DETAILED ACTION
This action is in reply to papers filed 12/2/2025. Claims 12-25 are pending and examined herein.
Notice of Pre-AIA or AIA Status
The present application is being examined under the pre-AIA first to invent provisions.
Examiner’s Note
All paragraph numbers throughout this office action, unless otherwise noted, are from the US PGPub of this application US20230346844A1, Published 11/2/2023.
Withdrawn Rejection(s)
The nonstatutory double patenting rejections of instant claims over the claims 1-13 of U.S. Patent No. 10155011 is withdrawn in view of Applicant filed and Office accepted terminal disclaimers.
The nonstatutory double patenting rejections of instant claims over the 1-12 of U.S. Patent No. 11439666 is withdrawn in view of Applicant filed and Office accepted terminal disclaimers.
Maintained Rejection(s)
The 103(a) rejection of claims 12, 14-19 and 21-25 as being unpatentable over Ando et al. (US20080159996 A1, Publication Date 7/3/2008) in view of Mineno et al. (US20100273213 A1, Effective Filed Date 6/6/2008), Croce (U.S Patent US5198338 , Publication Date 3/30/1993) and Baer et al. (Mol. Biol. Med. 3 (3), 265-277 (1986)) is maintained. Applicant’s arguments will be addressed following maintained rejection.
The 103(a) rejection of claims 13 and 20 as being unpatentable over Ando et al. (US20080159996 A1, Publication Date 7/3/2008) in view of Mineno et al. (US20100273213 A1, Effective Filed Date 6/6/2008), Croce (U.S Patent US5198338 , Publication Date 3/30/1993) and Baer et al. (Mol. Biol. Med. 3 (3), 265-277 (1986)) as applied to claims 12, 14-19 and 21-25 and further in view of Pulè et al. (Molecular Therapy (2005) 12, 933–941) is maintained. Applicant’s arguments will be addressed following maintained rejection.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under pre-AIA 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a).
Prior Art Rejection 1
Claims 12, 14-19 and 21-25 remain rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Ando et al. (US20080159996 A1, Publication Date 7/3/2008, Reference A39 in IDS filed 5/4/2023) in view of Mineno et al. (US20100273213 A1, Effective Filed Date 6/6/2008, Reference A42 in IDS filed 5/4/2023), Croce (U.S Patent US5198338 , Publication Date 3/30/1993, Reference A1 in IDS filed 5/4/2023) and Baer et al. (Mol. Biol. Med. 3 (3), 265-277 (1986), Reference C5 in IDS filed 5/4/2023). The rejection is copied below for Applicant’s convenience.
Regarding claim 12,in-part, and claim 19, in-part Ando et al. teach an isolated T-cell (Pg. 2, para. 15) (as in claim 16 and claim 23) or a hematopoietic stem cell (Pg. 2, para. 15) (as in claim 17, claim 18, claim 24 and claim 25) comprising a genomic modification made by a zinc finger nuclease (ZFN) (Abstract) (as further in claim 12 and claim 19) and wherein the genomic modification is within any target endogenous gene (Pg. 11, para. 122) and wherein the genomic modification is an insertion of a transgene (Pg. 14, para. 171), wherein said insertion results in the inactivation of the endogenous gene (Pg. 1, para. 7). Moreover, Ando teaches the nuclease is introduced into the modified cell as a polynucleotide (Pg. 1, para. 12) wherein the cell further comprises a donor polynucleotide encoding a transgene (Pg. 11, para. 118). In a specific embodiment, Ando teaches the endogenous gene is knocked out (Pg. 1, para. 6; Pg. 2 para. 17) and replaced with the donor polynucleotide encoding a transgene (Example 8, Pg. 14, para. 168). It is noted that insofar as Ando teaches the genetically modified cell can be comprised in a composition (reagent) (Pg. 1, para. 7) for the purposes of treating genetic diseases and/or infectious diseases (Pg. 12, para. 126) or to provide for gene therapy (Pg. 12, para. 128 (as in claim 19).
However, Ando et al. fail to teach the endogenous gene is a TCR gene (as further in claim 12 and claim 19).
