Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Amendments
In the reply filed 3/26/2026, Applicant has amended Claims 1 and 13, and cancelled claims 7, 10, 14, and 20.
Claims 1-6, 8-9, 11-13, 15-19 are under consideration.
Election/Restrictions
Applicant’s election of the following species in the reply filed on 7/29/2025 has been acknowledged.
Claims 4 and 5: RNA;
Claims 11 and 13: a nickase function;
Claims 12 and 15: a plant cell, and human cell was rejoined;
Claim 17: hematologic disorders;
Claim 18: Sickle cell disease.
Rejoinder
As per Claims 4 and 5, DNA as the doNA is rejoined.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 3/10/2026 was filed after the mailing date of the non-final Office action on 11/24/2025. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Withdrawn Objection to Specification
The objection to the Specification as not conforming to sequence rules is withdrawn in light of the amendments filed.
New Objection to Specification
The disclosure is objected to because of the following informalities: MPEP 608.01(p) states that simulated or predicted test results and prophetical examples (paper examples) are permitted in patent applications. However, paper examples should not be represented as work actually done. No results should be represented as actual results unless they have actually been achieved. Paper examples should not be described using the past tense. Hoffman-La Roche, Inc. v. Promega Corp., 323 F.3d 1354, 1367, 66 USPQ2d 1385, 1394 (Fed. Cir. 2003). For further guidance, see "Properly Presenting Prophetic and Working Examples in a Patent Application," 86 FR 35074 (July 1, 2021). In instant case, Applicant switches tense in Examples 1-16. For example, Example 10a indicates a vector “was” cloned, but the donor “is” driven, or Example 10b indicates the vector “was” cloned, but “is” transformed, or Example 11 indicates the vector “is” used”, but the seeds “has been” done. This is by no means an exhaustive list, and the Examiner suggests using a consistent tense for example that have actually been carried out versus those that are paper examples.
Appropriate correction is required.
Withdrawn Claim Objections
The objection to Claim 13 for informalities of labeling is withdrawn in light of Applicant’s amendments to instant claim.
Withdrawn 35 USC § 112(b)
The prior rejection of Claim 13 under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which applicant regards as the invention is withdrawn in light of Applicant’s amendments of instant claimed to describe the nucleic acid.
Withdrawn 35 USC § 103
The prior rejection of Claims 1-6, 8-9, 11-13, 15-19 under 35 U.S.C. 103 as being unpatentable over Cotta-Ramusino et al., (WO2017/180711, filed 4/12/2017, published 10/19/2017, with priority to US 62/322,099, filed 4/13/2016, see IDS filed 9/16/2022) is withdrawn in light of Applicant’s amendments of claim 1 to limit the homology arms to 50 or less nucleotides, which was an unexamined limitation, and Cotta-Ramusino does not teach.
New Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-6, 8-9, 11-13, and 15-16 are rejected under 35 U.S.C. 103 as being unpatentable over Potter et al. (WO2016/065364, filed 10/26/2015, published 4/28/2016, see IDS filed 9/16/2022),
Human Cell Embodiments
[AltContent: textbox ([img-media_image1.png])]In regard to claim 1, Potter teaches methods for modifying a genomic target in cells comprising contacting the cell with a composition comprising (a) a recombinant fusion nucleic acid molecule comprising a guide RNA covalently linked to a donor nucleic acid and (b) a Cas9 polypeptide (Example 1, Claims 7-9 of Potter, see excerpt from Fig. 9, adjacent).
With respect to the preamble of claim 1, Potter teaches methods for modifying the genomic target in a cell encompass cells comprising mutations associated with a disease phenotype such as cancer [0110] and teaches in vivo delivery formulations [0099].
