DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
Applicant’s submission filed 19 February 2026 has been entered. Claims 1, 4, 6-8, 11-14, 17, 19, 21-22, 24-25, 27-29, and 34-48 are pending. Claims 1, 4, 6-8, 11-14, 17, 19, 21-22, 24-25, and 27-29 have been amended, while claims 2-3, 5, 9-10, 15-16, 18, 20, 23, 26, and 30-33 have been cancelled without prejudice or disclaimer and claims 34-48 have been newly added. Therefore, prosecution on the merits continues for claims 1, 4, 6-8, 11-14, 17, 19, 21-22, 24-25, 27-29, and 34-48 as being drawn to the elected invention and species. All arguments have been fully considered with the status of each prior ground of rejection set forth below.
Status of Prior Rejections/Response to Arguments
RE: Objection to claims 6, 12, and 21
Applicant’s amendments to each of instant claims 6, 12, and 21 correct the minor informalities of each claim, thus obviating the objections of record.
Therefore, the objections are withdrawn.
RE: Rejection of claims 9, 12-14, and 24 under 35 USC 112(b)
The cancellation of claim 9 renders the rejection moot for that claim. For the remaining claims, Applicant’s amendments to instant claims 12-14 and 24 obviate the rejections of record.
Therefore, the rejections are withdrawn.
RE: Rejection of claim 3 under 35 USC 112(d)
The cancellation of instant claim 3 renders the rejection of record moot for that claim.
Therefore, the rejection is withdrawn.
RE: Rejection of claims 1, 3-7, 9, 11-13, and 26-33 under 35 USC 102(a)(1) and 35 USC 102(a)(2) over Chen et al
The cancellation of claims 3, 5, 9, 26 and 30-33 renders the rejection moot for those claims. For the remaining claims, Applicant has amended independent claim 1 to require, in part, the modified immune cell to be a modified T cell, wherein the modified T cell is now limited to comprise an insertion and/or deletion in at least three endogenous genes encoding: CD3ε; an HLA class I molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, and NLRC5; an HLA class II molecule selected from the group consisting of CIITA, HLA-DM, RFX5, RFXANK, RFXAP, and Ii Chain; and wherein expression of an endogenous TCR on the surface of the modified T cell is reduced as compared to a T cell without the three insertions and/or deletions. With that, Applicant’s arguments filed 19 February 2026 have been fully considered but they are not persuasive.
Applicant has traversed the rejection, asserting in Pages 26-27 of the Remarks filed 19 February 2026 that Chen et al do not reduce to practice or exemplify the triple editing of endogenous CD3ε, B2M, and CIITA genes within CAR-T cells, as there are no working examples of the editing of CD3ε in combination with any other genes. In response, the Examiner respectfully submits that working examples are not required for a prior art reference to show a “reduction to practice” of a claimed product, so long as one skilled in the art will be able to practice it without an undue amount of experimentation. See MPEP § 2121(III) and 2164.02. More specifically, a “reduction to practice” may be an actual reduction to practice or a constructive reduction to practice. In these terms, an actual reduction to practice equates to the working examples of the prior art, while a constructive reduction to practice equates to an enabled disclosure within the prior art reference. See MPEP § 2138.05. In the instant case, Chen et al constructively disclose a CAR-T cell that has a reduced or eliminated expression of CD3ε, B2M, and CIITA via the introduction of indels within each endogenous gene. See, for example, Paragraphs [0570] and [1224] of Chen et al. As the prior art reference of Chen et al is enabled, this therefore anticipates the modified T cell of the instant claims. See MPEP § 2121 and 2152.02(b).
Applicant has further traversed the rejection, asserting in Page 27 of the Remarks filed 19 February 2026 that Chen et al fail to disclose TAP1, TAP2, TAPBP, and NLRC5 as potential targeted HLA class I molecules, as well as HLA-DM, RFX5, RFXANK, RFXAP, and Ii Chain as potential targeted HLA class II molecules. In response, the Examiner respectfully submits that Chen et al disclose the targeting of B2M and CIITA, which are the elected species of HLA class I and class II molecules, and recited in the claims. Accordingly the disclosure of Chen is not required to disclose the alternative HLA class I and class II molecules listed the claim in order to anticipate the claim. However, it is of note that Chen et al do disclose the targeting of NLRC5, HLA-DM, RFX5, RFXANK, and RFXAP. See, for example, Paragraphs [0005], [0263] of Chen et al.
Therefore, the rejection is maintained and amended to encompass the claims as currently written.