Prior to the time of the claimed invention, Mineno et al. taught that when a TCR gene composed of an α chain and a β chain recognizing an objective antigen is introduced into a T cell, the endogenous TCR α chain and TCR β chain originally expressed by the T cell cause mispairing between a β chain and an α chain of the introduced TCR recognizing the objective antigen. That is, when α′ and β′ are introduced into a cell expressing α and β, each heterodimer of αβ, αβ′, α′β, and α′β′ is formed, thereby causing a problem that TCRs forming a proper heterodimer to recognize the objective antigen are decreased, and a heterodimer recognizing an unexpected antigen may be formed (Pg. 1, Col. 2, para. 6). Thus, to remedy this deficiency, Mineno et al. teach a T-cell (Pg. 1, para. 7) comprising a transgene encoding an exogenous polypeptide corresponding to at least one endogenous polypeptide and in which the expression of the endogenous polypeptide is inhibited (Abstract). In one embodiment, Mineno teaches the transgene encodes an engineered TCR subunit (Fig. 1; Pg. 2, para. 17; Pg. 7 ‘Example 1’ para. 98- Pg. 8, para. 99; Pg. 3 para. 54) (as further in claim 12 and as further in claim 19). Note also that Mineno teaches administering a T cell containing the introduced exogenous TCR to a patient with cancer (Pg. 7, para. 83), such as leukemia.
However, none of Ando et al. nor Mineno et al. teach the zinc finger nuclease binds to a target site as shown in SEQ ID NO: 41 (as further in claim 12 and claim 19) or that the integration is within an endogenous TCRα gene (as in claim 21), in particular, within exon 1 of an endogenous TCRα gene (as in claim 15 and claim 22).
Prior to the time of the claimed invention, Croce taught chromosomal abnormalities, translocations, inversions and deletions are nonrandomly associated with certain types of human leukemias. Particularly, in T-cell tumors, many such abnormalities involve the T-cell receptor alpha (TCRα) locus at chromosome band 14 q11. In fact, Croce teaches cells derived from three different patients with acute T-cell leukemia were analyzed and the breakpoint (region of the chromosome which is consistently involved in T-cell malignancies ((Col. 3, lines 44-47)) in this translocation was found within the TCRα locus in the region between the C alpha and V alpha genes on chromosome 14 (Col. 1, lines 18-23; Col. 1, lines 48-52). This teaching by Croce is reasonably considered as a chromosome translocation breakpoint in the TCRα locus in the region between the Constant α (Cα) and Variable α (Vα) genes is associated with T-cell leukemia.
Prior to the time of the claimed invention, Baer et al. taught the structure and rearrangement of the human TCRα gene in T-cell leukemic cells. Baer teaches the Constant (Cα) region segment is comprised of four exons (Abstract). Of note, Baer teaches exon 1 (as in claim 15 and claim 22) of the T-cell receptor constant region alpha-chain (TCRα) gene (as in claim 14 and claim 21), which is 100% identical to SEQ ID NO: 41 (as further in claim 12 and claim 19), see below. In their teaching, Baer et al. suggests the four exons in the constant region of the human TCRα gene are associated with leukemia as they may undergo rearrangement.
RESULT 2
HUMTCACA1
LOCUS HUMTCACA1 300 bp DNA linear PRI 21-NOV-2003
DEFINITION Homo sapiens T-cell receptor constant region alpha-chain (TCRA)
gene, exon 1.
ACCESSION M14858
VERSION M14858.1 GI:338709
KEYWORDS .
SEGMENT 1 of 4
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 300)
AUTHORS Baer,R., Lefranc,M.P., Minowada,J., Forster,A., Stinson,M.A. and
Rabbitts,T.H.
TITLE Organization of the T-cell receptor alpha-chain gene and
rearrangement in human T-cell leukaemias
JOURNAL Mol. Biol. Med. 3 (3), 265-277 (1986)
PUBMED 3016457
COMMENT Clean copy of sequence [1] kindly provided by M.-P.Lefranc
(01-AUG-1986).
FEATURES Location/Qualifiers
source 1..300
/organism="Homo sapiens"
/mol_type="genomic DNA"
/db_xref="taxon:9606"
/chromosome="14"
/map="14q11.2"
/clone="lambda-D-alpha-3"
/germline
intron 300
/gene="TCRA"
/note="G00-120-404"
/number=1
Query Match 100.0%; Score 28; DB 111; Length 300;
Best Local Similarity 100.0%;
Matches 28; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTGTGGCCTGGAGCAACAAATCTGACTT 28
||||||||||||||||||||||||||||
Db 191 CTGTGGCCTGGAGCAACAAATCTGACTT 218
The combination of prior art cited above in all rejections under 35 U.S.C.103 satisfies the factual inquiries as set forth in Graham v. John Deere Co., 383 U.S. 1,148 USPQ 459 (1966). Once this has been accomplished the holdings in KSR can be applied (KSR International Co. v. Teleflex Inc. (KSR), 550 U.S. 389, 82 USPQ2d 1385 (2007): "Exemplary rationales that may support a conclusion of obviousness include: (A) Combining prior art elements according to known methods to yield predictable results; (B) Simple substitution of one known element for another to obtain predictable results; (C) Use of known technique to improve similar devices (methods, or products) in the same way; (D) Applying a known technique to a known device (method, or product) ready for improvement to yield predictable results; (E) "Obvious to try" - choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success; (F) Known work in one field of endeavor may prompt variations of it for use in either the same field or a different one based on design incentives or other market forces if the variations are predictable to one of ordinary skill in the art; (G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention."
