Prosecution Insights
Last updated: October 04, 2026
Application No. 17/933,369

UNIVERSAL DONOR CELLS

Final Rejection §103§112
Filed
Sep 19, 2022
Priority
Dec 31, 2020 — provisional 63/132,890 +3 more
Examiner
QIAN, CELINE X
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
CRISPR Therapeutics AG
OA Round
2 (Final)
48%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
64%
With Interview

Examiner Intelligence

Grants 48% of resolved cases
48%
Career Allowance Rate
376 granted / 790 resolved
-12.4% vs TC avg
Strong +17% interview lift
Without
With
+16.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
57 currently pending
Career history
836
Total Applications
across all art units

Statute-Specific Performance

§101
7.9%
-32.1% vs TC avg
§103
30.1%
-9.9% vs TC avg
§102
17.9%
-22.1% vs TC avg
§112
35.9%
-4.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 790 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 102-119, 121 and 122 are pending in the application. This office action is in response to the amendment filed on 4/29/2026. All previous rejection not reiterated in this office action are withdrawn. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 102, 103, 105, 107, 118-121 is/are rejected under 35 U.S.C. 103 as being unpatentable over Schreper (WO2020/231882), in view of Ko et al (Xenotransplantation, September-October 2019, Vol.26, No.5. Abstract Number: P.168). This rejection has been rewritten to address the amendment. Schreper teaches a method for generating hypoimmune pluripotent cells (HIP) that evades rejection by the host allogeneic immune system, suitable for allogeneic transplantation (paragraph [0008]). Schreper teaches these cells are engineered to reduce HLA-I and HLA-II expression to avoid initiation of immune response and increase production of CD47 to suppress phagocytic innate immune surveillance, said engineering include reduce HLA-II function by virtue of a reduction in CIITA protein expression or knocking out CIITA gene (paragraph [0020]), reducing HLA-I function by reduction in B2M macroglobulin protein expression or knocking out B2M gene by using CRISPR/Cas9 reaction (paragraph [0019]). Schreper teaches CRISPRs are designed to target the coding sequence of the CIITA gene, and iPSC cells not expressing CIITA are determined by PCR and FACS analysis (paragraph [0138]). Schreper teaches such cells are further modified to increase CD47 expression by knock in CD47 transgene into said cells through CRISPR technique (paragraph [00140], [00142]). Schreper teaches HIP cells may be further modified by introduction of CD39 transgene (paragraph [00147], line 7). Schreper teaches a first gRNA targeting CIITA gene with Cas9 were introduced into iPSC cell (paragraph 0216]). Schreper teaches the cell is iPSC cell from human (page 46, paragraph [00210]). The only difference is that Schreper does not teach introducing CD39 transgene into the CIITA locus. Ko teaches a method of modify porcine ear skin fibroblasts by simultaneous knock out GT and insertion of CD55 and CD39 into GGTA1 locus using CRISPR/Cas9, wherein the resultant cell does not express alpha-gal epitope of expressed human CD55 and CD39 (see result section of the abstract). Ko teaches that such co-transfection method of GTKO/CD55/CD39 knock in vector and CRISPR/Cas9 for GGTA increased efficiency of homologous recombination, and transgenic pig revealed improvement in immunological rejection against human complement, and could prolong survival of xenograft (conclusion section). It would have been obvious to an ordinary skilled in the art reading Ko to recognize the advantage of the method of co-transfection, increase efficiency of homologous recombination and survival of the transplanted cell. The ordinary skilled in the art reading Schreper would thus be motivated to using said strategy in generating CTIIA knockout cells and expresses transgene CD39 for the demonstrated advantage, thus generating modified cells that are hypoimmunogenic. Therefore, the claimed invention of claim 102, 107 and 119 would have been obvious to an ordinary skilled in the art at the time the application was filed. Regarding claim 103, Schreper teaches the knock in transgene may be using exogenous constitutive or inducible promoter, wherein constitutive promoter is preferred (paragraph 00141]). Regarding