Prosecution Insights
Last updated: October 02, 2026
Application No. 17/932,026

METHOD OF INCREASING THE REPLICATION OF A CIRCULAR DNA MOLECULE

Final Rejection §103
Filed
Sep 14, 2022
Priority
Aug 10, 2015 — EU PCT/EP2015/068398 +2 more
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Curevac Manufacturing GmbH
OA Round
6 (Final)
38%
Grant Probability
At Risk
7-8
OA Rounds
0m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allowance Rate
285 granted / 750 resolved
-22.0% vs TC avg
Strong +53% interview lift
Without
With
+52.6%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
50 currently pending
Career history
813
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
38.7%
-1.3% vs TC avg
§102
13.3%
-26.7% vs TC avg
§112
31.4%
-8.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 750 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . The Amendment filed on 02/25/2026 has been entered. Claims 5-6, 10, 12-20, 22, 25-26, 28-29, 32 and 35-50 are pending in the present application. Applicant elected previously without traverse the invention of Group IV, which is drawn to a method for producing an RNA molecule, and the following species: (i) performing fermentation; (ii) said purifying comprises digesting the DNA; and (iii) the insert encodes a mRNA. Claims 29, 36-38 and 47 were withdrawn previously from further consideration because they are directed to non-elected species. Accordingly, claims 5-6, 10, 12-20, 22, 25-26, 28, 32, 35, 39-46 and 48-50 are examined on the merits herein with the above elected species. Response to Amendment The rejection under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, for New Matter was withdrawn upon further considerations, and in light of Applicant’s cited written support in the Amendment filed on 02/25/2026 (page 7). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 5-6, 10, 12-13, 16-20, 22, 25-26, 32, 35, 39, 41 and 43-46 are rejected under 35 U.S.C. 103 as being unpatentable over Bancel et al (WO 2014/152027; IDS) in view of Von Der Mulbe et al (US 2005/0032730; IDS), Marra et al (Science 300:1399-1404, 2003), Carnes et al (US 7,943,377; IDS) and Romero Ramos et al (US 2018/0135060; IDS) for the same reasons as set forth in the Non-Final Office Action dated 09/25/2025 (pages 6-14). The same rejection is restated below. The instant claims encompass a method for producing a RNA molecule comprising: (A) obtaining a DNA molecule by bacterial fermentation in E. Coli, the DNA molecule comprising: (a) a bacterial origin of replication, (b) a kanamycin resistance gene, and (c) an insert comprising: (i) a RNA polymerase promoter sequence, (ii) an open reading frame (ORF) encoding a viral surface antigen, and (iii) a homopolymeric poly(A) comprising 20 to about 400 adenosine nucleotides; wherein said homopolymeric poly(A) sequence is: (1) located at a distance of at least 2200 bp from the bacterial origin of replication, and (2) oriented so that the direction of transcription of the insert is the same as the direction of replication of the origin of replication, wherein the ORF is positioned between the RNA polymerase promoter sequence and the homopolymeric poly(A) sequence; wherein the bacterial fermentation comprises fed-batch fermentation; wherein the DNA molecule is a DNA plasmid; wherein when the DNA molecule is fermented in the E. coli bacteria the yield of the DNA molecule is increased compared to the yield of an otherwise identical DNA molecule in which the homopolymeric poly(A) sequence is: (1) located at a distance of less than 500 bp from the origin of replication in the direction of replication; and (2) oriented so that the direction of transcription of the homopolymeric poly(A) sequence is opposite to the direction of replication of the origin of replication; (B) synthesizing a RNA molecule from the DNA molecule by in vitro transcription; (C) purifying the RNA; and (D) formulating the RNA in a pharmaceutically acceptable carrier. It is noted that the limitation “a linker” in new claims 39 and 41 is not necessarily limited to a heterologous linker; and as such a linker can be comprised of two or more adenosine nucleotides. Bancel et al already disclosed a method for production of RNA transcripts using a non-amplified, linearized plasmid DNA template in an in vitro transcription reaction, wherein the plasmid DNA template comprises a gene of interest coding for a polypeptide of interest (e.g., GCSF, Factor IX, or one or more vaccines that improve immunity to an infectious agent), an RNA polymerase promoter located 5’ to and operably linked to the gene of interest (e.g., a T7 RNA polymerase, SP6 RNA polymerase), a sequence coding for a polyA tail located 3’ to the gene of interest, and immediately downstream of the polyA tail coding sequence on the plasmid DNA template is a recognition site for a restriction endonuclease to linearize the plasmid (Abstract; Summary of the Invention; particularly paragraphs [0042]-[0045], [0052] and [0098]). Bancel et al taught that an in vitro transcription reaction comprises a transcription buffer; unmodified nucleotide triphosphates (e.g., A, C, G and U ribonucleotides), modified nucleotides (e.g., 5-methylcytidine triphosphate, pseudouridine triphosphate, 1-methylpseudouridine triphosphate) or a combination thereof; an RNase inhibitor and an RNA polymerase (paragraphs [0051], [0056]-[0061]). Additionally, the RNA transcript is enzymatically capped or co-transcriptionally capped with a cap analog to produce a 5’ cap structure that includes Cap 0, Cap 1 and Cap 2 structures (paragraphs [0040]-[0041], [0062]-0066]; and Figure 3). Bancel et al also