Prosecution Insights
Last updated: September 17, 2026
Application No. 17/928,803

NUCLEIC ACID ENCODING AN ANTI-VEGF ENTITY AND A NEGATIVE COMPLEMENT REGULATOR AND USES THEREOF FOR THE TREATMENT OF AGE-RELATED MACULAR DEGENERATION

Non-Final OA §102§103§112
Filed
Nov 30, 2022
Priority
Oct 16, 2020 — GB 2016463.8 +2 more
Examiner
XIAO, YAN
Art Unit
1642
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Gyroscope Therapeutics Limited
OA Round
1 (Non-Final)
67%
Grant Probability
Favorable
1-2
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 67% — above average
67%
Career Allowance Rate
516 granted / 768 resolved
+7.2% vs TC avg
Strong +53% interview lift
Without
With
+52.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
45 currently pending
Career history
799
Total Applications
across all art units

Statute-Specific Performance

§101
4.8%
-35.2% vs TC avg
§103
26.4%
-13.6% vs TC avg
§102
18.5%
-21.5% vs TC avg
§112
27.0%
-13.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 768 resolved cases

Office Action

§102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION 2. The election filed 07/02/2026 in response to the Office Action of 05/05/2026 is acknowledged and has been entered. Applicant has elected Group I, claims 1-10, 12-13 and 30, drawn to an adeno-associated viral (AAV) vector comprising a polynucleotide comprising nucleotide sequences encoding (i) an anti-VEGF entity and (ii) a negative complement regulator. Additionally, Applicant has elected species: (a) Anti-VEGF entity: aflibercept. Nucleotide sequence: SEQ ID NO:11; amino acid sequence: SEQ ID NO:1. (b) Negative complement regulator: CFI. (c) Complement-mediated disorder of the eye: wet AMD. Because applicant did not distinctly and specifically point out any supposed errors in the restriction requirement, the election has been treated as an election without traverse. See MPEP 818.03(a). 3. Claims 1-10, 12-13, 15-21 and 30 are pending in the application. Claims 15-21 have been withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected inventions, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 07/31/2019. 4. Claims 1-10, 12-13 and 30 are currently under prosecution. Priority 5. Applicant’s claim under 35 U.S.C. §§ 365(c) for benefit of the earlier filing date of application, is acknowledged. 6. Receipt is acknowledged of papers submitted under 35 U.S.C. 119(a)-(d), which papers have been placed of record in the file. Claim Rejections - 35 USC § 112 7. The following is a quotation of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. 8. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention. 9. Claims 5-9 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a “written description” rejection. The considerations that are made in determining whether a claimed invention is supported by an adequate written description are outlined by the published Guidelines for Examination of Patent Applications Under the 35 U.S.C. 112, para. 1, ``Written Description'' Requirement (Federal Register; Vol. 66, No. 4, January 5, 2001; The 2015 Written Description Workshop materials; hereinafter “Guidelines”). These guidelines state that rejection of a claim for lack of written description, where the claim recites the language of an original claim should be rare. Nevertheless, these guidelines further state, “the issue of a lack of written description may arise even for an original claim when an aspect of the claimed invention has not been described with sufficient particularity such that one skilled in the art would recognize that the applicant has possession of the claimed invention” (Id. at 1105). The “Guidelines” continue: The claimed invention as a whole may not be adequately described if the claims require an essential or critical feature which is not adequately described in the specification and which is not conventional in the art or known to one of ordinary skill in the art. This problem may arise where