stem cell having an A to G nucleotide substitution in the splice acceptor site of exon 2 of the endogenous CD33 gene of Mukherjee et al such that the target guide RNA sequence comprises SEQ ID NO: 50 of Mukherjee et al. One of ordinary skill in the art before the effective filing date of the invention would have been motivated to generate a guide RNA sequence that targets the altered splice acceptor site, and would have had a reasonable expectation of success given that the disclosure of Mukherjee et al teaches the engineering of CD34+ hematopoietic stem cells with CRISPR/Cas9 base editor systems in combination with guide RNA sequences. See MPEP § 2143(I)(G).
Consequently, Mukherjee et al render obvious CD34+ hematopoietic stem cells (claim 16) genetically engineered to comprise an altered splice acceptor site in exon 2 of the endogenous CD33 gene via a modified CRISPR/Cas9 base editor system in combination with guide RNA sequences, wherein the CRISPR/Cas9 base editor system causes an A to G nucleotide substitution within the splice acceptor site that is targeted by a guide RNA having a sequence of SEQ ID NO: 50, resulting in a reduced expression of exon 2 epitope when compared to a wild-type cell. As the sequence of SEQ ID NO: 50 has 100% sequence identity to instant SEQ ID NO: 3, this therefore renders obvious the engineered hematopoietic stem or progenitor cell of instant claim 1.
Regarding claim 20: Following the discussion of claim 1, Mukherjee et al further disclose that the CRISPR/Cas9 base editor system is a BE2 or BE3 system (Page 49). As these are the same base editor systems utilized within the instant disclosure, the genetically engineered hematopoietic stem cells will inherently not comprise a mutation in any predicated off-target sites. See Pages 94-95 of the instant disclosure and MPEP See MPEP § 2112.01(I). This therefore reads on the genetically engineered hematopoietic stem or progenitor cell of the instant claim.
Regarding claim 21: Following the discussion of claim 1, Mukherjee et al further disclose a population of the genetically engineered hematopoietic stem cells (Abstract; Pages 3-6, 9, 14, 19, 41, 45-46, 54-55, 64-66). This therefore renders obvious the cell population of the instant claim for the same reasons as discussed in the rejection of instant claim 1.
Regarding claims 49 and 51: Following the discussion of claim 1, Mukherjee et al further disclose a method of treating a hematopoietic malignancy, wherein an effective amount of an agent comprising an antigen-binding fragment specific for CD33 is first administered to a human subject suffering from the hematopoietic malignancy (claim 51), followed by the administration of a population of the genetically engineered hematopoietic stem cells (claim 49) (Pages 3, 5-6, 14, 84-87; Example 5). This therefore renders obvious the method of the instant claims for the same reasons as discussed in the rejection of instant claim 1.
Regarding claim 58: Following the discussion of claim 49, Mukherjee et al further disclose that the hematopoietic malignancy is Hodgkin's lymphoma, non-Hodgkin's lymphoma, leukemia, or multiple myeloma (Pages 4, 7, 66-69, 54-55, 59, 62-66, 86). This therefore reads on the method of the instant claim.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the
extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALYSSA G WESTON whose telephone number is (571)272-0337. The examiner can normally be reached Monday-Thursday 8AM - 4PM (CT); Friday 8AM - 11AM (CT).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
ALYSSA G WESTON/Examiner, Art Unit 1633
/CHRISTOPHER M BABIC/Supervisory Patent Examiner, Art Unit 1633
Sequence Alignment
Query Match 100.0%; Score 23; Length 23; Best Local Similarity 100.0%;
Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCCCACAGGGGCCCTGGCTATGG 23 (INSTANT SEQ ID NO: 3)
|||||||||||||||||||||||
Db 1 CCCCACAGGGGCCCTGGCTATGG 23 (HUMBERT ET AL SEQ ID NO: 12)
Query Match 100.0%; Score 23; Length 56; Best Local Similarity 100.0%;
Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCCCACAGGGGCCCTGGCTATGG 23 (INSTANT SEQ ID NO: 3)
|||||||||||||||||||||||
Db 4 CCCCACAGGGGCCCTGGCTATGG 26 (MUKHERJEE ET AL SEQ ID NO: 50)
Prosecution Insights