With respect to the donor nucleic acid of claim 1(a), Potter teaches the donor nucleotide is as short as about 50 nt, and that homology arms are as short as 25 nt (see Claims 8 and 9 of Potter). Specifically, Potter provides a working example of a sRNA covalently attached to 80 bp ssDNA oligonucleotide (Example 1), wherein the homology arms of donor DNA for homologous recombination a the HPRT locus are about 27 nucleotides each (highlighted boxes) and separated by EcoR1 insertion sequence (in bold) (see p. 26, line 8 for ssDNA sequence below):
gaagaaggaactctagccagagtcttggaattccgttagtgtaggttctgaccgggtaatggactggggctgaatcacatg
However, although Potter teaches the method is very useful in DNA repair of single nucleotide polymorphisms (SNPs), wherein the donor DNA is designed with two homology regions that 25 nt in length and a single base pair correction (p. 10, [0047]), they do not provide a preferred embodiment of treating a genetic disease in an organism.
Nevertheless, it would have been obvious to one having ordinary skill in the art at the time the invention was filed to practice said method to treat a genetic disease such as cancer because each of the individual elements of the instant claims are independently presented by Potter as embodiments and are taught that they can be combined in various embodiments; therefore a combination of all the elements into a single embodiment would be apparent to an artisan skilled in gene therapy in light of the Supreme Court’s KSR decision (see MPEP 2143 Exemplary Rationale (A)). Regarding the rationale for combining prior art elements according to known methods to yield predictable results, all of the claimed elements were known in the prior art and one skilled in the art could have combined the element as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of filing of the invention. Each of the elements (guide RNA fused to donor templates, Cas9 nucleases, delivery methods and formulations for treating SNP based genetic disease) are taught by Potter and further they are taught in various combinations and are shown to be used in a method for genetically modifying a cell to treat a genetic disease. It would have been therefore predictably obvious to use a combination of these elements in said method.
In regard to claims 2 and 3, Potter teaches the guide RNA comprises a spacer of at least 13 bases which are 100% complementary to at least 16 consecutive bases in the target sequence (Example 1, Methods, [0115]).
In regard to claims 4 and 5, as stated supra, Potter teaches the guide RNA is RNA and the donor nucleic acid is a ssDNA.
In regard to claim 6, as stated supra, Potter teaches the homology arms of at least 15 consecutive bases complementary to the target site
In regard to claims 8 and 16, as shown supra, Potter teaches the guide RNA further comprises a scaffold nucleic acid, wherein the scaffold forms a secondary structure of at least two hairpins.
In regard to claim 9, as shown supra in Figure , Potter teaches the guide RNA is covalently bound to a scaffold RNA.
In regard to claim 11, Potter teaches that the Cas9 can be a nickase [0006, 0031].
In regard to claim 12, Potter teaches the target site can be in a human cell (e.g., Jurkat T cell as in Example 1).
In regard to claim 13, as stated supra, Potter teaches (i) the guide RNA comprises a spacer of at least 16 bases which are 100% complementary to at least 16 consecutive bases in the target sequence, and (ii) a Cas9 nuclease capable of nicking (nickase). Furthermore, in an ex vivo embodiment, Potter teaches (iii) a cell comprising a target site [0099].
In regard to claim 15, as stated supra, Potter teaches the target site can be in a human cell.
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
RESPONSE TO ARGUMENTS
Applicant's arguments filed on 3/26/2026 are acknowledged.
Applicant argues that the preferred embodiments of Cotta-Ramusino use donor nucleic acids of 129 and 179 nucleotides in length, and are not explicit on the lengths of the homology arms but it would have been reasonable to assume that these lengths were about 64 or 89 nucleotides, respectively. By contrast, Applicant argues that in yeast cells, they were able to use homology arms under 50 nucleotides.
Applicant's arguments have been fully considered and they are found persuasive. Nevertheless, the amended claims necessitated a new rejection over Potter who makes predictably obvious a method of treating a genetic disease in an organism comprising a guide RNA fused to a donor nucleic acid with homology arms less than 50 nucleotides.
Claims 17-19 are rejected under 35 U.S.C. 103 as being unpatentable over Potter et al. (WO2016/065364, filed 10/26/2015, published 4/28/2016, see IDS filed 9/16/2022) in view of Zhang et al. (US2016/0208243, filed 12/18/2015, published 7/21/2016)
As stated supra, Potter suggests methods for treating a genetic disease based on SNPs comprising a guide RNA fused to a donor DNA is designed with two homology regions that 25 nt in length and a single base pair correction.