an invention is described solely in terms of a method of its making coupled with its function and there is no described or art-recognized correlation or relationship between the structure of the invention and its function. A lack of adequate written description issue also arises if the knowledge and level of skill in the art would not permit one skilled in the art to immediately envisage the product claimed from the disclosed process. With further regard to the proposition that, as original claims, the claims themselves provide in haec verba support sufficient to satisfy the written description requirement, the Federal Circuit has explained that in ipsis verbis support for the claims in the specification does not per se establish compliance with the written description requirement: Even if a claim is supported by the specification, the language of the specification, to the extent possible, must describe the claimed invention so that one skilled in the art can recognize what is claimed. The appearance of mere indistinct words in a specification or a claim, even an original claim, does not necessarily satisfy that requirement. The disclosure must allow one skilled in the art to visualize or recognize the identity of the subject matter purportedly described. Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Regents of the University of California v. Eli Lilly & Co., 119 F.3d 1559, 43 USPQ2d 1398 (Fed. Cir. 1997). See also: University of Rochester v. G.D. Searle & Co., 69 USPQ2d 1886 1892 (CA FC 2004). Thus, an original claim may provide written description for itself, but it must still be an adequate written description, which establishes that the inventor was in possession of the invention. In this instance, claims 5-6 are drawn to negative complement regulator variants, claims 7-9 are drawn to a nucleotide sequence has at least 75% sequence identity to SEQ ID NO: 11, 35, 36, 41, or 45-54. Thus, the claims are drawn to a genus of negative complement regulator variants, and a genus of nucleotide sequences has at least 75% sequence identity to SEQ ID NO: 11, 35, 36, 41, or 45-54. Although the specification teaches negative complement regulators (see pages 15-26 of the published application), and SEQ ID NO: 11, 35, 36, 41, or 45-54 (see pages 12, 19, 24, 27-44 of the published application); however, the specification does not teach the claimed complement regulator variants, and a nucleotide sequence has at least 75% sequence identity to SEQ ID NO: 11, 35, 36, 41, or 45-54 would have or retain the activity or function of the complement regulator, and SEQ ID NO: 11, 35, 36, 41, or 45-54. Given the fact that the claims are drawn to a genus of negative complement regulator variants, and a genus of nucleotide sequences has at least 75% sequence identity to SEQ ID NO: 11, 35, 36, 41, or 45-54, which have no particular function or activity, there is no correlation between any one particularly identifying structural feature and any one particularly identifying functional feature. Consequently, it is submitted that the skilled artisan could not immediately envision, recognize or distinguish at least a substantial number of negative complement regulator variants, and a nucleotide sequence has at least 75% sequence identity to SEQ ID NO: 11, 35, 36, 41, or 45-54, to which the claims are directed. Although the specification teaches the negative complement regulator and SEQ ID NO: 11, 35, 36, 41, or 45-54; however, the negative complement regulator and the SEQ ID NOs are not reasonably representative of the plurality of negative complement regulator variants, and a nucleotide sequence has at least 75% sequence identity to SEQ ID NO: 11, 35, 36, 41, or 45-54. This is largely because each negative complement regulator variant, and a nucleotide sequence has at least 75% sequence identity to SEQ ID NO: 11, 35, 36, 41, or 45-54 has substantially varying structure and need not have any particular