Prosecution Insights
Last updated: April 19, 2026
Application No. 17/933,369

UNIVERSAL DONOR CELLS

Non-Final OA §103§112
Filed
Sep 19, 2022
Examiner
QIAN, CELINE X
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Crispr Therapeutics AG
OA Round
1 (Non-Final)
48%
Grant Probability
Moderate
1-2
OA Rounds
3y 7m
To Grant
64%
With Interview

Examiner Intelligence

Grants 48% of resolved cases
48%
Career Allow Rate
364 granted / 762 resolved
-12.2% vs TC avg
Strong +17% interview lift
Without
With
+16.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
57 currently pending
Career history
819
Total Applications
across all art units

Statute-Specific Performance

§101
6.6%
-33.4% vs TC avg
§103
29.5%
-10.5% vs TC avg
§102
19.2%
-20.8% vs TC avg
§112
34.3%
-5.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 762 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 102-121 are pending in the application. Specification The use of the term “ACCUTASE” “STMFLEX”, “REVITACELL,” which are trade names or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 112-117 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 112, the recitation of “wherein the genetically modified cell comprises (a) a disrupted TXNIP gene; and an insertion of a polynucleotide encoding MANF and HLA-E into the disrupted TXNIP gene; and/or (b) a disrupted B2M gene and an insertion of a polynucleotide encoding TNFAIP3 and PD-L1 into the disrupted B2M gene” renders the claim indefinite because it is unclear how such disruption and insertion occurs as a result of delivering a gRNA targeting CIITA and polynucleotide encoding CD39 inserted into CIITA site. Claim 12 is thus incomplete for omitting essential steps, such omission amounting to a gap between the steps. See MPEP § 2172.01. Dependent claims 113-117 are rejected for same reason because they depend on claim 12 and does not remedy the deficiency of claim 112. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 102, 103, 105, 107, 118-121 is/are rejected under 35 U.S.C. 103 as being unpatentable over Schreper (WO2020/231882), in view of Ko et al (Xenotransplantation, September-October 2019, Vol.26, No.5. Abstract Number: P.168). Schreper teaches a method for generating hypoimmune pluripotent cells (HIP) that evades rejection by the host allogeneic immune system, suitable for allogeneic transplantation (paragraph [0008]). Schreper teaches these cells are engineered to reduce HLA-I and HLA-II expression to avoid initiation of immune response and increase production of CD47 to suppress phagocytic innate immune surveillance, said engineering include reduce HLA-II function by virtue of a reduction in CIITA protein expression or knocking out CIITA gene (paragraph [0020]), reducing HLA-I function by reduction in B2M macroglobulin protein expression or knocking out B2M gene by using CRISPR/Cas9 reaction (paragraph [0019]). Schreper teaches CRISPRs are designed to target the coding sequence of the CIITA gene, and iPSC cells not expressing CIITA are determined by PCR and FACS analysis (paragraph [0138]). Schreper teaches such cells are further modified to increase CD47 expression by knock in CD47 transgene into said cells through CRISPR technique (paragraph [00140], [00142]). Schreper teaches HIP cells may be further modified by introduction of CD39 transgene (paragraph [00147], line 7). Schreper teaches a first gRNA targeting CIITA gene with Cas9 were introduced into iPSC cell (paragraph 0216]). The only difference is that Schreper does not teach introducing CD39 transgene into the CIITA locus. Ko teaches a method of modify porcine ear skin fibroblasts by simultaneous knock out GT and insertion of CD55 and CD39 into GGTA1 locus using CRISPR/Cas9, wherein the resultant cell does not express alpha-gal epitope of expressed human CD55 and CD39 (see result section of the abstract). Ko teaches that such co-transfection method of GTKO/CD55/CD39 knock in vector and CRISPR/Cas9 for GGTA increased efficiency of homologous recombination, and transgenic pig revealed improvement in immunological rejection against human complement, and could prolong survival of xenograft (conclusion section). It would have been obvious to an ordinary skilled in the art reading Ko to recognize the advantage of the method of co-transfection, increase efficiency of homologous recombination and survival of the transplanted cell. The ordinary skilled in the art reading Schreper would thus be motivated to using said strategy in generating CTIIA knockout cells and expresses transgene CD39 for the demonstrated advantage, thus generating modified cells that are hypoimmunogenic. Therefore, the claimed invention of claim 102 and 107 would have been obvious to an ordinary skilled in the art at the time the application was filed. Regarding claim 103, Schreper teaches the knock in transgene may be using exogenous constitutive or inducible promoter, wherein constitutive promoter is preferred (paragraph 00141]). Regarding claim 105, Ko teaches the knock in vector comprises left and right arm of homology flanking the inserted transgene (see Figure A). Regarding claim 118-120, both Schreper (page 47, last line) paragraph and Ko (result section) teaches the RNA guided nuclease is a Cas9 nuclease (118), and Schreper teaches the cell is iPSC cell from human (119 and 120) (page 46, paragraph [00210]). Regarding claim 121, Schreper teaches the modified cells are