However, Potter is silent to treating the SNP underlying the genetic disease of Sickle Cell Anemia.
Zhang teaches treating genetic disease comprising the CRISPR system comprising guide RNAs and donor repair templates. In regard to instant claims, Zhang teaches the guide RNA and HDR template can target the human beta globin (HBB) gene for treating Sickle Cell Anemia [0815-0816, 0869-0870, 1327-1328, 1331, 1353, 1367, 1496]. Specifically, Zhang explains that a SNP cause the change from glutamic acid (GAG) to valine (GTG) to cause the disease, and the HDR template corrects the SNP by providing the proper sequence [1331].
Accordingly, it would have been obvious to practice methods for treating a genetic disease based on SNPs comprising a guide RNA fused to a HDR template as suggested by Potter and choose Sickle Cell Anemia as the genetic disease as taught by Zhang with a reasonable expectation of success. One of ordinary skill would have been motivated to do so as taught by Zhang because Sickle Cell Anemia is a clinically revlevant diseases that causes serious damage to the bone, spleen, and skin, which can lead to episodes of pain, frequent infections, or even multiple organ failure [1331].
Furthermore, in regard to claim 19, as stated supra Zhang teaches the target site is single nucleotide polymorphism in the HBB gene that causes the Glu to Val mutation. Since, the only “replacement sequence” is the with a wildtype sequence with no intervening nucleotides, the homology arms are directly adjacent to each other. Note that Applicant specification evidences that when a homology arm is larger than 15 nucleotides it can be as low as 60% complementary to the target nucleic acid (p. 9. 4th para.).
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
RESPONSE TO ARGUMENTS
Applicant's arguments filed on 3/26/2026 are acknowledged and have been addressed supra.
Claims 1-6, 8-9, 11-12, and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Beetham et al. (US2017/0081674, filed 3/14/2015, published 3/23/2017), in view of Potter et al. (WO2016/065364, filed 10/26/2015, published 4/28/2016, see IDS filed 9/16/2022) and Xiong et al. (Hort Res, 2015, 1 15019)
Plant Cell Embodiments
[AltContent: textbox ([img-media_image2.png])]In regard to claim 1, Beetham teaches methods for modifying a genomic target in plant cells comprising contacting the plant cell with a composition comprising (a) a recombinant fusion nucleic acid molecule comprising a guide RNA tethered to a donor gene repair oligonucleotide (GRON) (b) a Cas9 nuclease ([0007-0008, 0233, 0300-0313], see excerpt from Fig. 10, adjacent). Specifically, although Beetham teaches the nuclease may be “covalently coupled” to the repair oligonucleotide [0233], and the overall concept that the CRISPR-Cas complex with tether GRON to the site of nuclease activity thereby increasing the likelihood of gene editing [0539], they are silent to a covalent coupling of the GRON to the guide RNA.
Nevertheless in regard to covalent coupling of claim 1, Potter teaches methods for modifying a genomic target in cells comprising contacting the cell with a composition comprising (a) a recombinant fusion nucleic acid molecule comprising a guide RNA covalently linked to a donor nucleic acid and (b) a Cas9 polypeptide (Example 1, Claims 7-9 of Potter, see Fig. 9).
Accordingly, it would have been obvious to practice methods for modifying a plant cell comprising the CRISPR-Cas system comprising a guide RNA tethered to a GRON as taught by Beethram and substitute a covalently tethered donor nucleic acid as taught by Potter with a reasonable expectation of success. One of ordinary skill would have been motivated to do so as taught by Potter because click-chemistry used to covalently couple the guide RNA to the donor DNA is particularly advantageous because it is fast, modular, efficient, does not produce waste products, done in water, and can be stereospecific [0082].