RE: Rejection of claims 1, 3-7, 9, 11-13, 17-21, and 23-33 under 35 USC 103 over Chen et al
The cancellation of claims 3, 5, 9, 18, 20, 23, 26 and 30-33 renders the rejection moot for those claims. For the remaining claims, Applicant has amended independent claims 1 and 17 to require, in part, the modified immune cell to be a modified T cell, wherein the modified T cell is now limited to comprise an insertion and/or deletion in at least three endogenous genes encoding: CD3ε; an HLA class I molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, and NLRC5; and an HLA class II molecule selected from the group consisting of CIITA, HLA-DM, RFX5, RFXANK, RFXAP, and Ii Chain. With that, Applicant’s arguments filed 19 February 2026 have been fully considered but they are not persuasive.
Applicant has traversed the rejection, asserting in Pages 28-30 of the Remarks filed 19 February 2026 that the substitution of TRAC with CD3ε, as asserted in the rejection of record over Chen et al, does not yield predictable results, and are thereby not functionally comparable. More specifically, Applicant has asserted that anti-PSMA CAR-T cells having a complete knockout of CD3ε had an improved expansion, higher transduction efficiency, and enhanced killing capacity when compared to anti-PSMA CAR-T cells having a complete knockout of TRAC. Applicant cites Figures 3-5 and Examples 5-7 of the instant disclosure to support these assertions. In response, the Examiner is respectfully not convinced of error. Initially, it is noted that the functions allegedly associated with T cells comprising a deletion of endogenous CD3ε of Examples 5-7 are not required by, nor recited in, the pending claims. Although the claims are interpreted in light of the Specification, limitations from the Specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Thus, the cells of Chen et al need not anticipate or render obvious the same functions. As noted in the rejection of record, Chen et al explicitly disclose deletions in the T cell can be targeted to TRAC or CD3ε genes at Paragraphs [0133], [0287] and [0294]:
Paragraph [0133] - “In embodiments, the first gRNA molecule includes a targeting domain complementary with a target sequence of TRAC, TRBC1, TRBC2, CD247, CD3D, CD3E, or CD3G”,
Paragraph [0287] - “An indel at or near a sequence of a gene encoding a component of a TCR (e.g., TRAC, TRBC1 TRBC2, CD3E, CD3D or CD3G, e.g. TRAC)”, and
Paragraph [0294] - “exhibits reduced or eliminated expression and/or function of one or more of: i) a component of a TCR (e.g., TRAC, TRBC1 TRBC2, CD3D, CD3E or CD3G, e.g. TRAC).”
Therefore, the disclosure of Chen et al establishes the “functional equivalence” required to establish a prima facie case of obviousness over claims as written. See MPEP § 2143.
Furthermore, the Examiner respectfully reminds Applicant that, in submitting evidence asserted to establish unobvious results, there is a burden on Applicant to indicate how the examples asserted to represent the claimed invention are considered to relate to the examples intended to represent the prior art and, particularly, to indicate how those latter examples do represent the closest prior art. The evidence relied upon should also be reasonably commensurate in scope with the subject matter claimed and illustrate the claimed subject matter relative to the prior art subject matter. See MPEP § 2145. It should also be established that the differences in the results are in fact unexpected and unobvious and of both statistical and practical significance. See MPEP § 716.02(b). In the instant case, the Examiner notes that the evidence relied upon is not encompassed by, nor commensurate in scope with, the pending claims. More specifically, the cells produced in the referenced examples are a single-edited T cell comprising a complete knockout of CD3ε, and an anti-PSMA CAR transgene. The pending claims are directed to a triple-edited T cell comprising a mutation that reduces the expression of CD3ε, and an HLA I gene, and an HLA II gene. Also, the claimed mutations result in the “downregulated expression” of the endogenous CD3ε – which is broader than the complete knockout (i.e. no expression) of CD3ε seen in the T cells of the asserted examples. Thus, the T cells relied upon as evidence are not encompassed by, nor are of the same scope, as the pending claims.
In addition, there is no evidence that the functional result(s) seen in the single-edited T cells produced in the referenced examples are comparable or predictable in a triple-edited T cell as claimed. More specifically, the referenced examples do not compare a triple-edited T cell comprising a CD3ε mutation, an HLA I mutation, and an HLA II mutation to a triple-edited T cell comprising a TRAC mutation, an HLA I mutation, and an HLA II mutation. Nor does Applicant provide any such explanation. See MPEP § 2145.