claim 105, Ko teaches the knock in vector comprises left and right arm of homology flanking the inserted transgene (see Figure A). Regarding claim 118, both Schreper (page 47, last line) paragraph and Ko (result section) teaches the RNA guided nuclease is a Cas9 nuclease. Regarding claim 121, Schreper teaches the modified cells are differentiated into β cells (page 44, paragraph [0200]). Claim(s) 106 is/are rejected under 35 U.S.C. 103 as being unpatentable over Schreper and Ko, as applied to claim 102 and 105 above, and further in view of the sequence having accession number S73813 ( 4-12-1995, Maliszewski et al, J. Immunol.) and sequence having accession number EF064747 (11-13-2006, Livingston et al). The teaching from Schreper and Ko has been discussed above. However, neither reference teaches CD39 sequence comprising SEQ ID NO: 27 and having homology arm sequence comprising SEQ ID NO: 26 and/or SEQ ID NO: 28. Maliszewski teaches the sequence S73813, which is CD39 mRNA, having 100% sequence identity with SEQ ID NO: 27 (see attached alignment). Livingston et al. teaches sequence EF064747, which encodes CIITA gene, having 100% sequence identity with SEQ ID NO: 26 and SEQ ID NO: 28 (see attached alignment). Since the sequence encoding CD39, and sequence encoding CIITA are known in prior art, it would have been obvious to an ordinary skilled in the art to follow the design of the knock in vector taught by Ko, and integrating CD39 encoded by SEQ ID NO: 27 into the CIITA locus. It would have been routine practice to including homology arms have sequence homology with CIITA locus (SEQ ID NO: 26 and 28) to facilitate homologous recombination at the cleavage site of CIITA locus. Therefore, the claimed invention of claim 106 would have been obvious to an ordinary skilled in the art at the time the application was filed. Claim(s) 108 is/are rejected under 35 U.S.C. 103 as being unpatentable over Schreper and Ko, as applied to claim 102 above, and further in view of Banovic (Blood, 9-15-2015, Vol.106, No.6, pages 2206-2214). The teaching from Schreper and Ko has been discussed above. Schreper further teaches that the HIP cells may have additional transgenes introduced into said cell that includes TGFβ (paragraph [00147]). However, Schreper and Ko does not teach further disrupt TGF-β2 in the modified cell. Banovic teaches in allogeneic stem cell transplantation (SCT) murine model, TGF-β2 offers a protective effect for acute graft versus host disease (aGVHD) (page 2208, 1st col-2nd col., bridging paragraph, and page 2210, 2nd col., 1st sentence), but subsequent pathologic TGFβ production is responsible for the augmented manifestations of chronic GVHD after SCT (page 2213, 2nd col., lines 21-23). Banovic suggests that therapeutic neutralization of TGFβ late after allogeneic SCT may attenuate the severity of cGVHD while maintaining the beneficial early regulatory effect of TGFβ on aGVHD (page 2213, 2nd col., last paragraph, last sentence). It would have been obvious to an ordinary skilled in the art that TGFβ offer both protective role for aGVHD following SCT and contribute to severity of cGVHD later on, so that the timing of therapeutic TGFβ is very important based on the teaching from Banovic. The ordinary skilled in the art would thus be motivated to disrupt the endogenous TGFβ locus in the HIP cells rendered obvious by combined teaching from Schreper and Ko, and introducing exogenous TGFβ transgene, wherein the expression of which may be controlled by induction and attenuation. Using CRISPR system to disrupt the endogenous TGF locus would have been obvious to an ordinary skilled in the art because Shreper has demonstrated disrupting two different genes CIITA and B2M using said method. Therefore, the claimed invention of claim 108 would have been prima facie obvious to an ordinary skilled in the art at the time the application was made. Claim(s) 109 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shreper, Ko and Banovic, as applied to claims 102 and 108 above, and further in view of sequence having accession number BC096235 (10-4-2006, Strausberg et al). The teaching from Shreper, Ko and Banovic has been discussed above. However, none the reference teaches the specific sequence of the target site within TGFβ2 comprises SEQ ID NO: 57. The sequence having accession number BC096235 