function or activity. Guidelines states, “[p]ossession may be shown in a variety of ways including description of an actual reduction to practice, or by showing the invention was ‘ready for patenting’ such as by disclosure of drawings or structural chemical formulas that show that the invention was complete, or by describing distinguishing identifying characteristics sufficient to show that the applicant was in possession of the claimed invention” (Id. at 1104). “Guidelines” further states, “[f]or inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus” (Id. at 1106); accordingly, it follows that an adequate written description of a genus cannot be achieved in the absence of a disclosure of at least one species within the genus. Moreover, because the claims encompass a genus of negative complement regulator variants, and a genus of nucleotide sequences has at least 75% sequence identity to SEQ ID NO: 11, 35, 36, 41, or 45-54, which vary both structurally and functionally, an adequate written description of the claimed invention must include sufficient description of at least a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics sufficient to show that Applicant was in possession of the claimed genus. In this instance, factual evidence of an actual reduction to practice has not been disclosed by Applicant in the specification; Applicant has not shown the invention was “ready for patenting” by disclosure of drawings or structural chemical formulas that show that the invention was complete; and Applicant has not described distinguishing identifying characteristics sufficient to show that Applicant was in possession of the claimed invention at the time the application was filed. Thus, it is submitted that the instant claims, and the disclosure describing the claimed subject matter, fails to satisfy the written description requirement set forth under 35 U.S.C. § 112, first paragraph. 10. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. Claim Rejections - 35 USC § 102 11. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention. 12. Claims 1-2, 5, 10, 12-13 and 30 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Her et al. (WO 2013/082563, published on 6 June 2013, IDS). Claims 1-2, 5, 10, 12-13 and 30 are herein drawn to an adeno-associated viral (AAV) vector comprising a polynucleotide comprising nucleotide sequences encoding (i) an anti-VEGF entity and (ii) a negative complement regulator. Her et al. teach a vector comprising a nucleic acid encoding a fusion protein comprising a complement regulatory protein (e.g., CR1, Factor H, C4-BP, DAF, and MCP) and a VEGF inhibiting domain (e.g., anti-VEGF antibody); see entire document, e.g., abstract, [0009-0010], [0058], claims 1-2 and 28-29. Her et al. teach the vector is Adenovirus 2; see [0101]. For claim 10, Adenovirus 2 of Her et al. should be less than 4.7 kb. For claim 12, Her et al. teach a composition comprising the fusion protein which is entrapped in microcapsules (e.g., liposomes, or nanoparticles); see [0146]. For claim 13, Her et al. teach a composition comprising the fusion protein and a pharmaceutically acceptable carrier; see claim 26. For claim 30, it is inherent that Adenovirus 2 of Her et al. should comprise an AAV2 genome and AAV2 capsid protein. Claim Rejections - 35 USC § 103 13. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 14. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. 