Applicant has further traversed the rejection, asserting in Pages 30-31 of the Remarks filed 19 February 2026 that the ordinary artisan would not have been motivated to select CD3ε as the endogenous gene to reduce expression of the TCR, as Chen et al would lead the ordinary artisan to believe that the targeting of the endogenous TRAC gene is preferred due to the exemplary embodiments. In response, the Examiner respectfully submits there is no requirement wherein the reduced expression of an endogenous TCR is the direct result of the deletion of CD3ε, or the mutations associated with the reduced expression of any of the claimed genes. The claims only require that “expression of an endogenous TCR on the surface of the modified T cell is reduced as compared to a T cell without the three insertions and/or deletions.” As noted in the rejection, modified in response to Applicant’s amendments presented below, Chen et al disclose the surface expression of an endogenous TCR in an engineered T cell is reduced (Paragraphs [1117], [1119]). Thus, Chen et al disclose that the surface expression of an endogenous TCR in an engineered T cell is reduced compared to a T cell that is not edited. It is also of note that the rationale for selecting CD3ε from the disclosure of Chen et al was discussed above.
Therefore, the rejection is maintained and amended to encompass the claims as currently written.
RE: Rejection of claims 1, 3-9, 11-13, and 17-33 under 35 USC 103 over Chen et al in view of Baumgartner et al
The cancellation of claims 3, 5, 9, 18, 20, 23, 26 and 30-33 renders the rejection moot for those claims. For the remaining claims, Applicant’s arguments filed 19 February 2026 have been fully considered but they are not persuasive.
Applicant has traversed the rejection, asserting in Pages 31-32 of the Remarks filed 19 February 2026 that Baumgartner et al fail to teach the triple knockout of CD3ε with an HLA class I molecule and an HLA class II molecule. In response, the Examiner respectfully submits that one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In the instant case, Baumgartner et al was a secondary reference relied upon to teach the CD3ε gRNA sequence as set forth in instant SEQ ID NO: 52.
Applicant has further traversed the rejection, citing the same assertions presented within Pages 28-31 of the Remarks filed 19 February 2026. In response, the Examiner respectfully directs Applicant to the discussion of the 35 USC 103 rejection over Chen et al, where the assertions were addressed.
Therefore, the rejection is maintained and amended to encompass the claims as currently written.
RE: Rejection of claims 1, 3-7, 9, 11-14, 17-21, and 23-33 under 35 USC 103 over Chen et al in view of Pu et al and Quatrini et al
The cancellation of claims 3, 5, 9, 18, 20, 23, 26 and 30-33 renders the rejection moot for those claims. For the remaining claims, Applicant’s arguments filed 19 February 2026 have been fully considered but they are not persuasive.
Applicant has traversed the rejection, asserting in Page 32 of the Remarks filed 19 February 2026 that both Pu et al and Quatrini et al fail to teach the editing of the endogenous CD3ε gene. In response, the Examiner respectfully submits that one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In the instant case, Pu et al and Quatrini et al are secondary references relied upon to teach a PD-1 dominant negative molecule.
Applicant has further traversed the rejection, citing the same assertions presented within Pages 28-31 of the Remarks filed 19 February 2026. In response, the Examiner respectfully directs Applicant to the discussion of the 35 USC 103 rejection over Chen et al, where the assertions were addressed.
Therefore, the rejection is maintained and amended to encompass the claims as currently written.
New/Maintained Grounds of Rejection
Claim Objections
Claim 24 is objected to because of the following informalities:
Regarding claim 24: The instant claim is objected to for reciting “wherein the method comprises introducing the exogenous nucleic acid encoding the CAR” instead of “wherein the method comprises introducing into the population of T cells the exogenous nucleic acid encoding the CAR”, or the like. The Examiner notes that this clarifies the limitation of the method step.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 4, 6-8, 11-14, 28-29, 34-41, and 46-48 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 1, 4, 6-8, 11-14, 28-29, 34-41, and 46-48: Independent claims 1 and 28 each require a modified T cell that comprises, in part, “an insertion and/or deletion in at least three endogenous genes encoding:
(i) CD3ε, wherein the insertion and/or deletion downregulates expression of the endogenous CD3ε gene;
(ii) an HLA class I molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, and NLRC5, wherein the insertion and/or deletion downregulates expression of the endogenous B2M, TAP1, TAP2, TAPBP, or NLRC5 gene;
(iii) an HLA class II molecule selected from the group consisting of CIITA, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii Chain), wherein the insertion and/or deletion downregulates CIITA, HLA-DM, RFX5, RFXANK, RFXAP, or Ii Chain; and…”.