With respect to the donor nucleic acid of claim 1(a), Beetham teaches the donor nucleotide is a gene repair oligonucleotide (GRON) that is at least 15 bases in length and comprises a mutation site for introduction into the target DNA of the plant cell (Summary, [0008]). Specifically, Beetham teaches a donor oligonucleotides of 41-mer or 101-mer, with the mutation (e.g., C>T) in nearly the middle yielding homology arms of 20 or 50 nucleotides, respectively (Example 7, Table 7, see Fig. 4, but see also Example 16 with a modified GRON).
However, with respect to the preamble of claim 1, although Beetham teaches methods for modifying the genomic target in a plant cell, the preferred embodiments of Beetham are directed to genetic modification for herbicidal resistance, and Beetham is silent to modifications to treat plant diseases such as for disease resistance.
Nevertheless in regard to the preamble of claim 1, Xiong reviews genome-editing technologies in plants, and specifically teaches the advantages of using the CRISPR-Cas system (p. 7, Table 2). Importantly, Xiong teaches that the genome editing strategy can introduce gene encoding for new traits into plants, such as resistance to certain diseases (p. 2, 3rd para., pgs. 3-4, Table 1, p. 6, 1st para.).
Accordingly, it would have been obvious to practice methods for modifying a plant cell comprising the CRISPR-Cas system as taught by Beethram and choose to modify a disease resistance gene as reviewed by Xiong with a reasonable expectation of success. One of ordinary skill would have been motivated to do so as taught by Xiong because plant disease caused by microorganisms is a major factor that reduces shelf life and the quality and yield of horticultural crops (p. 7, col 2, 1st para.).
In regard to claims 2 and 3, Beetham teaches the guide RNA comprises a spacer that is typically 20 nucleotides and with at least 13 nucleotides 100% complementary to the same number of consecutive bases in the target sequence ([0286, see Examples 7 and 16).
In regard to claims 4 and 5, as stated supra, Beetham teaches the guide RNA is RNA and the donor nucleic acid is a DNA.
In regard to claim 6, as stated supra, Beetham teaches the homology arms of at least 15 consecutive bases complementary to the target site
In regard to claims 8 and 16, as shown supra, Beetham teaches the guide RNA further comprises a scaffold nucleic acid, wherein the scaffold forms a secondary structure of at least two hairpins.
In regard to claim 9, as stated supra, Potter makes obvious that the guide RNA is covalently bound to a scaffold RNA.
In regard to claim 11, Beetham teaches that the Cas9 can be a nickase [0047, Example 10, 0031].
In regard to claim 12, as stated supra, Beetham teaches the target site can be in a plant cell.
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
RESPONSE TO ARGUMENTS
Applicant's arguments filed on 3/26/2026 are acknowledged and have been addressed supra.
Claims 1-6, and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (US2016/0208243, filed 12/18/2015, published 7/21/2016) in view of Potter et al. (WO2016/065364, filed 10/26/2015, published 4/28/2016, see IDS filed 9/16/2022)
fuRNA Embodiments
Zhang teaches modifying a target RNA sequence in a cell for the treatment of a genetic disease, the gene therapy method comprising (a) administering to the cells the Type V CRISPR-Cas system comprising guide RNAs and donor RNA repair templates for changing a single nucleic acid, and (b) a Cpf1 site directed nuclease [0009, 0221-0226, 0448, 0632, 0857, 0903].
With respect to the length of homology arms of the donor nucleic acid of claim 1, Zhang teaches the lengths of the homology arms are at least 20 bp, for example about 50 bp [0222, 0635], which total template length being from about 40 to 100 bp [0634]. Zhang also teaches the lengths of the homology arms should be short to avoid repeat elements [0636]. Notably, in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. See M.P.E.P. §2144.05.
With respect to covalent coupling of the donor nucleic acid of claim 1, although Zhang teaches the modification of the guide RNA to increase its activity, such as chemically modified guide RNAs, modified guide RNAs with attached functional domains, aptamers, added loops, etc. [0317-0321], they are silent to modification of the guide RNA to attach the donor nucleic acid.
In regard to claim 1, Potter teaches methods for modifying a nucleic acid in cells comprising contacting the cell with a composition comprising a recombinant fusion nucleic acid molecule comprising a guide RNA covalently linked to a donor nucleic acid (Example 1, Claims 7-9 of Potter, see Fig. 9).