disclosed that the RNA transcript also includes a 5’UTR and a 3’ UTR, the region encoding the polypeptide of interest is at least greater than about 35, 50, 100, 500, 1,000, 2000, 2500, 3000, 4000, 5000 nucleotides or more in length, and the polyA tail is at least about 80 nucleotides or 160 nucleotides in length (paragraphs [0067], [0072], [0075]; and Figure 4). In an exemplification, Bancel et al taught a method for isolating and purifying the exemplary plasmid pJ344:91543-TC-GCSF that includes the coding sequence for GCSF (granulocyte colony stimulating factor) and 141 nucleotide sequence coding for Poly A tail, using an E. coli strain DH10B harboring the plasmid, with the plasmid map is shown in Figure 5 below (Abstract; particularly paragraphs [00409]-[00410]; Example 1 and Figure 5). PNG media_image1.png 649 662 media_image1.png Greyscale The exemplary plasmid pJ344:91543-TC-GCSF also contains a T7-promoter used to express the coding sequence for GCSF (granulocyte colony stimulating factor) and 141 nucleotide sequence coding for Poly A tail (Insert 91543), a high copy pUC origin of replication, an Ampicillin resistance gene, and the transcription direction of the T7 promoter is the same as the direction of replication of the pUC origin of replication as shown in Figure 5 above. Based on the location of the Insert 91543, the polyA tail is also located at a distance of more than 400 bp but less than 2200 bp from the pUC origin of replication in the direction of replication. Bancel et al also disclosed the isolation and purification of another exemplary plasmid pJ204109475 that includes the coding sequence for Factor IX and 141 nucleotide sequence coding for PolyA tail, using an E. coli strain DH10B harboring the plasmid, with the plasmid pJ204109475 map is shown in Figure 11A below (Abstract; Summary of the Invention; particularly paragraphs [0040]-[0050], [00409]-[00410], [0419]; Example 6; Figure 6 and 11A-B). PNG media_image2.png 516 665 media_image2.png Greyscale The exemplary plasmid pJ204:104975 contains a T7-promoter used to express the coding sequence for Factor IX and 141 nucleotide sequence coding for Poly A tail (Insert 109475), a high copy bacterial origin of replication, an Ampicillin resistance gene, and the transcription direction of the T7 promoter is the same as the direction of replication of the pUC origin of replication as shown in Figure 11A reproduced above. Bancel et al also stated at least “PCR generated DNA templates have disadvantages that can be mitigated using linearized whole plasmid DNA templates. A PCR-free process has the following advantages: Scalability: Plasmid DNA template can be produced at microgram, milligram and grand gram scale in a cGMP compliant fashion. Large scale production of PCR generated templates is not commercially viable” (paragraphs [0023]-[0024]). Bancel et al did not disclose explicitly at least a method for producing an RNA molecule encoding a viral surface antigen that is at least 2,200 bp and transcribed from a recombinant DNA plasmid that has a similar plasmid backbone as the exemplary recombinant pJ344:91543-TC-GCSF plasmid with a kanamycin resistance gene instead of an ampicillin resistance gene as a selection marker, wherein the DNA plasmid is obtained by bacterial fermentation in E. Coli, including by fed-batch fermentation to obtain large amounts of the recombinant plasmid for the production of the RNA molecule, or the step of further formulating the RNA in a pharmaceutically acceptable carrier. Before the effective filing date of the present application (8/10/2015), Von Der Mulbe et al already taught preparation of a pharmaceutical composition comprising a modified RNA that is stabilized by sequence modifications and optimized for translation, and a pharmaceutically acceptable carrier for inoculation or vaccination; wherein the modified RNA coding for a viral surface antigen against which an immune response is elicited in a subject to treat infectious diseases (e.g., HIV, hepatitis A, B or C, herpes, herpes zoster, measles, flu and others) (see at least Abstract; particularly paragraphs [0053]-[0054], [0057], [0071]; and Example 3). Von Der Mulbe et al also taught that the modified RNA is produced from in vitro transcription of a corresponding DNA molecule (paragraph [0040]). Additionally, Marra et al already determined the genome sequence of the severe acute respiratory syndrome (SARS)-associated coronavirus, and disclosed that the nucleotide sequence of residues 21,492-25,259) encodes the surface Spike (s) glycoprotein precursor with 1255 amino acids in length (see at least Abstract; page 1402, 1st column continues to first paragraph of 2nd column; and Fig. 2). Marra et al concluded “[t]his information will assist in the development of antiviral treatments, including neutralizing antibodies and development of a vaccine to treat this emerging and deadly disease” (page 1403, last sentence of first paragraph in 3rd column). Moreover, Carnes et al already taught improvements in plasmid DNA production technology to ensure economic feasibility of future DNA vaccines and DNA therapeutics, including fed-batch fermentation strategies combining novel growth and induction phase temperature shifts (see at least Abstract; Disclosure of the Invention; Brief Summary of the Invention; issued claims 1-7). Specifically, Carnes et al disclosed a method of fed-batch fermentation in which plasmid-containing E. Coli cells are grown at a reduced temperature (e.g., around 300C) during the fed-batch phase, during which growth rate is restricted (e.g., preferred growth rate ranges are u=0.05 to 0.3 