The scope of each claim is indefinite, as it is unclear whether the insertions and/or deletions are required to result from a mutation in the genes within each of (i), (ii), and (iii), or instead can be any three genes selected from the group consisting of (i), (ii), and (iii). More specifically, the claims can be reasonably interpreted as requiring either:
an insertion and/or deletion in at least three endogenous genes selected from the group consisting of (i), (ii) and (iii), the genes encoding: (i), (ii), and (iii);
an insertion and/or deletion in at least three endogenous genes encoding: (i), (ii), and/or (iii); or
an insertion and/or deletion in at least three endogenous genes encoding: (i), (ii), and (iii), wherein the modified T cell comprises one insertion and/or deletion in a gene recited in (i), one insertion and/or deletion recited in (ii), and one insertion and/or deletion in (iii).
Therefore the ordinary artisan cannot readily determine the metes and bounds of each claim, thus rendering the scope of the claims indefinite.
Instant claims 4, 6-8, 11-14, 29, 34-41, and 46-48 are included in the rejection because they depend from a rejected claim and do not correct the deficiencies of the rejected claim
Appropriate correction is required.
For the sake of compact prosecution, the claims will be interpreted as if they require an insertion and/or deletion in at least three endogenous genes encoding: (i), (ii), and (iii), wherein the modified T cell comprises one insertion and/or deletion in a gene recited in (i), one insertion and/or deletion recited in (ii), and one insertion and/or deletion in (iii).
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 4, 6-7, 11-13, 27-29, 36-41, and 46-48 are rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C. 102(a)(2) as being anticipated by Chen et al (US 2018/0362975 A1, of record on IDS filed 09 April 2023).
Chen et al disclose genome editing systems, reagents and methods for immunooncology (Abstract).
As such, Chen et al disclose an T cell – or population of T cells – that has been engineered to comprise indels within an endogenous TCR-associated gene, B2M gene, and CIITA gene, and to further comprise an exogenous nucleic acid encoding a chimeric antigen receptor (CAR) (Paragraphs [0095], [0133], [0279]-[0284], [0287]-[0294], [0319], [0323], [0382], [0475], [0576]). Chen et al further disclose that one of the TCR-associated genes is CD3ε, wherein the expression of the endogenous CD3ε, B2M, and CIITA genes is downregulated within the engineered T cells ([0133], [0279]-[0284], [0287], [0294], [1629]-[1635]). Chen et al further disclose that engineered T cells comprise a reduced surface expression of an endogenous TCR (Paragraphs [1117], [1119]). Thus, Chen et al disclose the expression of an endogenous TCR on the surface of the engineered T cell is reduced as compared to a T cell without the three insertions and/or deletions.
Chen et al further disclose that the indels are result of a CRISPR-Cas9 system and guide RNAs, wherein the guide RNAs target each of the endogenous CD3ε, B2M, and CIITA genes (Paragraphs [0321], [0384], [0472], [0570], [0761]-[0779], [1036]-[1037]).
Chen et al further disclose that the CAR comprises an scFv antigen binding domain, a hinge domain, a transmembrane domain, a costimulatory signaling domain, and a CD3 zeta intracellular signaling domain, wherein the antigen binding domain targets a tumor antigen associated with a solid tumor or hematological malignancy – including PSMA (Paragraphs [0489], [0492]-[0494], [0815]-[0817], [0820], [0823]-[1005], [1007], [1010]). Chen et al further disclose that the intracellular signaling domain is a CD3 zeta intracellular signaling domain with a 4-1BB costimulatory domain (Paragraphs [1016]-[1028], [1086]).
Chen et al further disclose that the population of T cells comprises human T cells (Paragraphs [0094], [0283], [0382]-[0383], [0759]).
With that, Chen et al further disclose a method of treating a subject suffering from prostate cancer, wherein the engineered CAR-T cells having downregulated expression of CD3ε, B2M, and CIITA are comprised within a pharmaceutical composition comprising a pharmaceutically acceptable carrier, and administered to the subject (Paragraphs [0238]-[0239], [0256], [0505], [0533], [0543]-[0544], [0557], [1295], [1298]-[1299], [1393]-[1396], [1406], [1415]-[1428]).
Accordingly, Chen et al anticipate the claims as follows:
Regarding claims 1 and 4: Chen et al disclose a population of T cells that have been engineered to comprise indels within the endogenous CD3ε, B2M, and CIITA genes (claim 4), wherein the expression of the endogenous CD3ε, B2M, and CIITA genes within the T cells is downregulated and results in the reduced surface expression of an endogenous TCR compared to an unmodified cell, and to further comprise an exogenous nucleic acid encoding a CAR. This therefore reads on the modified T cell of instant claim 1.