In the present situation, rationales A and G are applicable. At the time of invention, it would have been prima facie obvious to an artisan of ordinary skill to combine the teachings of Ando et al., wherein Ando teaches a ZFN-modified T-cell (or hematopoietic stem cell) comprising a deletion of any target endogenous gene and wherein the cell further comprises a donor polynucleotide encoding a transgene to replace the deleted endogenous gene, with the teachings of Mineno et al., wherein Mineno teaches a T-cell comprising a transgene encoding a TCR subunit for the purposes of replacing an endogenous TCR subunit, with a reasonable expectation of achieving success.
The skilled artisan would have had a reasonable expectation of success given that (1) using ZFN, Ando successfully knocked out an endogenous gene and replaced said gene with a donor polynucleotide encoding a transgene and (2) Mineno teaches a transgene encoding an engineered TCR subunit. The skilled artisan would have found it prima facie obvious to modify the teachings of Ando et al. such that the TCR transgene of Mineno et al. is inserted and targeted to the endogenous TCR gene so that the endogenous TCR gene is inactivated, as suggested by Mineno, because Mineno warns that when a TCR transgene composed of an α chain and a β chain recognizing an objective antigen is introduced into a T cell, the endogenous TCR α chain and TCR β chain originally expressed by the T cell cause mispairing between a β chain and an α chain of the introduced TCR recognizing the objective antigen which can manifest into undesired outcomes.
Moreover, one of ordinary skill in the art would have been found it prima facie obvious to target the ZFN to the endogenous TCRα gene, in particular exon 1 of the constant region of TCRα gene, because Croce traced acute T-cell leukemia in three different patients to a translocation within the TCRα locus in the region between the C alpha and V alpha genes and Baer provides evidence that rearrangements of the exons of the constant region of the TCRα gene may be associated with leukemia. Thus, the skilled artisan would have targeted the endogenous TCRα gene so that it is inactivated. Further, the skilled artisan would have targeted exon 1 of the TCR Cα gene because Ando teaches ZFNs can be engineered to target specific desired DNA sequences and Baer provides the complete DNA sequence of exon 1 of the TCR C alpha gene.
Note that the reason or motivation to modify the reference may often suggest what the inventor has done, but for a different purpose or to solve a different problem. It is not necessary that the prior art suggest the combination to achieve the same advantage or result discovered by applicant. >See, e.g., In re Kahn, 441 F.3d 977, 987, 78 USPQ2d 1329, 1336 (Fed. Cir. 2006) (motivation question arises in the context of the general problem confronting the inventor rather than the specific problem solved by the invention); Cross Med. Prods., Inc. v. Medtronic Sofamor Danek, Inc., 424 F.3d 1293, 1323, 76 USPQ2d 1662, 1685 (Fed. Cir. 2005) ("One of ordinary skill in the art need not see the identical problem addressed in a prior art reference to be motivated to apply its teachings.");< In re Linter, 458 F.2d 1013, 173 USPQ 560 (CCPA 1972) (discussed below); In re Dillon, 919 F.2d 688, 16 USPQ2d 1897 (Fed. Cir. 1990), cert. denied, 500 U.S. 904 (1991) (discussed below). Although Ex parte Levengood, 28 USPQ2d 1300, 1302 (Bd. Pat. App. & Inter. 1993) states that obviousness cannot be established by combining references "without also providing evidence of the motivating force which would impel one skilled in the art to do what the patent applicant has done" (emphasis added), reading the quotation in context it is clear that while there must be motivation to make the claimed invention, there is no requirement that the prior art provide the same reason as the applicant to make the claimed invention.
In the instant case, owing to the fact that Croce teaches the breakpoint in translocation of cells derived from three different patients with acute T-cell leukemia was found within the TCR alpha locus in the region between the C alpha and V alpha genes and the fact that Baer suggest the exons of the constant region of TCRα gene are associated with T-cell leukemia, one of ordinary skill in the art would have found it prima facie obvious to use a ZFN to inactivate the endogenous constant region of the TCRα gene in the T-cell of a patient with leukemia and replace said endogenous region with a transgene encoding a constant region of a TCRα gene, for the purposes of administering the resulting T-cell to said patient for the purposes of treating leukemia.