per hour, preferably u=0.12 per hour via control nutrient feed), followed by a temperature up-shift (e.g., to approximately 36-450C) and continued growth at elevated temperature in order to accumulate plasmid, whereby the temperature shift and restricted growth rate improves yield and purity of plasmids, and wherein the plasmid contains a ColE1-derived replication origin, a pMB1 replication origin containing the pUC G to A mutation, or a pUC origin containing plasmid (col. 5, first full paragraph; col. 9, lines 53-63). Furthermore, Romero Ramos et al also taught preparation of the Escherichia Coli T7 expression pMRKA plasmid vector that allows an enhanced production, in industrial scale, of recombinant proteins, by modifying plasmids containing the gene sequence of the T7 promoter of E. coli (e.g., pAE vector) and which modification comprises the substitution of the ampicillin-resistance gene by the kanamycin-resistance gene (Abstract; Summary of the Invention; particularly paragraphs [0051]-[0052], [0134]-[0138]; and Figure 1). Romero Ramos et al stated “The need to modify the pAE plasmid was due to the following reasons: (a) as the ampicillin resistant gene encodes a beta-lactamase which is located in periplasmic space of E. coli in high density culture, this enzyme has the possibility to migrate of the culture means and, consequently, to degrade the antibiotic, decreasing the selective pressure of the means and providing the buildup of cells without plasmid; and (b) in the production of expression vectors in industrial scale it is not recommended to use antibiotic similar to the ones used in medical and veterinary fields, as it is the case of ampicillin. As kanamycin does not have medical application, the ampicillin resistant gene in pAE vector was replaced with kanamycin resistance gene” (paragraph [0052]). Romero Ramos et al also disclosed that T7 promoter of T7 bacteriophage is a strong promoter, and the expression systems based on T7 are broadly used for super-expression of in large scale of recombinant proteins in prokaryotes and eukaryotes (paragraph [0003]). Accordingly, it would have been obvious for an ordinary skilled artisan before the effective filing date of the present application to modify the teachings of Bancel et al by also at least using the fed-batch fermentation method of Carnes et al for fermentative production of a recombinant pJ344:91543-TC-GCSF plasmid modified by the substitution of the ampicillin-resistance gene with the kanamycin-resistance gene as a selection marker, and the substitution of the coding sequence of GCSF with the coding sequence of a viral surface antigen such as the surface Spike glycoprotein of SARS-associated coronavirus; to obtain large amounts of plasmids for the production of RNA transcripts coding for said surface Spike glycoprotein, in light of the teachings of Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al as presented above. An ordinary skilled artisan would have been motivated to carry out the above modifications because: (1) Von Der Mulbe et al already taught preparation of a pharmaceutical composition comprising a modified RNA coding for a viral surface antigen against which an immune response is elicited in a subject for treating infectious diseases, and a pharmaceutically acceptable carrier, wherein the modified RNA is produced from in vitro transcription of a corresponding DNA molecule; (2) Marra et al already determined the genome sequence of the severe acute respiratory syndrome (SARS)-associated coronavirus, and disclosed that the nucleotide sequence of residues 21,492-25,259) encodes the surface Spike (S) glycoprotein precursor with 1255 amino acids in length, and that the disclosed information is useful for development of a vaccine to treat this emerging and deadly disease; (3) Carnes et al already disclosed successfully a method of fed-batch fermentation that improves yield and purity of plasmids; and (4) Romero Ramos et al taught advantages offered by substitution of the ampicillin-resistance gene by the kanamycin-resistance gene for an Escherichia Coli T7 expression plasmid vector. Moreover, please note that the primary Bancel reference teaches explicitly that the plasmid DNA template comprises a gene of interest coding for any polypeptide of interest such as GCSF, Factor IX or one or more vaccines that improve immunity to an infectious agent; and the region encoding the polypeptide of interest is at least greater than about 35, 50, 100, 500, 1,000, 2000, 2500, 3000, 4000, 5000 nucleotides or more in length. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al as set forth above; coupled with a high level of skill of an ordinary skilled artisan in the relevant art. The modified method resulting from the combined teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al is indistinguishable from the presently claimed method regarding to the materials and method steps used. Please note that the resulting modified recombinant pJ344:91543-TC-GCSF plasmid having the substitution of the ampicillin-resistance gene with the kanamycin-resistance gene as a selection marker, and the substitution of the coding sequence of GCSF with the coding sequence of the surface Spike glycoprotein of SARS-associated coronavirus (1,255 amino acids) would have a homopolymeric poly(A) sequence located at a distance of 3768 bp (1,255 x 3 bp = 3765 bp plus 3 bp for the starting codon) from the bacterial origin of replication. Accordingly, the modified method would also possess the same properties recited in the “wherein clause” regarding to the yield of the DNA molecule recited in currently amended independent claim 5. Moreover, it is noted that the “wherein clause” regarding to the yield of the DNA molecule does not add any further structural details for the DNA molecule and/or any further conditions used in E. Coli bacterial fermentation. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claims 14-15 and 28 are rejected under 35 U.S.C. 103 as being unpatentable over Bancel et al (WO 2014/152027; IDS) in view of Von Der Mulbe et al (US 2005/0032730; IDS), Marra et al (Science 300:1399-1404, 2003), Carnes et al (US 7,943,377; IDS) and Romero Ramos et al (US 2018/0135060; IDS) as applied to claims 5-6, 10, 12-13, 16-20, 22, 25-26, 32, 35, 39, 41 and 43-46 above, and further in view of Williams (US 2010/0184158; IDS) and Melton et al (Nucleic Acids Research 12:7035-7056, 1984). The combined teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al were presented above. However, none of the cited references teach specifically the use of a recombinant DNA molecule (e.g., modified pJ344:91543-TC-GCSF plasmid) comprising a primosome assembly site in the heavy strand (PAS-BH) (claim 14), or a sequence at least 90% identical to SEQ ID NO: 5 (claim 15); or purifying the RNA comprises digesting the DNA. Before the effective filing date of the present application (8/10/2015), Williams already taught vector modifications that improve production yield of ccc recombinant DNA molecules such as plasmids, including a plasmid with a pUC origin (see at least Abstract; Summary of the Invention; particularly paragraphs [0011]-[0012], [0015], [0060]-[0064], [0067], [0070] and Fig. 2). Williams taught explicitly that by adding one or more components selected from the group consisting of an SV40 enhancer, PAS-BH region, and PAS into a plasmid vector to improve plasmid yield in shake flask and/or fermentation culture. Williams stated explicitly “It has been surprisingly found that this PAS-BH site improves plasmid yield in subsequent shake flask and/or fermentation culture” (paragraph [0067]). An exemplary DNA plasmid with improved copy number designated NTC8485 having SEQ ID NO: 11 (3,784 nts) that has the sequence of nucleotides 2256-1 having 98% sequence identity to SEQ ID NO: 5 of the present application with components comprising at least PAS-BH, pUC origin of replication, kanamycin resistance-gene, and SV40 enhancer (see attached sequence search below). Additionally, Melton et al already disclosed at least an efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter, wherein the method comprises transcribing linearized DNA plasmid templates in a transcription buffer comprising rNTPs (rATP, rGTP, rCTP and rUTP) with 500 uM of each rNTP; and following RNA synthesis the DNA templates are removed by the addition of RNAsin and RNAse-free DNase (see at least page 7038, last two paragraphs; and Figure 2). Accordingly, it would have been obvious for an ordinary skilled artisan before the effective filing date of the present application to further modify the combined teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al by also further incorporating at least the PAS-BH region and/or an SV40 enhancer, or a sequence of nucleotides 2256-1 of the exemplary DNA plasmid with improved copy number designated NTC8485 having SEQ ID NO: 11 that contains components comprising at least PAS-BH, pUC origin of replication, kanamycin resistance-gene, and SV40 enhancer, into the modified pJ344:91543-TC-GCSF plasmid vector to improve plasmid yield in a fermentation culture; as well as further digesting the DNA template in the process of purifying the transcribed RNA molecule, in light of the teachings of Williams and Melton et al as presented above. An ordinary skilled artisan would have been motivated to further carry out the above modifications because Williams taught explicitly that by adding one or more components selected from the group consisting of an SV40 enhancer, PAS-BH region, and PAS into a plasmid vector, including a plasmid vector with a pUC origin, to improve plasmid yield in shake flask and/or fermentation culture; along with an exemplary DNA plasmid with improved copy number designated NTC8485 having SEQ ID NO: 11 (3,784 nts) that has the sequence of nucleotides 2256-1 having 98% sequence identity to SEQ ID NO: 5 of the present application with components comprising at least PAS-BH, pUC origin of replication, kanamycin resistance-gene, and SV40 enhancer. Moreover, Melton et al also taught that following RNA synthesis the DNA templates are removed by the addition of RNAsin and RNAse-free DNase in a process for in vitro synthesis of a biologically active RNA. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al, Romero Ramos et al, Williams and Melton et al as set forth above; coupled with a high level of skill of an ordinary skilled artisan in the relevant art. The modified method resulting from the combined teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al, Romero Ramos et al, Williams and Melton et al is indistinguishable and encompassed by the presently claimed invention. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claims 40, 42 and 48-50 are rejected under 35 U.S.C. 103 as being unpatentable over Bancel et al (WO 2014/152027; IDS) in view of Von Der Mulbe et al (US 2005/0032730; IDS), Marra et al (Science 300:1399-1404, 2003), Carnes et al (US 7,943,377; IDS) and Romero Ramos et al (US 2018/0135060; IDS) as applied to claims 5-6, 10, 12-13, 16-20, 22, 25-26, 32, 35, 39, 41 and 43-46 above, and further in view of Thess et al (WO 2013/143698; IDS) and Priess et al (RNA 4:1321-1331, 1998; IDS). The combined teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al were presented above. However, none of the cited references teach specifically that the insert comprising two homopolymeric poly(A) sequences separated by a heteropolymeric linker sequence, wherein each of said regions of poly(A) sequence comprises 20 to 400 adenosine nucleotides in length. Before the effective filing date of the present application (8/10/2015), Thess et al already disclosed an artificial nucleic acid molecule (e.g., mRNA and/or a DNA vector encoding the mRNA) comprising at least one open reading frame and at least one 3’-UTR for use in gene therapy and/or genetic vaccination applications, wherein the artificial nucleic acid molecule further comprises elements such as a poly(A) and a poly(C) sequence (see at least the Abstract; and page 45, last paragraph continues to first paragraph on page 46). Thess et al stated “[p]referably the artificial nucleic acid molecule according to the present invention comprises, preferably in 5’-to-3’ direction, an ORF, at least one 3’UTR element as described above, a poly(A) sequence or a polyadenylation signal, and a poly(C) sequence” (page 45, last paragraph continues to first paragraph on page 46). Thess et al also taught that the poly(A) sequence may have a length of about 20 adenine nucleotides up to about 300 adenine nucleotides, more preferably from about 50 to about 100 adenine nucleotides, such as 60, 70, 80 or 100 adenine nucleotides (page 40, last paragraph); and the poly(A) sequence is located 3’ to at least one 3’UTR element via a direct connection or indirect connection such as via a linker of 1-50 or preferably 20 nucleotides (page 38, second paragraph). Additionally, Priess et al already investigated the effect of different poly(A) tail length systematically by generating a series of capped IRE.CAT mRNAs with poly(A) tails ranging from 15 to 98 adenosines in length using plasmid DNAs encoded homopolymeric stretches of various lengths pIRE.CAT(A)15, pIRE.CAT(A)51, pIRE.CAT(A)98 and pIRE.CAT(A)150; and they found that CAT yields begin to increase significantly at and beyond 31 adenosines, and reach an early saturation at 51 adenosines under non-competitive conditions, whereas under competitive conditions CAT translation increases steadily between 15 and 98 adenosines (section titled “Effects of variations in poly(A) tail length on translation” on page 1326-1327; and Fig. 7). Moreover, Preiss et al reported generation of spontaneous deletion mutants during amplification of the plasmids pIRE.CAT(A)98 and pIRE.CAT(A)150 in bacteria; and found that the construct with the (A/T)150 proved too unstable for isolation in pure form but allowed the isolation of another spontaneous deletion clone pIRE.CAT(A)72 (section titled “Plasmid constructs” on page 1329). Accordingly, it would have been obvious for an ordinary skilled artisan before the effective filing date of the present application to further modify the combined teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al by also using a poly(A) sequence having a length of about 20 adenine nucleotides up to about 300 adenine that is comprised of multiple of poly(A) sequence of about 30-70 adenosine nucleotides each that are connected via a heteropolymeric linker, in light of the teachings of Thess et al and Priess et al as presented above. An ordinary skilled artisan would have been motivated to further carry out the above modifications because: (i) Thess et al already disclosed an artificial nucleic acid molecule (e.g., mRNA and/or a DNA vector encoding the mRNA) comprising at least one open reading frame and at least one 3’-UTR for use in gene therapy and/or genetic vaccination applications, wherein the artificial nucleic acid molecule further comprises elements such as a poly(A) and a poly(C) sequence, and wherein the poly(A) sequence may have a length of about 20 adenine nucleotides up to about 300 adenine nucleotides and using a linker of 1-50 or preferably a 20 nucleotide-linker to indirectly connect the poly(A) sequence to the 3’ of at least one 3’UTR element; and (ii) Preiss et al reported generation of spontaneous deletion mutants during amplification of the plasmids pIRE.CAT(A)98 and pIRE.CAT(A)150 in bacteria; and found that the construct with the (A/T)150 proved too unstable for isolation in pure form but allowed the isolation of another spontaneous deletion clone pIRE.CAT(A)72. Accordingly, by segmenting a poly(A) sequence having a length of about 20 adenine nucleotides up to about 300 adenine nucleotides into multiple of poly(A) sequence of about 30-70 adenosine nucleotides each that are connected via a heteropolymeric linker, spontaneous generation of deletion mutants during amplification of the plasmids could be avoided. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al, Thess et al and Priess et al as set forth above; coupled with a high level of skill of an ordinary skilled artisan in the relevant art. The further modified method for fermentative production of a covalently closed recombinant DNA molecule resulting from the combined teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al, Thess et al and Priess et al as set forth above is indistinguishable from the presently claimed method regarding to the materials and method steps used. Accordingly, it would also possess the same properties recited in the “wherein functional clause” regarding to the yield of the covalently circular recombinant DNA molecule in new claim 48. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Response to Arguments Applicant’s arguments related to the above 103 rejections in the Amendment filed on 02/25/2026 (pages 8-11) have been fully considered but they are respectfully not found persuasive for the reasons discussed below. It is noted that Applicant presented essentially the same arguments as those presented in the Amendment filed on 08/05/2025 (pages 7-11). A. Applicant argued that since Carnes teaches that the orientations of prokaryotic elements in the plasmid had no effect and that the inducible process is not specific to a particular plasmid, an ordinary skill in the art would have expected all plasmids to work equally well regardless of the orientation of prokaryotic elements. Applicant argued that at the time of filing the application, it was neither known nor reasonably expected that a plasmid with a specific orientation of replication and transcription, or a particular distance between the origin of replication and the poly(A) sequence, would be particularly suited for use in a fermentative production method. Additionally, Applicant argued that numerous widely used plasmids, such as pNIC-CH and pcDNA3.1, exhibit opposite directionality between transcription and replication. Consequently, there was no reason to believe altering the directionality of these elements would reasonably result in an increase in yield. None of Bancel, Von Der Mulbe, Marra, Carnes and Romero Ramos identified directionality as a point of optimization, and a skilled in the art would not have been motivated to specifically optimize the system with these two factors, directionality and distance, considered together. Applicant also argued that both the Williams and Melton references do not cure the aforementioned defects in the combination of Bancel, Von Der Mulbe, Marra, Carnes and Romero Ramos. First, it is irrelevant whether or not Carnes recognized the importance of optimizing the distance between the homopolymeric poly(A) sequence and the origin of replication, and/or the orientations of prokaryotic elements in any plasmid vector. As set forth in the above 103 rejection, an ordinary skilled in the art would have been motivated to modify the teachings of Bancel by also at least using the fed-batch fermentation method of Carnes for fermentative production of the covalently closed circular recombinant DNA plasmid template comprising a gene of interest with 2500, 3000, 4000, 5000 nucleotides or more in length in the same configuration as those described in the exemplary plasmids pJ344:91543-TC-GCSF and pJ204:104975 that is modified by the substitution of the ampicillin-resistance gene with the kanamycin-resistance gene as a selection marker to obtain large amounts of plasmids for the production of RNA transcripts because Carnes already taught improvements in plasmid DNA production technology to ensure economic feasibility of future DNA vaccines and DNA therapeutics, including fed-batch fermentation strategies combining novel growth and induction phase temperature shifts. Additionally, the above rejection was made under 35 U.S.C. 103 based on the specific combination of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al. Second, the covalently closed circular recombinant pJ344:91543-TC-GCSF plasmid and/or pJ204109475 plasmid containing a gene of interest with 2500, 3000, 4000, 5000 nucleotides or more in length, with the substitution of the GCSF gene and FIX gene, respectively, by the coding sequence of a viral surface antigen such as the surface Spike glycoprotein of SARS-associated coronavirus contain all elements except for the kanamycin resistance gene and in the same directionality as those recited in the DNA molecule used in a method for producing a RNA molecule of the presently claimed invention. The above 103 rejections are directed specifically to the plasmid platform of the exemplary pJ344:91543-TC-GCSF plasmid and pJ204109475 plasmid in Bancel, and not related to any modifications for other widely used plasmids, such as pNIC-CH and pcDNA3.1. Please refer to the above 103 rejections for more details, particularly the motivation on why an ordinary skilled artisan would modify the teachings of Bancel by also using the fed-batch fermentation method of Carnes et al for fermentative production of the covalently closed circular recombinant DNA plasmid template comprising a gene of interest with 2500, 3000, 4000, 5000 nucleotides or more in length such as the coding sequence of the surface Spike glycoprotein of SARS-associated coronavirus in the same configuration as those described in the exemplary plasmids pJ344:91543-TC-GCSF and pJ204:104975 that is modified by the substitution of the ampicillin-resistance gene by the kanamycin-resistance gene as a selection marker to obtain large amounts of plasmids for the production of RNA transcripts. It is also important to note that the replacement/substitution of the ampicillin-resistance gene with the kanamycin-resistance gene should not affect the yield of a covalently closed circular (ccc) recombinant DNA molecule since similar yields were obtained for ccc recombinant DNA plasmids P1140-K2 containing kanamycin-resistance gene and P1140-AF2 containing RNA OUT selective marker (see Table 1 of the specification). Third, since the modified method for producing a RNA molecule resulting from the combined teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al is indistinguishable from the presently claimed method regarding to the materials and method steps used, it would also possess the same properties recited in the “wherein functional clause” regarding to the yield of the covalently circular recombinant DNA molecule. Please note that the resulting modified recombinant pJ344:91543-TC-GCSF plasmid having the substitution of the ampicillin-resistance gene with the kanamycin-resistance gene as a selection marker, and the substitution of the coding sequence of GCSF with the coding sequence of the surface Spike glycoprotein of SARS-associated coronavirus (1,255 amino acids) would have a homopolymeric poly(A) sequence located at a distance of 3768 bp (1,255 x 3 bp = 3765 bp plus 3 bp for the starting codon) from the bacterial origin of replication. Moreover, it is noted that the “wherein clause” regarding to the yield of the DNA molecule does not add any further structural details for the DNA molecule and/or any further conditions used in E. Coli bacterial fermentation. Please, also note that where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke. Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972). Fourth, with respect to any robust and surprising yields for plasmids P1140-AF2 and P1140-K2 they must be commensurate with the scope of the claims. However, the claims under rejection are not necessarily limited to a method for fermentative production of plasmids P1140-AF2 (3617 bp-plasmid vector; Figure 2) and P1140-K2 (4385 bp-plasmid vector; Figure 4) in E. Coli bacteria. It is noted that the P1140-K2 plasmid has a single 64-adenosine-nucleotide poly(A) tail sequence that is followed by a single 31-cytidine-nucleotide poly(C) sequence, and both poly(A) tail sequence and poly(C) sequence are 3’ of the ORF (see Figure 2). Fifth, both the Williams and Melton references were cited primarily to supplement the combined teachings of Bancel et al, Von Der Mulbe et al, Marra et al, Carnes et al and Romero Ramos et al for the additional limitations recited in dependent claims 14-15 and 28. B. With respect to the rejection based on Bancel, Von Der Mulbe, Marra, Carnes, Romero Ramos, Thes and Priess, Applicant argued that none of the cited prior art references teach a plasmid having two poly(A) sequence regions. Specifically, Applicant argued that Thess teaches a linker positioned between the insert and a single poly(A) sequence, while Priess reports the generation of spontaneous deletion mutants during plasmid amplification; and it is stated in the Office action that such mutants could be avoided, implying no inherent benefit from using a heteropolymeric linker between poly(A) sequences. Therefore, the combination of Thess and Priess does not suggest the claimed configuration of two poly(A) sequences separated by a linker, and a skilled artisan would not have been motivated to arrive at this invention by combining these two references with any other cited art. First, since the above rejection was made under 35 U.S.C 103 none of the cited references have to teach every limitation of the instant claims. For example, neither Thess nor Priess alone have to teach a configuration of two poly(A) sequences connected by a heteropolymeric linker sequence. Second, since Thess et al already taught that the poly(A) sequence may have a length of about 20 adenine nucleotides up to about 300 adenine nucleotides and using a linker of 1-50 or preferably a 20 nucleotide-linker to indirectly connect the poly(A) sequence to the 3’ of at least one 3’UTR element; and Preiss et al reported generation of spontaneous deletion mutants during amplification of the plasmids pIRE.CAT(A)98 and pIRE.CAT(A)150 in bacteria; and found that the construct with the (A/T)150 proved too unstable for isolation in pure form but allowed the isolation of another spontaneous deletion clone pIRE.CAT(A)72; it would have been obvious for an ordinary skilled in the art to recognize that by segmenting a poly(A) sequence having a length of about 20 adenine nucleotides up to about 300 adenine nucleotides into multiple poly(A) sequences of about 30-70 adenosine nucleotides each that are indirectly connected via a heteropolymeric linker, spontaneous generation of deletion mutants during amplification of the plasmids could be avoided. Third, please also note that the standard under 35 U.S.C. 103 is a “reasonable” expectation of success. Conclusions No claim is allowed. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/Primary Examiner, Art Unit 1631 Plasmid pNTC7485 genome, SEQ ID NO: 11. US2010184158-A1. Query Match 98.1%; Score 2241.6; DB 40; Length 3784; Best Local Similarity 99.6%; Matches 2247; Conservative 0; Mismatches 9; Indels 0; Gaps 0; Qy 1 GAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2256 GAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACC 2197 Qy 61 ATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2196 ATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAG 2137 Qy 121 GATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2136 GATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTAT 2077 Qy 181 CAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGA 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2076 TAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGA 2017 Qy 241 ATCCGGTGAGAATGGCAAAAGTTTGTGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCC 300 ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| Db 2016 ATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCC 1957 Qy 301 ATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1956 ATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGC 1897 Qy 361 CTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1896 CTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATG 1837 Qy 421 TAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTC 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1836 CAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTC 1777 Qy 481 