Regarding claims 6-7: Following the discussion of claim 1, Chen et al further disclose that the indels are result of a CRISPR-Cas9 (claim 7) system and guide RNAs, wherein the guide RNAs target each of the endogenous CD3ε, B2M, and CIITA genes. This therefore reads on the modified T cell of instant claim 6.
Regarding claims 11-12 and 38: Following the discussion of claim 1, Chen et al further disclose that the CAR comprises an scFv antigen binding domain (claim 38), a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain, wherein the antigen binding domain targets a tumor antigen associated with a solid tumor or hematological malignancy (claim 12). This therefore reads on the modified T cell of instant claim 11.
Regarding claim 13: Following the discussion of claim 1, Chen et al further disclose that the engineered CAR-T cell can be further engineered to express a dominant negative mutant or fragment of an NK inhibitory molecule, wherein the NK inhibitory molecule has been modified such that it partially or fully does not comprise an intracellular inhibitory domain (Paragraph [1097]). This therefore reads on the modified T cell of the instant claim.
Regarding claim 27: Following the discussion of claim 1, Chen et al further disclose that the engineered CAR-T cell is comprised within a pharmaceutical composition comprising a pharmaceutically acceptable carrier. This therefore reads on the composition of the instant claim.
Regarding claims 28-29: As aforementioned in the discussion of claim 1, Chen et al disclose a population of T cells that has been engineered to comprise indels within the endogenous CD3ε, B2M, and CIITA genes, wherein the expression of the endogenous CD3ε, B2M, and CIITA genes within the T cells is downregulated, and to further comprise an exogenous nucleic acid encoding a CAR.
Chen et al further disclose a method of treating a subject suffering from prostate cancer (claim 29), wherein the engineered CAR-T cells having downregulated expression of CD3ε, B2M, and CIITA are comprised within a pharmaceutical composition comprising a pharmaceutically acceptable carrier, and administered to the subject. As the subject is capable of eliciting an immune response and the administration of the engineered CAR-T cells activates an immune response (Paragraph [0533], [0828]), this therefore reads on the methods of instant claim 28.
Regarding claims 36-37: Following the discussion of claim 12, Chen et al further disclose that the tumor antigen is PSMA (claim 37). This therefore reads on the modified T cell of instant claim 36.
Regarding claims 39-40: Following the discussion of claim 11, Chen et al further disclose that the intracellular signaling domain is a CD3 zeta intracellular signaling domain (claim 39) with a 4-1BB costimulatory domain (claim 40). This therefore reads on the modified T cell of the instant claims.
Regarding claim 41: Following the discussion of claim 1, Chen et al further disclose that the population of T cells comprises human T cells. This therefore reads on the modified T cell of the instant claim.
Regarding claims 46-48: Following the discussion of claim 28, Chen et al further disclose that the engineered CAR-T cells administered to the subject are allogeneic (claim 46) (Paragraphs [0480]-[0481], [1349]-[1392], [1400], [1451]). As Chen et al further disclose that the allogeneic engineered CAR-T cells reduce or eliminate undesired immunogenicity – including graft-versus-host-disease or host-versus-graft-disease (claim 48) (Paragraphs [0570]-[0577], [0588]) – this therefore reads on the method of instant claim 47.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102
and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 4, 6-7, 11-13, 17, 19, 21-22, 24-25, 27-29, 36-41, and 45-48 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al (US 2018/0362975 A1, of record on IDS filed 09 April 2023).
Chen et al anticipate claims 1, 4, 6-7, 11-13, 27-29, 36-41, and 46-48, the content of which can be observed above and is incorporated herein in its entirety.
Regarding claims 17, 19, and 24: Chen et al disclose a method of preparing T cells, wherein the T cells have (i) been engineered to comprise indels within the endogenous CD3ε, B2M, and CIITA genes such that the expression of the endogenous CD3ε, B2M, and CIITA genes is downregulated; (ii) been engineered to further comprise an exogenous nucleic acid encoding a chimeric antigen receptor (CAR); and (iii) been expanded to generate a population of the cells (Paragraphs [0095], [0133], [0241]-[0247], [0279], [0284], [0287]-[0294], [0319], [0323], [0382], [0475], [0576], [1629], [1634]).
Although Chen et al reduce to practice the triple editing of the endogenous TRAC, B2M, and CIITA genes within CAR-T cells (Paragraphs [1629]-[1635]), as well as the editing of CD3ε within HEK-293 cells (Paragraph [1652]), Chen et al do not reduce to practice or otherwise exemplify the triple editing of the endogenous CD3ε, B2M, and CIITA genes within CAR-T cells, as required by instant claim 17.