Accordingly, it would have been obvious to practice gene therapy methods for modifying a cell for a genetic disease comprising the CRISPR-Cas system comprising a guide RNA and a donor nucleic acid as taught by Zhang and to attach the guide RNA to the donor nucleic acid as taught by Potter with a reasonable expectation of success. One of ordinary skill would have been motivated to do so as taught by Potter because doing so enhances homologous recombination by increasing the concentration of donor nucleic at or in close proximity to the junction of a break in a nucleic acid molecule resident in a cell [0004]. In regard to the reasonable expectation of success in doing so, Potter teaches click-chemistry used for the ligation of RNA molecules is particularly advantageous because it is fast, modular, efficient, does not produce waste products, done in water, and can be stereospecific [0082].
In regard to claims 2 and 3, Zhang teaches the guide RNA comprises a spacer of 23-25 nucleotides which are 100% complementary to at least 13 consecutive bases in the target sequence [0226].
In regard to claims 4 and 5, as stated supra, Zhang teaches the guide RNA is RNA and the donor nucleic acid is a RNA.
In regard to claim 6, as stated supra, Zhang teaches the homology arms are more than 15 consecutive bases in length.
In regard to claim 12, Zhang teaches the target RNA can be in a human cell [0223, 0448].
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
RESPONSE TO ARGUMENTS
Applicant's arguments filed on 5/1/2026 are acknowledged and have been addressed supra.
Withdrawn Double Patenting
The prior rejection of Claims 1-5, 8-9, 12 and 16 on the grounds of nonstatutory double patenting over claim 11-20 of U.S. Patent No. 11,608,499 (Neuteboom et al., Patented 3/21/2023) is withdrawn in light of Applicant’s amendments of claim 1 to limit the homology arms to 50 or less nucleotides
The prior rejection of Claims 6, 11, 13, 15, and 17-19 on the grounds of nonstatutory double patenting over claim 11-20 of U.S. Patent No. 11,608,499 (Neuteboom et al., Patented 3/21/2023), as applied to Claim 1, in view of Cotta-Ramusino et al., (WO2017/180711, filed 4/12/2017, published 10/19/2017, with priority to US 62/322,099, filed 4/13/2016, see IDS filed 9/16/2022) is withdrawn in light of Applicant’s amendments of claim 1 to limit the homology arms to 50 or less nucleotides
The prior provisional rejection of Claims 1-6, 8-9, 11-13, and 15-16 on the grounds of nonstatutory double patenting as being unpatentable over claims 1- 10 of copending Application No. 17/933,005 is withdrawn in light of Applicant’s amendments of claim 1 to limit the homology arms to 50 or less nucleotides
The prior provisional rejection of Claims 17-19 on the grounds of nonstatutory double patenting as being unpatentable over claims 1- 10 of copending Application No. 17/933,005, in view of Cotta-Ramusino et al., (WO2017/180711, filed 4/12/2017, published 10/19/2017, with priority to US 62/322,099, filed 4/13/2016, see IDS filed 9/16/2022). is withdrawn in light of Applicant’s amendments of claim 1 to limit the homology arms to 50 or less nucleotides
New Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory obviousness-type double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the conflicting application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement.
Effective January 1, 1994, a registered attorney or agent of record may sign a terminal disclaimer. A terminal disclaimer signed by the assignee must fully comply with 37 CFR 3.73(b).
Claims 1-6, 8-9, 11-13 and 15-16 are rejected on the grounds of nonstatutory double patenting over claim 11-20 of U.S. Patent No. 11,608,499 (Neuteboom et al., Patented 3/21/2023), in view of Potter et al. (WO2016/065364, filed 10/26/2015, published 4/28/2016, see IDS filed 9/16/2022)
The subject matter claimed in the instant application is disclosed in the referenced patent as follows: the method for modification of a target nucleic acid in a cell of cited patent makes obvious the method of instant application. It is clear that elements of the cited patent claims are to be found in instant claims. The difference between the cited patent claims and the instant claims lies in the fact that the instant applications claims are more specific with respect to 1) the modification of the target nucleic acid in the cell is to treat a disease and 2) the homology arms are 50 or less nucleotides. In regard to the first difference, the term “disease” is claimed in instant case with such a high degree of generality, and active method step of “administering” is so broad, instant claims appear to encompasses no more than the obvious in vivo embodiment of the patented method.