TTCTAATACCTGGAAGGCTGTTTTCCCAGGGATCGCAGTGGTGAGTAACCAAGCATCATC 540 ||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||| Db 1776 TTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATC 1717 Qy 541 AGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1716 AGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAG 1657 Qy 601 TCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1656 TCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAA 1597 Qy 661 CTCTGGCGCATCGGGCTTCCCATACAATCGGTAGATTGTCGCACCTGATTGCCCGACATT 720 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Db 1596 CTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATT 1537 Qy 721 ATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1536 ATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCT 1477 Qy 781 AGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTA 840 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1476 CGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTA 1417 Qy 841 AGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1416 AGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAG 1357 Qy 901 ATTTTGAGACACAACGTGGTTTGCAGGAGTCAGGCAACTATGGATGAACGAAATAGACAG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1356 ATTTTGAGACACAACGTGGTTTGCAGGAGTCAGGCAACTATGGATGAACGAAATAGACAG 1297 Qy 961 ATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1296 ATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCA 1237 Qy 1021 TATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1236 TATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATC 1177 Qy 1081 CTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1176 CTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA 1117 Qy 1141 GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1116 GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGC 1057 Qy 1201 TGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1056 TGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTA 997 Qy 1261 CCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 996 CCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTT 937 Qy 1321 CTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 936 CTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTC 877 Qy 1381 GCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 876 GCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGG 817 Qy 1441 TTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 816 TTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCG 757 Qy 1501 TGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 756 TGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAG 697 Qy 1561 CTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 696 CTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGC 637 Qy 1621 AGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTAT 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 636 AGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTAT 577 Qy 1681 AGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 576 AGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGG 517 Qy 1741 GGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 516 GGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGC 457 Qy 1801 TGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 456 TGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT 397 Qy 1861 ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 396 ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA 337 Qy 1921 GTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 336 GTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGT 277 Qy 1981 ATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 276 ATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGC 217 Qy 2041 CAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAA 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 216 CAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAA 157 Qy 2101 CACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTG 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 156 CACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTG 97 Qy 2161 TGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 96 TGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGA 37 Qy 2221 GGCAGCCTAAGAAAAAAAAGCCCGCTCATTAGGCGG 2256 |||||||||||||||||||||||||||||||||||| Db 36 GGCAGCCTAAGAAAAAAAAGCCCGCTCATTAGGCGG 1
Read full office action

Prosecution Timeline

Show 7 earlier events
May 16, 2024
Response Filed
Sep 17, 2024
Response after Non-Final Action
Feb 06, 2025
Final Rejection mailed — §103
Aug 05, 2025
Request for Continued Examination
Aug 06, 2025
Response after Non-Final Action
Sep 25, 2025
Non-Final Rejection mailed — §103
Feb 25, 2026
Response Filed
Apr 28, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12697350
METHODS AND COMPOSITIONS FOR TREATING A PREMATURE TERMINATION CODON-MEDIATED DISORDER
4y 3m to grant Granted Aug 04, 2026
Patent 12680074
ANTIGEN PRESENTING T CELLS, SENSITIZED, MANUFACTURED T CELLS AND METHODS OF TREATMENT USING THE SAME
3y 8m to grant Granted Jul 14, 2026
Patent 12680076
METHODS FOR ENGINEERING ALLOGENEIC AND HIGHLY ACTIVE T CELL FOR IMMUNOTHERAPHY
3y 8m to grant Granted Jul 14, 2026
Patent 12673116
COMPOSITIONS AND METHODS FOR TREATING NON-AGE-ASSOCIATED HEARING IMPAIRMENT IN A HUMAN SUBJECT
5y 3m to grant Granted Jul 07, 2026
Patent 12655427
Recombinant Adeno-Associated Virus Delivery of Exon 2-Targeted U7SNRNA Polynucleotide Constructs
4y 6m to grant Granted Jun 16, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

7-8
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.6%)
4y 0m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 750 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month