Therefore, it would have been prima facie obvious to have modified the method of Chen et al such that the endogenous CD3ε, B2M, and CIITA genes within the CAR-T cells are triple edited, wherein the expression of the endogenous CD3ε, B2M, and CIITA genes is downregulated. One of ordinary skill in the art before the effective filing date of the invention would have recognized that the endogenous TRAC and CD3ε genes are functionally comparable, as they are alternative TCR-associated genes (Paragraphs [0133], [0287], [0294]), and thereby could have been substituted within the editing of the T cells with predictable results. See MPEP § 2143(I)(B).
Consequently, Chen et al render obvious a method of preparing T cells, wherein the T cells have been (i) engineered to comprise indels within the endogenous CD3ε, B2M, and CIITA genes such that the expression of the endogenous CD3ε, B2M, and CIITA genes (claim 19) is downregulated; (ii) engineered to further comprise an exogenous nucleic acid encoding a chimeric antigen receptor (CAR) (claim 24); and (iii) expanded to generate a population of the cells. This therefore renders obvious the method of instant claim 17.
Regarding claims 21-22: Following the discussion of claim 17, Chen et al further disclose that the indels are result of a CRISPR-Cas9 system (claim 22) and guide RNAs, wherein the guide RNAs target each of the endogenous CD3ε, B2M, and CIITA genes (Paragraphs [0321], [0384], [0472], [0570], [0761]-[0779], [1036]-[1037]). This therefore reads on the method of instant claim 21.
Regarding claim 25: Following the discussion of claim 17, Chen et al further disclose that the T cells are isolated from a human apheresis sample (Paragraphs [0132], [0283], [0323], [1044]-[1045], [1069], [1421]). This therefore reads on the method of the instant claim.
Regarding claim 45: Following the discussion of claim 17, Chen et al further disclose that the engineered CAR-T cell can be further engineered to express a dominant negative mutant or fragment of an NK inhibitory molecule, wherein the NK inhibitory molecule has been modified such that it partially or fully does not comprise an intracellular inhibitory domain (Paragraph [1097]). This therefore reads on the method of the instant claim.
Claims 1, 4, 6-8, 11-13, 17, 19, 21-22, 24-25, 27-29, 36-42, and 45-48 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al (US 2018/0362975 A1, of record on IDS filed 09 April 2023) in view of Baumgartner et al (US 2025/0179481 A1, of record).
The discussion of Chen et al regarding claims 1, 6, 17, and 21 can be observed above and is relied upon herein, the content of which is incorporated in its entirety. Chen et al anticipate claims 1, 4, 6-7, 11-13, 27-29, 36-41, and 46-48. Chen et al render obvious claims 1, 4, 6-7, 11-13, 17, 19, 21-22, 24-25, 27-29, 36-41, and 45-48. Baumgartner et al is considered prior art under 35 USC 102(a)(2), with an effective filing date of 1 June 2021.
Regarding claims 8 and 42: Following the discussion of claims 6 and 21 above, Chen et al disclose that the indels are result of a CRISPR-Cas9 system and guide RNAs, wherein the guide RNAs target each of the endogenous CD3ε, B2M, and CIITA genes.
Chen et al do not disclose that the guide RNA targeting CD3ε has a sequence set forth in instant SEQ ID NO: 52, as required by instant claims 8 and 42.
Baumgartner et al, however, disclose CRISPR-Cas9 systems for engineering CAR-T cells, wherein a guide RNA targeting CD3ε has a sequence as set forth in SEQ ID NO: 1795 (Paragraphs [0044], [0101]-[0102], [0107], [0160], [0257], [0266], [0359]-[0360], [0395], [0402], [0404]; Table 8). It is of note that SEQ ID NO: 1795 of Baumgartner et al has 100% identity to instant SEQ ID NO: 52 (see sequence alignment below).
Therefore, it would have been prima facie obvious to have substituted the CD3ε guide RNA of Chen et al with the CD3ε guide RNA of Baumgartner et al, as doing so would have been a simple substitution of one known CD3ε guide RNA sequence for another. See MPEP § 2143(I)(B). One of ordinary skill before the effective filing date of the invention would have recognized that the two guide RNA sequences are functionally comparable, as they both target CD3ε, and thereby would have been able to substitute the sequences with predictable results.
