DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Warning
Applicant is advised that should claims 1, 4-7, 9-10 be found allowable, claims 11, 14-17, 19-20 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).
Both independent claims 1 and 11 are drawn to identical snRNP complexes comprising a core comprising siRNAs or shRNAs, same group of Sm proteins, Sm binding sequence, identically arranged, and at least one cell receptor ligand and endosomal escape peptide. Therefore, scopes of claims 1 and 11 are identical. Dependent claims 4-7, 9-10 and 14-17, 19-20 add identical limitations, respectively, to independent claims 1 and 11. Therefore, scopes of respective dependent claims are identical as well.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1, 4-7, 9-11, 14-17, 19-20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Wilson et al (WO 2020/010083, January 2020, cited from IDS) and in further view of Leung et al (J Mol Biol, 2010, 402: 154-164, of record), GenBank 6V4X_A (GenBank, 2019, pages 1-2, of record), Pirie et al (WO 2012/094653, July 2012, of record) and Xie et al (WO 2009/108217, September 2009, of record).
Wilson teach a system of delivery of cargo RNA comprising modified RNA-binding protein (RBP) such as U1A snRNP, which comprises small nuclear RNA (see paragraph [0085]), endosomolytic peptides which promote endosomal escape such as histidine-rich peptide H2E and variants thereof (see paragraphs [00112, 00116]), covalently bound to RBP (see Figure 3, paragraph [0010]), and modified cargo RNA complexed to RBP, such RNA modified to include binding site for RBP (see paragraph [0007]). Such cargo RNA can be siRNA or shRNA (see paragraph [00157]). Wilson teach that the system can further comprise targeting moiety such as a receptor or a ligand for a receptor targeting cargo RNA to specific cell type (see paragraph [00281]), such receptor can be EGF (see paragraph [00283]).
Wilson do not teach Sm proteins of SEQ ID NO: 1, or Sm binding sequence of SEQ ID NO: 23 attached to 3' or 5' end of therapeutic RNA, or endosomal escape peptide GALA3, or siRNA of SEQ ID NOs: 37 and 38.
Leung teach structure of U4 snRNP particle (see Abstract), which comprises seven Sm proteins, including SmD3 (see first column on page 155) and RNA binding sequence of AAUUUUUGA (see Figure 1), which is identical to instant SEQ ID NO: 23. The longer version of such sequence can be CAAUUUUUGA (see Figure 2).
GenBank 6V4X_A teach amino acid sequence of SmD3 protein (see page 2), comprising instant SEQ ID NO: 1.
Pirie teach endosomal escape peptide GALA (see last six lines on page 18) of SEQ ID NO: 19 (see first paragraph on page 19), which comprises instant GALA3 peptide of SEQ ID NO: 44 as taught in instant specification paragraph [0101].
Xie teach a number of siRNAs targeting KRAS (see Abstract, page 1), including siRNA comprising one strand of SEQ ID NO: 441 (see Table 12 on page 78), 25 nucleotides long with first 24 identical to instant SEQ ID NO: 37:
SEQ ID NO: 37 1 CCTTGACGATACAGCTAATTCAGA 24
||||||||||||||||||||||||
SEQ ID NO: 441 1 CCUUGACGAUACAGCUAAUUCAGAA 25
Xie teach that TT overhang can be added to the 3' end of any strand of siRNA (see the end of page 20). Further such siRNA comprises complementary strand of SEQ ID NO: 442 (see Table 12 on page 78): 3'- (GGAACUGCUAUGUCGAUUAAGUCUU)r-5'. Adding to 5' end of the sequence (with exclusion of first nucleotide) Sm binding sequence as taught in Leung above leads to formation of the sequence identical to instant SEQ ID NO: 38 with addition of TT overhang: CAAUUUUUGAUCUGAAUUAGCUGUAUCGUCAAGGTT (binding sequence shown in bold, overhang in italic).
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to create siRNA delivery agent based on teachings of Wilson, Leung, GenBank 6V4X_A, Pirie and Xie, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so because Wilson provides a framework to form such delivery agent comprising RBP which can be U1 snRNP, cell receptor ligands, endosomolytic peptides and siRNA as therapeutic (cargo) RNA, modified to include binding site for RBP. Leung teach such binding site sequence and RBP such as Sm as part of U4 snRNP, similar to U1 snRNP taught by Wilson, with GenBank 6V4X_A providing sequence for the Sm protein. Pirie teach endosomal escape peptide comprising peptide used in the instant invention. Xie teach siRNA targeting KRAS, which with addition of binding site taught by Leung becomes identical to instantly claimed. Such binding site can be added to 3' or 5' end of siRNA because siRNA has only two ends, 3' or 5'. Cell receptor ligand can be added to C-terminus or N-terminus of Sm peptide, because Sm peptide has only two ends, C- and N-terminus. All the elements of instantly claimed delivery agents are taught in prior art, making it obvious to combine them based on teachings of Wilson, arriving at instant invention.
Response to Arguments
Applicant's arguments filed 12/15/2025 have been fully considered but they are not persuasive.
Previous 112(a) rejection is withdrawn in view of new amendments, arguments are moot.
Concerning 103 rejection Applicant argues that Wilson reference does not teach U1 snRNP. In response the reference teaches U1A snRNP protein, which can bind snRNA and other proteins forming U1 snRNP (see paragraphs [0085-0086]). Further Applicant argues that the reference does not teach delivery of siRNA or shRNA. In response the reference teaches in paragraph [0157] that the cargo molecule can be siRNA. Further Applicant argues that there is no motivation to combine teachings of Leung reference with Wilson reference. In response Leung reference teaches specific RNA-binding protein, similar to the one taught by Wilson reference, and RNA-binding sequence, which can be used for binding of therapeutic RNA. The rejection is maintained.
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637