In regard to the length of the arms, Potter teaches methods for modifying a genomic target in cells comprising contacting the cell with a composition comprising (a) a recombinant fusion nucleic acid molecule comprising a guide RNA covalently linked to a donor nucleic acid and (b) a Cas9 polypeptide (Example 1, Claims 7-9 of Potter, see Fig. 9).
With respect to the preamble of claim 1, Potter teaches methods for modifying the genomic target in a cell encompass cells comprising mutations associated with a disease phenotype such as cancer [01110], which makes obvious the administration of the composition to repair single nucleotide mutations in cancer cells.
With respect to the donor nucleic acid of claim 1(a), Potter teaches the donor nucleotide is as short as about 50 nt, and that homology arms are as short as 25 nt (see Claims 8 and 9 of Potter). Specifically, Potter provides a working example of a gRNA covalently attached to 80 bp ssDNA oligonucleotide (Example 1), wherein the homology arms of donor DNA for homologous recombination a the HPRT locus are about 27 nucleotides each (see p. 26, line 8 for ssDNA).
According, it would have been obvious to have claimed the method for modification of a target nucleic acid with a donor nucleic acid (doNA) in a cell of cited patent, and choose a doNA comprising homology arms as taught by Potter et al. with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to do so because Potter et al. teach that homology arms improve donor nucleic acid recombination efficiency (Example 1, [0110]).
Furthermore, in regard to claims 11 and 13, Potter teaches that the Cas9 can be a nickase [0006, 0031], which would have been obvious to claim because two CRISPR complexes have to bind the target region [0031], thereby reducing off-target effects.
Since the instant application claims are obvious over cited patent claims in view of Potter, said claims are not patentably distinct.
Claims 17-19 are rejected on the grounds of nonstatutory double patenting over claim 11-20 of U.S. Patent No. 11,608,499 (Neuteboom et al., Patented 3/21/2023), in view of Potter et al. (WO2016/065364, filed 10/26/2015, published 4/28/2016, see IDS filed 9/16/2022), as applied to Claim 1, in further view of Zhang et al. (US2016/0208243, filed 12/18/2015, published 7/21/2016)
As stated supra, Neuteboom in view of Potter suggest claiming methods for treating a genetic disease comprising a guide RNA fused to a donor DNA is designed with two homology regions that are equal to or less than 50 nt in length.
However, Neuteboom and Potter are silent to treating the genetic disease of Sickle Cell Anemia.
Zhang teaches treating genetic disease comprising the CRISPR system comprising guide RNAs and donor repair templates. In regard to instant claims, Zhang teaches the guide RNA and HDR template can target the human beta globin (HBB) gene for treating Sickle Cell Anemia [0815-0816, 0869-0870, 1327-1328, 1331, 1353, 1367, 1496]. Specifically, Zhang explains that a SNP cause the change from glutamic acid (GAG) to valine (GTG) to cause the disease, and the HDR template corrects the SNP by providing the proper sequence [1331].
Accordingly, it would have been obvious to claim methods for treating a genetic disease comprising a guide RNA fused to a HDR template as suggested by Potter and choose Sickle Cell Anemia as the genetic disease as taught by Zhang with a reasonable expectation of success. One of ordinary skill would have been motivated to do so as taught by Zhang because Sickle Cell Anemia is a clinically relevant diseases that causes serious damage to the bone, spleen, and skin, which can lead to episodes of pain, frequent infections, or even multiple organ failure [1331].