Consequently, Chen et al as modified by Baumgartner et al render obvious a method of preparing a T cell, wherein the guide RNA targeting CD3ε has a sequence set forth in SEQ ID NO: 1795 of Baumgartner et al. As SEQ ID NO: 1795 of Baumgartner et al is identical to instant SEQ ID NO: 52, this therefore renders obvious the modified T cell of instant claim 8 and method of instant claim 42.
Query Match 100.0%; Score 21; Length 21; Matches 21; Gaps 0;
Qy 1 AGATCCAGGATACTGAGGGCA 21 (INSTANT SEQ ID NO: 52)
|||||||||||||||||||||
Db 1 AGATCCAGGATACTGAGGGCA 21 (BAUMGARTNER ET AL SEQ ID NO: 1795)
Claims 1, 4, 6-7, 11-14, 17, 19, 21-22, 24-25, 27-29, 36-41, and 45-48 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al (US 2018/0362975 A1, of record on IDS filed 09 April 2023) in view of Pu et al (US 2020/0299354 A1, of record) and Quatrini et al (Cancers, 2020, of record).
The discussion of Chen et al regarding claims 1 and 13 can be observed above and is relied upon herein, the content of which is incorporated in its entirety. Chen et al anticipate claims 1, 4, 6-7, 11-13, 27-29, 36-41, and 46-48. Chen et al render obvious claims 1, 4, 6-7, 11-13, 17, 19, 21-22, 24-25, 27-29, 36-41, and 45-48. Pu et al is considered prior art under 35 USC 102(a)(1) and 35 USC 102(a)(2). Quatrini et al is considered prior art under 35 USC 102(a)(1).
Regarding claim 14: As aforementioned in the discussion of claim 13, Chen et al disclose that the engineered CAR-T cell can be further engineered to express a dominant negative mutant or fragment of an NK inhibitory molecule, wherein the NK inhibitory molecule has been modified such that it partially or fully does not comprise an intracellular inhibitory domain.
Chen et al further disclose that PD-1 is an inhibitory molecule (Paragraphs [0478], [0581], [1454], [1346]).
Chen et al further disclose that the engineered CAR-T cells are administered to a subject suffering from cancer (Paragraphs [0238]-[0239], [0256], [0533], [0543]-[0544], [0557], [1295], [1298]-[1299], [1393]-[1396], [1406], [1415]-[1428]).
Chen et al do not disclose that the dominant negative molecule is PD-1, VSIG3, VSIG8, or TGFβR, as required by instant claim 14.
Pu et al, however, disclose a modified T cell comprising a CAR and a dominant negative form of PD-1, wherein the dominant negative form of PD-1 lacks a functional PD-1 intracellular domain for PD-1/PD-L1 signal transduction (Abstract; [0004], [0106], [0130], [0132], [0149]-[0150], [0165], [0181]-[0182], [0198], [0201]-[0202]).
With that, Quatrini et al disclose that PD-1 is a known natural killer cell inhibitory molecule (Abstract; Pages 2, 4).
Therefore, it would have been prima facie obvious to have modified the engineered CAR-T cell of Chen et al such that the dominant negative target of an NK inhibitory molecule is PD-1, as detailed in Pu et al and Quatrini et al. One of ordinary skill in the art before the effective filing date of the invention would have been motivated to include the dominant negative PD-1 within the CAR-T cell, as it results in an enhanced cancer treatment and killing functions (Pu et al: Paragraphs [0004], [0130], [0210]), and would have had a reasonable expectation of success since the disclosures of Chen et al and Pu et al are both concerned with the generation of a therapeutic CAR-T cell.
Consequently, Chen et al as modified by Pu et al and Quatrini et al render obvious an engineered CAR-T cell that has been further engineered to express a dominant negative PD-1 molecule. This therefore renders obvious the modified T cell of the instant claim.
Claims 1, 4, 6-7, 11-13, 17, 19, 21-22, 24-25, 27-29, 34-41, and 43-48 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al (US 2018/0362975 A1, of record on IDS filed 09 April 2023) in view of Meissner et al (US 2019/0309259 A1).
The discussion of Chen et al regarding claims 1, 6, 17, and 21 can be observed above and is
relied upon herein, the content of which is incorporated in its entirety. Chen et al anticipate claims 1, 4, 6-7, 11-13, 27-29, 36-41, and 46-48. Chen et al render obvious claims 1, 4, 6-7, 11-13, 17, 19, 21-22, 24-25, 27-29, 36-41, and 45-48. Meissner et al is considered prior art under 35 USC 102(a)(1) and 35 USC 102(a)(2).