encodes complete sequence of mRNA of TGFβ2 and comprises the sequence 100% identical to SEQ ID NO: 57 (see alignment). It would have been obvious to an ordinary skilled in the art to target the sequence TGFβ2 comprises SEQ ID NO: 57 because finding a proper target site within a gene of known sequence would have been routine practice in the art at the time the application was filed. SEQ ID NO: 57 comprises GTTCATGCGCAAGAGGATCT, which has a required PAM sequence for Cas9/gRNA binding. Therefore, selecting said sequence as target site would have been prima facie obvious to an ordinary skilled in the art at the time the application was filed. Claim(s) 104 and 110 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shreper and Ko, as applied to claim 102 above, and further in view of Zammit et al (Xenotransplantation. 2021; 28:e12669, First published 12-14-2020). The teaching from Shreper and Ko has been discussed above. However, neither reference teaches a further modification with TNFAIP3 inserted into a disrupted B2M gene. Zammit et al. teaches a contra-indication to utilizing islets from porcine donors clinically is the robust anti-graft immune response triggered against the xenogenic islet, which imposes a significant clinical challenge (page 2, 1st col., last paragraph). Zammit et al. teach that forced expression of A20 in mouse model, which is encoded by TNFAIP3 gene, can reduce the size of the islet graft mass needed to achieve metabolic control and promote allograft tolerance (page 2, 2nd col., 1st paragraph). Zammit et al. demonstrates that forced expression of A20 via recombinant adenovirus dampens neonatal porcine islet (NPI) inflammation by suppressing islet inflammatory mRNAs Cxcl10, Icam1, II1b and II6 and did not impact NPI insulin response to glucose (page 5, 2nd col). Zammit et al. also demonstrate forced expression of exogenous expression of TNFAIP3 improves the function of NPIs post transplantation in a mouse model (page 6, 1st col., 2nd paragraph). It would have been obvious to an ordinary skilled in the art when generating the HIP cells rendered obvious by Shreper and Ko by knocking out B2M and CIITA genes, to further introducing cytoprotective genes including TNFAIP3 to the stem cell to reduce post transplantation immune rejection as demonstrated by Zammit. The ordinary skilled in the art would use the strategy taught by Ko to simultaneously knockout B2M and inserting TNFAIP3 to the disrupted target site using CRISPR/Cas9 system to reduce the steps required for such multiple genetic modification. The ordinary skilled in the art would have reasonable expectation of success to introducing modification as claimed following combined teaching from Shreper, Ko and Zammit. Therefore, the claimed invention of claim 110 would have been prima facie obvious to an ordinary skilled in the art at the time the application was filed. Regarding claim 104, neither Shreper nor Ko teaches the inserted CD39 is operably linked to an exogenous promoter such as CMV. Zammit teaches the expression vector expressing TNFAIP3 is operably linked to CMV promoter (page 5, 2nd col., 1st paragraph, line 9). It would have been obvious to an ordinary skilled in the art to choose suitable promoter when expressing CD39 in the HIP cells based on combined teaching from Shreper and Ko. Since the teaching from Shreper indicates constitutive promoter is preferred, it would have been obvious to choose a constitutive promoter such as CMV because it is commonly used in the art for direct strong expression of a heterologous gene as demonstrated by Zammit. Therefore, the claimed invention of claim 104 would have been prima facie obvious to an ordinary skilled in the art at the time the application was filed. Claim(s) 111-114 and 116 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shreper, Ko and Zammit, as applied to claims 102 and 110 above, and further in view of Han et al (IDS). The teaching from Shreper, Ko and Zammit has been discussed above. However, neither reference teaches a disrupted B2M gene with inserted TNFAIP and PD-L1. Han teaches a method of generating hypoimmunogenic human pluripotent stem cell by expressing exogenous immunomodulatory factors PD-L1, HLA-G and CD47, as well as knockout endogenous HLA class Ia members and CIITA in hPSCs (page 10441, 2nd col., 2nd paragraph). Han