Furthermore, in regard to claim 19, as stated supra Zhang teaches the target site is single nucleotide polymorphism in the HBB gene that causes the Glu to Val mutation. Since, the only “replacement sequence” is the with a wildtype sequence with no intervening nucleotides, the homology arms are directly adjacent to each other. Note that the specification of instant application evidences that when a homology arm is larger than 15 nucleotides it can be as low as 60% complementary to the target nucleic acid (p. 9. 4th para.).
Since the instant application claims are obvious over cited patent claims in further view of Zhang et al., said claims are not patentably distinct.
Provisional nonstatutory double patenting
Claims 1-6, 8-9, 11-13, and 15-16 are provisionally rejected on the grounds of nonstatutory double patenting as being unpatentable over claims 1- 10 of copending Application No. 17/933,005. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented
The subject matter claimed in the instant application is disclosed in the referenced application as follows: the method for modification of a target nucleic acid in a cell of cited application makes obvious the method of instant application. It is clear that elements of the cited application claims are to be found in instant claims. The difference between the cited application claims and the instant claims lies in the fact that the instant applications claims are more specific with respect to the modification of the target nucleic acid in the cell is to treat a disease. However, the term “disease” is claimed in instant case with such a high degree of generality, and active method step of “administering” is so broad, instant claims appear to encompasses no more than the obvious in vivo embodiment of the cited method.
Since the instant application claims are obvious over cited application claims, said claims are not patentably distinct.
Claims 17-19 are provisionally rejected on the grounds of nonstatutory double patenting as being unpatentable over claims 1- 10 of copending Application No. 17/933,005, in view of view of Zhang et al. (US2016/0208243, filed 12/18/2015, published 7/21/2016). This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented
The subject matter claimed in the instant application is disclosed in the referenced application as follows: the method for modification of a target nucleic acid in a cell of cited application makes obvious the method of instant application. It is clear that elements of the cited application claims are to be found in instant claims.
The difference between the cited patent claims and the instant Claims 17-19 lies in the fact that the instant applications claims are more specific with respect to the diseases.
Nevertheless, administering a gRNA and site directed nucleic acid modifying polypeptide gene targeting a Sickle cell disease were well known.
Zhang teaches treating genetic disease comprising the CRISPR system comprising guide RNAs and donor repair templates. In regard to instant claims, Zhang teaches the guide RNA and HDR template can target the human beta globin (HBB) gene for treating Sickle Cell Anemia [0815-0816, 0869-0870, 1327-1328, 1331, 1353, 1367, 1496]. Specifically, Zhang explains that a SNP cause the change from glutamic acid (GAG) to valine (GTG) to cause the disease, and the HDR template corrects the SNP by providing the proper sequence [1331].
Accordingly, it would have been obvious to claim methods for treating a genetic disease comprising a guide RNA fused to a HDR template as suggested by Potter and choose Sickle Cell Anemia as the genetic disease as taught by Zhang with a reasonable expectation of success. One of ordinary skill would have been motivated to do so as taught by Zhang because Sickle Cell Anemia is a clinically relevant diseases that causes serious damage to the bone, spleen, and skin, which can lead to episodes of pain, frequent infections, or even multiple organ failure [1331].
Furthermore, in regard to claim 19, as stated supra Zhang teaches the target site is single nucleotide polymorphism in the HBB gene that causes the Glu to Val mutation. Since, the only “replacement sequence” is the with a wildtype sequence with no intervening nucleotides, the homology arms are directly adjacent to each other. Note that Applicant specification evidences that when a homology arm is larger than 15 nucleotides it can be as low as 60% complementary to the target nucleic acid (p. 9. 4th para.).
Since the instant application claims are obvious over cited application claims in view of Zhang said claims are not patentably distinct.
RESPONSE TO ARGUMENTS
Applicant's arguments filed on 3/26/2026 are acknowledged and ask that the double patenting rejections be held in abeyance until allowable subject matter has been identified.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
No claims are allowed.
Examiner Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ARTHUR S LEONARD whose telephone number is (571)270-3073. The examiner can normally be reached on Mon-Fri 9am-5pm.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James Doug Schultz can be reached on 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ARTHUR S LEONARD/Examiner, Art Unit 1631
Prosecution Insights