differentiated into β cells (page 44, paragraph [0200]). Claim(s) 106 is/are rejected under 35 U.S.C. 103 as being unpatentable over Schreper and Ko, as applied to claim 102 and 105 above, and further in view of the sequence having accession number S73813 ( 4-12-1995, Maliszewski et al, J. Immunol.) and sequence having accession number EF064747 (11-13-2006, Livingston et al). The teaching from Schreper and Ko has been discussed above. However, neither reference teaches CD39 sequence comprising SEQ ID NO: 27 and having homology arm sequence comprising SEQ ID NO: 26 and/or SEQ ID NO: 28. Maliszewski teaches the sequence S73813, which is CD39 mRNA, having 100% sequence identity with SEQ ID NO: 27 (see attached alignment). Livingston et al. teaches sequence EF064747, which encodes CIITA gene, having 100% sequence identity with SEQ ID NO: 26 and SEQ ID NO: 28 (see attached alignment). Since the sequence encoding CD39, and sequence encoding CIITA are known in prior art, it would have been obvious to an ordinary skilled in the art to follow the design of the knock in vector taught by Ko, and integrating CD39 encoded by SEQ ID NO: 27 into the CIITA locus. It would have been routine practice to including homology arms have sequence homology with CIITA locus (SEQ ID NO: 26 and 28) to facilitate homologous recombination at the cleavage site of CIITA locus. Therefore, the claimed invention of claim 106 would have been obvious to an ordinary skilled in the art at the time the application was filed. Claim(s) 108 is/are rejected under 35 U.S.C. 103 as being unpatentable over Schreper and Ko, as applied to claim 102 above, and further in view of Banovic (Blood, 9-15-2015, Vol.106, No.6, pages 2206-2214). The teaching from Schreper and Ko has been discussed above. Schreper further teaches that the HIP cells may have additional transgenes introduced into said cell that includes TGFβ (paragraph [00147]). However, Schreper and Ko does not teach further disrupt TGF-β2 in the modified cell. Banovic teaches in allogeneic stem cell transplantation (SCT) murine model, TGF-β2 offers a protective effect for acute graft versus host disease (aGVHD) (page 2208, 1st col-2nd col., bridging paragraph, and page 2210, 2nd col., 1st sentence), but subsequent pathologic TGFβ production is responsible for the augmented manifestations of chronic GVHD after SCT (page 2213, 2nd col., lines 21-23). Banovic suggests that therapeutic neutralization of TGFβ late after allogeneic SCT may attenuate the severity of cGVHD while maintaining the beneficial early regulatory effect of TGFβ on aGVHD (page 2213, 2nd col., last paragraph, last sentence). It would have been obvious to an ordinary skilled in the art that TGFβ offer both protective role for aGVHD following SCT and contribute to severity of cGVHD later on, so that the timing of therapeutic TGFβ is very important based on the teaching from Banovic. The ordinary skilled in the art would thus be motivated to disrupt the endogenous TGFβ locus in the HIP cells rendered obvious by combined teaching from Schrefer and Ko, and introducing exogenous TGFβ transgene, wherein the expression of which may be controlled by induction and attenuation. Using CRISPR system to disrupt the endogenous TGF locus would have been obvious to an ordinary skilled in the art because Shreper has demonstrated disrupting two different genes CIITA and B2M using said method. Therefore, the claimed invention of claim 108 would have been prima facie obvious to an ordinary skilled in the art at the time the application was made. Claim(s) 109 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shreper, Ko and Banovic, as applied to claims 102 and 108 above, and further in view of sequence having accession number BC096235 (10-4-2006, Strausberg et al). The teaching from Shreper, Ko and Banovic has been discussed above. However, none the reference teaches the specific sequence of the target site within TGFβ2 comprises SEQ ID NO: 57. The sequence having accession number BC096235 encodes complete sequence of mRNA of TGFβ2 and comprises the sequence 100% identical to SEQ ID NO: 57 (see alignment). It would have been obvious to an ordinary skilled in the art to target the sequence TGFβ2 comprises SEQ ID NO: 57 because finding a proper target site within a gene of known sequence would have been routine practice in the art at the time the application was filed. SEQ ID NO: 57 comprises GTTCATGCGCAAGAGGATCT, which has a required PAM sequence for Cas9/gRNA binding. Therefore, selecting said sequence as target site would have been prima facie obvious to an ordinary skilled in the art at the time the application was filed. Claim(s) 104 and 110 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shreper and Ko, as applied to claim 102 above, and further in view of Zammit et al (Xenotransplantation. 