teaches the resultant cells elicited significantly less immune activation and killings by T cells and NK cells and displayed minimal engulfment by macrophages (10444, 2nd col., 1st paragraph of discussion section). Han teaches the significance of the study is that the strategy of modifying multiple genes demonstrates the power of cell engineering and informs future studies aiming to generate universal cell products that may make cell therapy available to a larger pool of patients (page 10441, significance section). It would have been obvious to an ordinary skilled in the art to recognize the advantage of introducing multiple modification to the HIP cell to achieve immunotolerance for cell therapy based on combined teaching from Shreper, Ko, Zimmat and Han. The ordinary skilled in the art would be motivated to modify the HIP rendered obvious by Shreper and Ko further to include TNFAIP3 and PD-L1 insertion to disrupted B2M site because Zimmat and Han demonstrated further reduced immunogenicity when TNFAIP3 and PD-L1 are expressed in stem cells. The ordinary skilled in the art would have reasonable expectation of success to perform multiplex modification at claimed sites following combined teaching from Shreper, Ko, Zimmat and Han. Therefore, the claimed invention of claim 111 and 112 would have been prima facie obvious at the time the application was filed. Regarding claims 113, 114 and 116, the limitations in claim 113 and 114 further limits 112 (a), which is recited in alternative to 112(b). Claims 113, 114 and 116 are interpreted as reciting the limitation in 112 (b). Therefore, the claimed invention would have been obvious to an ordinary skilled in the art at the time the application was filed for same reason as applied to claim 112 set forth above. Response to Arguments In response to the rejection, Applicant argues that Schreper only discloses CD39 in paragraph [0147]), and the description and working example from Schreper provide a great deal of disclosure regarding expression of exogenous CD47, which is introduced into cells by lentivirus transformation, and in the background of cells comprising B2M and CIITA null mutations. Applicant alleges that Schreper does not provide any reason to choose CD39 from the list of possible transgene provided, or to replace the CD47 of Schreper with CD39 transgene into the CIITA locus. Applicant argues that it is unclear regarding co-transfection and increased efficiency is relative to. Applicant alleges that there is no reason to combine Schreper with Ko based on the teaching from Ko, and no reasonable expectation of success. Applicant asserts that Ko provides teaching related to modification of pig cells for transplantation into human, and address the specific challenges of rejection of pig cells in humans. Applicant states that CD39 and CD55 are knocked into the pig alpha gal gene (GGTA1) to ablate alpha-gal and introduce CD39 and CD55 genes. Applicant argues that amendment to claim 102 now recites the stem cell is a human stem cell, which is not contemplated by Ko. Applicant alleges that there would not be any reason to combine Schreper with Ko and adapt methods for pig cell transplantation to arrive at the presently recited method for genetically modifying human cells because alpha-gal epitope in pig is the most severe hurdle, whereas a POSITA would not have a reason to replace knockout GGTA1 or Ko with CIITA of Schreper because such modification would render the method taught by Ko inoperable. The above argument has been fully considered but deemed unpersuasive. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, the teaching from Schreper is not limited to the working examples, the totality of the teaching of this reference clearly encompasses the teaching from paragraph [0147], which is directed to generating hypoimmunogenic cells generated by the introduction of one or more transgenes including CD39, or agonist of CD39, in a stem cell background that eliminated the expression of CIITA and/or B2M (paragraph [00146]). The ordinary skilled in the art would recognize that activation of CD39 is beneficial for hypoimmunogenicity in said background based on such teaching. The “hypoimmunogenic stem cell” taught by Schreper is for cell transplant (see paragraph [0002]), wherein allogenic rejection is the problem to be solved (paragraph [0003]). Although Ko teaches cell transplantation from pig cells, the function of CD39 and CD55 are already known in the art, “human CD55, a decay accelerating factor is one of the complement regulatory protein which has a role of inactivation for complement cascade by blocking cleavage of C2 to C2b… CD39 is one of regulatory genes for thrombosis that can inhibit platelet aggregation.” (page 68, 2nd col., 1st paragraph). Ko has demonstrated that insertional co-transfection of CD39 and CD55 to CRISPR for GTKO increased efficiency of homologous recombination (page 69, 1st col., last paragraph). An ordinary skilled in the art would thus be motivated to insert CD39 in the CIITA KO background in human cells based on the combined teaching from Schreper and Ko. Claim(s) 115 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shreper, Ko, Zammit and Han et al (IDS) as applied to claim 102, 111, 112 above, in further view of Kwon (IDS). This is a new ground of rejection necessitated by amendment. The teaching from Shreper, Ko, Zammit and Han has been discussed above. However, none of the reference teaches the polynucleotide encoding TNFAIP3 and PD-L1 comprises a nucleotide sequence encoding a P2A peptide between the coding sequence of TNFAIP3 and the coding sequence of PD-L1. Kwon teaches it is within the skill of the art to knockout a single gene and insert more than one expression cassette containing different human genes that encode proteins connected by a 2A peptide cleavage sequence to release individual proteins from a single translational product (e.g. paragraph bridging pages 153-153). Kwon teaches a 2A cleavage sequence that is P2A (e.g. page 155, paragraph bridging columns). It would have been obvious to an ordinary skilled in the art to insert more than one expression cassette that encoding PD-L1 and TNFAIP3 into B2M locus based on combined teaching from Shreper, Ko, Zammit and Han. Since Kwon demonstrated multiple genes linked by P2A between coding sequences may be inserted into one knockout locus and efficiently expressing the transgene product, the ordinary skilled in the art would be motivated to link PD-L1 and TNFAIP3 and inserting them into B2M locus to generate an hypoimmunogenic stem cell. Therefore, the claimed invention of claim 115 would have been prima facie obvious to an ordinary skilled in the art at the time the application was filed. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 112 and 117 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 112 now depends on claim 111, however, it recites the same limitation as claim 111. Therefore, claim 112 does not further limit claim 111. Claim 117 depends on claim 112, which recites that the expression of TXNIP and/or B2M gene in the genetically modified cell is reduced or eliminated. Claim 112 already recites that TXNIP and/or B2M are disrupted and having insertion of heterologous gene in said locus. As such, claim 117 does not further limit the genetically modified human stem cell generated by the claimed method. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. This is a new ground of rejection necessitated by amendment. Allowable Subject Matter Claim 122 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CELINE X QIAN whose telephone number is (571)272-0777. The examiner can normally be reached M-F (8-4:00). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CELINE X QIAN/ Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Sep 19, 2022
Application Filed
Oct 31, 2025
Non-Final Rejection mailed — §103, §112
Apr 29, 2026
Response Filed
Jul 09, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12721886
Virus-like particles containing CST1 protein and toxoplasma vaccine using same
3y 9m to grant Granted Sep 01, 2026
Patent 12715906
SINGLE CHAIN VH AND HEAVY CHAIN ANTIBODIES
4y 2m to grant Granted Aug 25, 2026
Patent 12685775
OLIGONUCLEOTIDES WITH NUCLEOSIDE ANALOGS
4y 3m to grant Granted Jul 21, 2026
Patent 12649699
PHOSPHATE SENSING MICROBIAL GENE SWITCH
1y 4m to grant Granted Jun 09, 2026
Patent 12642874
METHODS OF TREATING EYE DISEASES
2y 8m to grant Granted Jun 02, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
48%
Grant Probability
64%
With Interview (+16.9%)
3y 8m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 790 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month