15. Claims 1 and 3-9 are rejected under 35 U.S.C. 103 as being unpatentable over Her et al. (WO 2013/082563, published on 6 June 2013, IDS) in view of Groendahl et al. (WO 2017072515, published on 4 May 2017). Claims 3-4 and 7 are herein drawn to the AAV vector of claim 1, wherein the anti- VEGF entity is aflibercept. Claims 5-6 and 8 are herein drawn to the AAV vector of claim 1, wherein the negative complement regulator is Complement Factor I (CFI). The teachings of Her et al. have been set forth in the above rejection of claims 1-2, 5, 10, 12-13 and 30 under 35 U.S.C. 102(a)(1). Although Her et al. teach anti-VEGF antibody aflibercept (see [0142]); however, Her et al. do not teach the fusion protein comprising aflibercept. It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of the reference so as to have a fusion protein comprising aflibercept and a complement regulatory protein. One would have been motivated to do so because Her et al. teach a vector comprising a nucleic acid encoding a fusion protein comprising a complement regulatory protein (e.g., CR1, Factor H, C4-BP, DAF, and MCP) and an anti-VEGF antibody, Her et al. also teach anti-VEGF antibody aflibercept can be used in combination with the fusion protein for treatment. Thus, one of ordinary skill in the art would have a reasonable expectation of success that by combining the teachings of the reference so as to substitute the anti-VEGF antibody in the fusion protein of Her et al. for another anti-VEGF antibody: aflibercept, because simple substitution of the anti-VEGF antibody in the fusion protein of Her et al. for another anti-VEGF antibody: aflibercept would obtain predictable results. Although Her et al. teach a complement regulatory protein is CR1, Factor H, C4-BP, DAF, or MCP; Her et al. do not teach a complement regulatory protein is CFI. However, this deficiency is remedied by Groendahl et al. Groendahl et al. teach an AAV vector comprising a nucleotide sequence encoding Complement Factor I (CFI, SEQ ID NO: 8) for use in the treatment or prevention of age-related macular degeneration (AMD); see entire document, e.g., abstract, page 19, claims 1-2. SEQ ID NO: 8 of Groendahl et al. is 100% identical with the instant claimed SEQ ID NO: 36; see sequence alignment below. Groendahl et al. teach wherein the AVV vector is in the form of a viral particle, wherein the AAV viral particle comprises an AAV2 genome and AAV2 capsid proteins; see claims 3-4. It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of the references so as to have a fusion protein comprising an anti-VEGF antibody and complement regulatory protein CFI. One would have been motivated to do so because Her et al. teach a vector comprising a nucleic acid encoding a fusion protein comprising a complement regulatory protein (e.g., CR1, Factor H, C4-BP, DAF, and MCP) and an anti-VEGF antibody; Groendahl et al. teach an AAV vector comprising a nucleotide sequence encoding Complement Factor I (CFI). Thus, one of ordinary skill in the art would have a reasonable expectation of success that by combining the teachings of the references so as to substitute the complement regulatory protein of Her et al. for another complement regulatory protein CFI of Groendahl et al., because simple substitution of the complement regulatory protein of Her et al. for another complement regulatory protein CFI of Groendahl et al. would obtain predictable results. For claim 9, given that combination Her et al. and Groendahl et al. teach AAV vector comprising a polynucleotide encoding aflibercept and CFI; thus, the polynucleotide of Her et al. in view Groendahl et al. would have a nucleotide sequence that has at least 75% sequence identity to the instant claimed SEQ ID NOs: 45-54. Conclusion 16. No claims are allowed. 17. Any inquiry concerning this communication or earlier communications from the examiner should be directed to YAN XIAO whose telephone number is (571)270-3578. The examiner can normally be reached M-F 8-5 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis can be reached on 571-270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /YAN XIAO/Primary Examiner, Art Unit 1642 Sequence alignment BDW41920 (NOTE: this sequence has 4 duplicates in the database searched. See complete list at the end of this report) ID BDW41920 standard; DNA; 1752 BP. XX AC BDW41920; XX DT 29-JUN-2017 (first entry) XX DE Factor I protein encoding DNA, SEQ ID 8. XX KW Factor I; Fibrinogen gene; age