Regarding claims 34 and 43: Following the discussion of claims 6 and 21 above, Chen et al disclose that the indels are result of a CRISPR-Cas9 system and guide RNAs, wherein the guide RNAs
target each of the endogenous CD3ε, B2M, and CIITA genes.
Chen et al do not disclose that the guide RNA targeting B2M has a sequence set forth in instant SEQ ID NO: 55, as required by instant claims 34 and 43.
Meissner et al, however, disclose the generation of universal donor cells – which include universal CAR-T cells – via CRISPR-Cas9 systems, wherein a guide RNA targeting B2M has a sequence as set forth in SEQ ID NO: 84082 (Paragraphs [0006], [0008], [0012], [0016]-[0017], [0020]-[0021], [0024]-[0025], [0028]-[0029], [0059], [0063], [0067]-[0069], [0392]; Table 15). It is of note that SEQ ID NO: 84082 of Meissner et al has 100% identity to instant SEQ ID NO: 55 (see sequence alignment below).
Therefore, it would have been prima facie obvious to have substituted the B2M guide RNA of Chen et al with the B2M guide RNA of Meissner et al, as doing so would have been a simple substitution of one known B2M guide RNA sequence for another. See MPEP § 2143(I)(B). One of ordinary skill before the effective filing date of the invention would have recognized that the two guide RNA sequences are functionally comparable, as they both target B2M, and thereby would have been able to substitute the sequences with predictable results.
Consequently, Chen et al as modified by Meissner et al render obvious a method of preparing a T cell, wherein the guide RNA targeting B2M has a sequence set forth in SEQ ID NO: 84082 of Meissner et al. As SEQ ID NO: 84082 of Meissner et al is identical to instant SEQ ID NO: 55, this therefore renders obvious the modified T cell of instant claim 34 and method of instant claim 43.
Query Match 100.0%; Score 20; Length 20; Matches 20; Gaps 0;
Qy 1 TATCTCTTGTACTACACTGA 20 (INSTANT SEQ ID NO: 55)
||||||||||||||||||||
Db 1 TATCTCTTGTACTACACTGA 20 (MEISSNER ET AL SEQ ID NO: 84082)
Regarding claims 35 and 44: Following the discussion of claims 6 and 21 above, Chen et al disclose that the indels are result of a CRISPR-Cas9 system and guide RNAs, wherein the guide RNAs
target each of the endogenous CD3ε, B2M, and CIITA genes.
Chen et al do not disclose that the guide RNA targeting CIITA has a sequence set forth in instant SEQ ID NO: 61, as required by instant claims 35 and 44.
Meissner et al, however, disclose the generation of universal donor cells – which include universal CAR-T cells – via CRISPR-Cas9 systems, wherein a guide RNA targeting CIITA has a sequence as set forth in SEQ ID NO: 36340 (Paragraphs [0006], [0008], [0012], [0016]-[0017], [0019], [0021], [0023], [0025], [0027], [0029], [0059], [0063], [0392]; Table 12). It is of note that SEQ ID NO: 36340 of Meissner et al has 100% identity to instant SEQ ID NO: 55 (see sequence alignment below).
Therefore, it would have been prima facie obvious to have substituted the CIITA guide RNA of Chen et al with the CIITA guide RNA of Meissner et al, as doing so would have been a simple substitution of one known CIITA guide RNA sequence for another. See MPEP § 2143(I)(B). One of ordinary skill before the effective filing date of the invention would have recognized that the two guide RNA sequences are functionally comparable, as they both target CIITA, and thereby would have been able to substitute the sequences with predictable results.
Consequently, Chen et al as modified by Meissner et al render obvious a method of preparing a T cell, wherein the guide RNA targeting CIITA has a sequence set forth in SEQ ID NO: 36340 of Meissner et al. As SEQ ID NO: 36340 of Meissner et al is identical to instant SEQ ID NO: 61, this therefore renders obvious the modified T cell of instant claim 35 and method of instant claim 44.
Query Match 100.0%; Score 20; Length 20; Matches 20; Gaps 0;
Qy 1 CCTTGGGGCTCTGACAGGTA 20 (INSTANT SEQ ID NO: 61)
||||||||||||||||||||
Db 1 CCTTGGGGCTCTGACAGGTA 20 (MEISSNER ET AL SEQ ID NO: 36340)
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALYSSA G WESTON whose telephone number is (571)272-0337. The examiner can normally be reached Monday-Thursday 8AM - 4PM (CT); Friday 8AM - 11AM (CT).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALYSSA G WESTON/Examiner, Art Unit 1633
/CHRISTOPHER M BABIC/Supervisory Patent Examiner, Art Unit 1633