2021; 28:e12669, First published 12-14-2020). The teaching from Shreper and Ko has been discussed above. However, neither reference teaches a further modification with TNFAIP3 inserted into a disrupted B2M gene. Zammit et al. teaches a contra-indication to utilizing islets from porcine donors clinically is the robust anti-graft immune response triggered against the xenogenic islet, which imposes a significant clinical challenge (page 2, 1st col., last paragraph). Zammit et al. teach that forced expression of A20 in mouse model, which is encoded by TNFAIP3 gene, can reduce the size of the islet graft mass needed to achieve metabolic control and promote allograft tolerance (page 2, 2nd col., 1st paragraph). Zammit et al. demonstrates that forced expression of A20 via recombinant adenovirus dampens neonatal porcine islet (NPI) inflammation by suppressing islet inflammatory mRNAs Cxcl10, Icam1, II1b and II6 and did not impact NPI insulin response to glucose (page 5, 2nd col). Zammit et al. also demonstrate forced expression of exogenous expression of TNFAIP3 improves the function of NPIs post transplantation in a mouse model (page 6, 1st col., 2nd paragraph). It would have been obvious to an ordinary skilled in the art when generating the HIP cells rendered obvious by Shreper and Ko by knocking out B2M and CIITA genes, to further introducing cytoprotective genes including TNFAIP3 to the stem cell to reduce post transplantation immune rejection as demonstrated by Zammit. The ordinary skilled in the art would use the strategy taught by Ko to simultaneously knockout B2M and inserting TNFAIP3 to the disrupted target site using CRISPR/Cas9 system to reduce the steps required for such multiple genetic modification. The ordinary skilled in the art would have reasonable expectation of success to introducing modification as claimed following combined teaching from Shreper, Ko and Zammit. Therefore, the claimed invention of claim 110 would have been prima facie obvious to an ordinary skilled in the art at the time the application was filed. Regarding claim 104, neither Shreper nor Ko teaches the inserted CD39 is operably linked to an exogenous promoter such as CMV. Zammit teaches the expression vector expressing TNFAIP3 is operably linked to CMV promoter (page 5, 2nd col., 1st paragraph, line 9). It would have been obvious to an ordinary skilled in the art to choose suitable promoter when expressing CD39 in the HIP cells based on combined teaching from Shreper and Ko. Since the teaching from Shreper indicates constitutive promoter is preferred, it would have been obvious to choose a constitutive promoter such as CMV because it is commonly used in the art for direct strong expression of a heterologous gene as demonstrated by Zammit. Therefore, the claimed invention of claim 104 would have been prima facie obvious to an ordinary skilled in the art at the time the application was filed. Claim(s) 111 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shreper, Ko and Zammit, as applied to claims 102 and 110 above, and further in view of Han et al (IDS). The teaching from Shreper, Ko and Zammit has been discussed above. However, neither reference teaches a disrupted B2M gene with inserted TNFAIP and PD-L1. Han teaches a method of generating hypoimmunogenic human pluripotent stem cell by expressing exogenous immunomodulatory factors PD-L1, HLA-G and CD47, as well as knockout endogenous HLA class Ia members and CIITA in hPSCs (page 10441, 2nd col., 2nd paragraph). Han teaches the resultant cells elicited significantly less immune activation and killings by T cells and NK cells and displayed minimal engulfment by macrophages (10444, 2nd col., 1st paragraph of discussion section). Han teaches the significance of the study is that the strategy of modifying multiple genes demonstrates the power of cell engineering and informs future studies aiming to generate universal cell products that may make cell therapy available to a larger pool of patients (page 10441, significance section). It would have been obvious to an ordinary skilled in the art to recognize the advantage of introducing multiple modification to the HIP cell to achieve immunotolerance for cell therapy based on combined teaching from Shreper, Ko, Zimmat and Han. The ordinary skilled in the art would be motivated to modify the HIP rendered obvious by Shreper and Ko further to include TNFAIP3 and PD-L1 insertion to disrupted B2M site because Zimmat and Han demonstrated further reduced immunogenicity when TNFAIP3 and PD-L1 are expressed in stem cells. The ordinary skilled in the art would have reasonable expectation of success to perform multiplex modification at claimed sites following combined teaching from Shreper, Ko, Zimmat and Han. Therefore, the claimed invention of claim 111 would have been prima facie obvious at the time the application was filed. No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CELINE X QIAN whose telephone number is (571)272-0777. The examiner can normally be reached M-F (8-4:00). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CELINE X QIAN/ Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Sep 19, 2022
Application Filed
Oct 29, 2025
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584905
METHOD FOR IDENTIFYING MOLECULAR MARKERS OF CHILDREN'S SKIN
2y 5m to grant Granted Mar 24, 2026
Patent 12577561
ANTISENSE OLIGOMERS FOR TREATMENT OF CONDITIONS AND DISEASES
2y 5m to grant Granted Mar 17, 2026
Patent 12570972
METHODS AND COMPOSITIONS FOR PRIME EDITING NUCLEOTIDE SEQUENCES
2y 5m to grant Granted Mar 10, 2026
Patent 12566177
ANTIGEN AND ANTIBODIES PREPARED BASED ON PADI4 SERVING AS TUMOR MARKER, AND APPLICATION THEREOF
2y 5m to grant Granted Mar 03, 2026
Patent 12565667
CHO INTEGRATION SITES AND USES THEREOF
2y 5m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
48%
Grant Probability
64%
With Interview (+16.6%)
3y 7m
Median Time to Grant
Low
PTA Risk
Based on 762 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month