related macular degeneration; KW diabetic retinopathy; ds; gene; gene therapy; ocular disease; KW ophthalmological; prophylactic to disease; therapeutic. XX OS Unidentified. XX CC PN WO2017072515-A1. XX CC PD 04-MAY-2017. XX CC PF 27-OCT-2016; 2016WO-GB053343. XX PR 28-OCT-2015; 2015GB-00019086. XX CC PA (SYNC-) SYNCONA MANAGEMENT LLP. XX CC PI Funnell T, Groendahl C, Hollowood C; XX DR WPI; 2017-29660G/36. DR P-PSDB; BDW41921. XX CC PT New adeno-associated viral (AAV) vector comprises nucleotide sequence CC PT encoding factor I or factor H or its fragment or derivative, useful for CC PT treating or preventing complement-mediated disorder of eye, e.g. age- CC PT related macular degeneration. XX CC PS Claim 2; SEQ ID NO 8; 83pp; English. XX CC The present invention relates to a novel adeno-associated viral (AAV) CC vector encoding factor I or factor H or its fragment or derivative useful CC or treating or preventing complement-mediated disorder of eye. The CC invention further relates to: (1) a cell transfected with the AAV vector; CC and (2) a method for treating or preventing a complement-mediated CC disorder of the eye e.g., age-related macular degeneration (AMD) or CC diabetic retinopathy. The present sequence is a factor I protein encoding CC DNA, used in the invention for treating or preventing complement-mediated CC disorder of eye. XX SQ Sequence 1752 BP; 427 A; 436 C; 534 G; 355 T; 0 U; 0 Other; Query Match 100.0%; Score 1752; Length 1752; Best Local Similarity 100.0%; Matches 1752; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGAAGCTGCTGCATGTCTTTCTGCTGTTTCTGTGCTTCCATCTGCGGTTCTGTAAAGTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGAAGCTGCTGCATGTCTTTCTGCTGTTTCTGTGCTTCCATCTGCGGTTCTGTAAAGTG 60 Qy 61 ACCTATACTAGCCAGGAGGATCTGGTGGAGAAGAAGTGTCTGGCCAAGAAGTACACACAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ACCTATACTAGCCAGGAGGATCTGGTGGAGAAGAAGTGTCTGGCCAAGAAGTACACACAC 120 Qy 121 CTGAGCTGCGACAAGGTGTTCTGTCAGCCTTGGCAGCGGTGCATCGAGGGCACCTGCGTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTGAGCTGCGACAAGGTGTTCTGTCAGCCTTGGCAGCGGTGCATCGAGGGCACCTGCGTG 180 Qy 181 TGCAAGCTGCCTTACCAGTGCCCAAAGAACGGCACCGCCGTGTGCGCCACAAATCGGAGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TGCAAGCTGCCTTACCAGTGCCCAAAGAACGGCACCGCCGTGTGCGCCACAAATCGGAGA 240 Qy 241 TCTTTTCCAACATATTGCCAGCAGAAGAGCCTGGAGTGTCTGCACCCCGGCACCAAGTTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TCTTTTCCAACATATTGCCAGCAGAAGAGCCTGGAGTGTCTGCACCCCGGCACCAAGTTC 300 Qy 301 CTGAACAATGGCACCTGCACAGCCGAGGGCAAGTTTTCTGTGAGCCTGAAGCACGGCAAC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CTGAACAATGGCACCTGCACAGCCGAGGGCAAGTTTTCTGTGAGCCTGAAGCACGGCAAC 360 Qy 361 ACAGATAGCGAGGGCATCGTGGAGGTGAAGCTGGTGGACCAGGATAAGACCATGTTCATC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 ACAGATAGCGAGGGCATCGTGGAGGTGAAGCTGGTGGACCAGGATAAGACCATGTTCATC 420 Qy 421 TGTAAGAGCTCCTGGTCCATGAGGGAGGCAAACGTGGCATGCCTGGATCTGGGATTCCAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TGTAAGAGCTCCTGGTCCATGAGGGAGGCAAACGTGGCATGCCTGGATCTGGGATTCCAG 480 Qy 481 CAGGGAGCAGACACACAGAGGCGCTTTAAGCTGTCCGACCTGTCTATCAATAGCACCGAG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CAGGGAGCAGACACACAGAGGCGCTTTAAGCTGTCCGACCTGTCTATCAATAGCACCGAG 540 Qy 541 TGCCTGCACGTGCACTGTAGGGGCCTGGAGACATCCCTGGCAGAGTGCACCTTCACAAAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TGCCTGCACGTGCACTGTAGGGGCCTGGAGACATCCCTGGCAGAGTGCACCTTCACAAAG 600 Qy 601 CGGAGAACCATGGGCTACCAGGACTTTGCCGACGTGGTGTGCTATACCCAGAAGGCCGAT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 CGGAGAACCATGGGCTACCAGGACTTTGCCGACGTGGTGTGCTATACCCAGAAGGCCGAT 660 Qy 661 AGCCCCATGGACGATTTCTTTCAGTGCGTGAACGGCAAGTATATCTCCCAGATGAAGGCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 AGCCCCATGGACGATTTCTTTCAGTGCGTGAACGGCAAGTATATCTCCCAGATGAAGGCC 720 Qy 721 TGCGACGGCATCAATGACTGTGGCGATCAGTCTGACGAGCTGTGCTGTAAGGCCTGTCAG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TGCGACGGCATCAATGACTGTGGCGATCAGTCTGACGAGCTGTGCTGTAAGGCCTGTCAG 780 Qy 781 GGCAAGGGCTTCCACTGCAAGAGCGGCGTGTGCATCCCTTCCCAGTACCAGTGCAACGGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GGCAAGGGCTTCCACTGCAAGAGCGGCGTGTGCATCCCTTCCCAGTACCAGTGCAACGGC 840 Qy 841 GAGGTGGATTGTATCACAGGAGAGGACGAAGTGGGATGCGCAGGATTTGCATCTGTGGCA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GAGGTGGATTGTATCACAGGAGAGGACGAAGTGGGATGCGCAGGATTTGCATCTGTGGCA 900 Qy 901 CAGGAGGAGACAGAGATCCTGACAGCCGACATGGATGCCGAGAGGCGCCGGATCAAGTCT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CAGGAGGAGACAGAGATCCTGACAGCCGACATGGATGCCGAGAGGCGCCGGATCAAGTCT 960 Qy 961 CTGCTGCCTAAGCTGAGCTGTGGCGTGAAGAATCGGATGCACATCAGAAGGAAGCGCATC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CTGCTGCCTAAGCTGAGCTGTGGCGTGAAGAATCGGATGCACATCAGAAGGAAGCGCATC 1020 Qy 1021 GTGGGAGGCAAGAGGGCACAGCTGGGCGATCTGCCATGGCAGGTGGCCATCAAGGACGCC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GTGGGAGGCAAGAGGGCACAGCTGGGCGATCTGCCATGGCAGGTGGCCATCAAGGACGCC 1080 Qy 1081 TCTGGCATCACCTGCGGCGGCATCTACATCGGAGGATGTTGGATCCTGACCGCAGCACAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TCTGGCATCACCTGCGGCGGCATCTACATCGGAGGATGTTGGATCCTGACCGCAGCACAC 1140 Qy 1141 TGCCTGAGAGCAAGCAAGACACACAGGTATCAGATCTGGACCACAGTGGTGGATTGGATC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TGCCTGAGAGCAAGCAAGACACACAGGTATCAGATCTGGACCACAGTGGTGGATTGGATC 1200 Qy 1201 CACCCAGACCTGAAGAGAATCGTGATCGAGTACGTGGATAGGATCATCTTTCACGAGAAC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 CACCCAGACCTGAAGAGAATCGTGATCGAGTACGTGGATAGGATCATCTTTCACGAGAAC 1260 Qy 1261 TACAATGCCGGCACATATCAGAACGACATCGCCCTGATCGAGATGAAGAAGGATGGCAAT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 TACAATGCCGGCACATATCAGAACGACATCGCCCTGATCGAGATGAAGAAGGATGGCAAT 1320 Qy 1321 AAGAAGGACTGTGAGCTGCCCAGATCCATCCCTGCATGCGTGCCATGGAGCCCCTATCTG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 AAGAAGGACTGTGAGCTGCCCAGATCCATCCCTGCATGCGTGCCATGGAGCCCCTATCTG 1380 Qy 1381 TTCCAGCCCAACGATACCTGCATCGTGTCCGGATGGGGAAGGGAGAAGGACAATGAGCGG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 TTCCAGCCCAACGATACCTGCATCGTGTCCGGATGGGGAAGGGAGAAGGACAATGAGCGG 1440 Qy 1441 GTGTTTTCTCTGCAGTGGGGCGAGGTGAAGCTGATCTCCAACTGTTCTAAGTTCTACGGC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GTGTTTTCTCTGCAGTGGGGCGAGGTGAAGCTGATCTCCAACTGTTCTAAGTTCTACGGC 1500 Qy 1501 AATAGGTTTTATGAGAAGGAGATGGAGTGCGCCGGCACCTACGATGGCAGCATCGACGCC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 AATAGGTTTTATGAGAAGGAGATGGAGTGCGCCGGCACCTACGATGGCAGCATCGACGCC 1560 Qy 1561 TGTAAGGGCGATTCCGGAGGACCACTGGTGTGCATGGACGCAAACAATGTGACATACGTG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TGTAAGGGCGATTCCGGAGGACCACTGGTGTGCATGGACGCAAACAATGTGACATACGTG 1620 Qy 1621 TGGGGAGTGGTGTCCTGGGGAGAGAACTGCGGCAAGCCAGAGTTCCCCGGCGTATATACC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 TGGGGAGTGGTGTCCTGGGGAGAGAACTGCGGCAAGCCAGAGTTCCCCGGCGTATATACC 1680 Qy 1681 AAGGTGGCCAATTATTTTGATTGGATTTCCTACCACGTCGGCAGGCCCTTTATTTCCCAG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 AAGGTGGCCAATTATTTTGATTGGATTTCCTACCACGTCGGCAGGCCCTTTATTTCCCAG 1740 Qy 1741 TATAATGTCTAA 1752 |||||||||||| Db 1741 TATAATGTCTAA 1752
Read full office action

Prosecution Timeline

Nov 30, 2022
Application Filed
Aug 27, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12729239
ANTI-CEACAM5 ANTIBODIES AND CONJUGATES AND USES THEREOF
3y 6m to grant Granted Sep 08, 2026
Patent 12723092
Anti-CXCR2 Antibodies and Uses Thereof
2y 12m to grant Granted Sep 01, 2026
Patent 12698326
ANTI-CD19 ANTIBODY FORMULATIONS
4y 4m to grant Granted Aug 04, 2026
Patent 12673995
MATERIALS AND METHODS FOR MODULATING T CELL MEDIATED IMMUNITY
3y 2m to grant Granted Jul 07, 2026
Patent 12668623
ANTI-PERIOSTIN HUMANIZED MONOCLONAL ANTIBODY, AND PREPARATION METHOD THEREFOR AND USE THEREOF
2y 3m to grant Granted Jun 30, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
67%
Grant Probability
99%
With Interview (+52.6%)
2y 11m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 768 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month