Thus, the teachings of the cited prior art in the obviousness rejection above provide the requisite teachings and motivations with a clear, reasonable expectation. The cited prior art meets the criteria set forth in both Graham and KSR.
Therefore, the claimed invention, as a whole, was clearly prima facie obvious in the absence of evidence to the contrary.
Prior Art Rejection 2
Claim 13 and 20 remain rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Ando et al. (US20080159996 A1, Publication Date 7/3/2008, Reference A39 in IDS filed 5/4/2023) in view of Mineno et al. (US20100273213 A1, Effective Filed Date 6/6/2008, Reference A42 in IDS filed 5/4/2023), Croce (U.S Patent US5198338 , Publication Date 3/30/1993, Reference A1 in in IDS filed 5/4/2023) and Baer et al. (Mol. Biol. Med. 3 (3), 265-277 (1986), Reference C5in IDS filed 5/4/2023) as applied to 12, 14-19 and 21-25 above, and further in view of Pulè et al. (Molecular Therapy (2005) 12, 933–941., Reference C43 in IDS filed 5/4/2023). The rejection is copied below for Applicant’s convenience.
The teachings of Ando et al., Mineno et al., Croce et al. and Baer et al. are relied upon as detailed above.
However, none of Ando et al., Mineno et al., Croce et al. or Baer et al. teach the transgene encodes a chimeric antigen receptor (as in claim 13 and 20)
Prior to the time of the claimed invention, Pulè et al. taught adoptive immunotherapy with T cells appears effective for treatment of certain malignant and infectious disorders (Pg. 933, Col. 1, para. 1). There are, however, considerable barriers to expanding the scope of this approach, not least in generating high-affinity T cells with appropriate anti-tumor effector function. Pulè teaches this problem may be overcome by the use of chimeric T cell receptors (cTCRs). Pulè teaches cTCRs are fusions between an antigen-recognizing ectodomain and a signaling endodomain (Fig. 1a). In their simplest form, Pulè teaches these chimeric molecules connect the antigen-recognition properties of antibodies with the signaling endodomain of CD3ζ. T cells transduced with cTCR are redirected to almost any target, providing an attractive strategy to generate large numbers of tumor-specific T cells. Thus, towards this end, Pulè et al. teach a CD28-OX40-CD3ζ tripartite cytoplasmic domain that provides a full complement of activation, proliferation, and survival signals for enhanced anti-tumor activity (Abstract) (as in claim 13 and claim 20). Pulè teaches the resulting the transduced T-cells have considerable clinical utility. (Pg. 939, Col. 2, para. 1)
When taken with the teachings of Pulè et al., the skilled artisan seeking to expand tumor T-specific T cells for the purposes of treating leukemia would have found it prima facie obvious to modify the teachings of Ando et al., Mineno et al., Croce et al. and Baer et al. such that the transgene encodes a chimeric antigen receptor with a reasonable expectation of success. The skilled artisan would have had a reasonable expectation of success given that (1) using ZFN, Ando successfully knocked out an endogenous gene and replaced said gene with a donor polynucleotide encoding a transgene and (2) Pulè teaches a transgene encoding a chimeric antigen receptor. Moreover, one of ordinary skill in the art would have found it prima facie obvious to substitute the transgene encoding a TCR subunit, as taught by Mineno, with the transgene encoding a chimeric antigen receptor, as taught by Pulè, in order to expand tumor T-specific T cells.
Note that the reason or motivation to modify the reference may often suggest what the inventor has done, but for a different purpose or to solve a different problem. It is not necessary that the prior art suggest the combination to achieve the same advantage or result discovered by applicant. >See, e.g., In re Kahn, 441 F.3d 977, 987, 78 USPQ2d 1329, 1336 (Fed. Cir. 2006) (motivation question arises in the context of the general problem confronting the inventor rather than the specific problem solved by the invention); Cross Med. Prods., Inc. v. Medtronic Sofamor Danek, Inc., 424 F.3d 1293, 1323, 76 USPQ2d 1662, 1685 (Fed. Cir. 2005) ("One of ordinary skill in the art need not see the identical problem addressed in a prior art reference to be motivated to apply its teachings.");< In re Linter, 458 F.2d 1013, 173 USPQ 560 (CCPA 1972) (discussed below); In re Dillon, 919 F.2d 688, 16 USPQ2d 1897 (Fed. Cir. 1990), cert. denied, 500 U.S. 904 (1991) (discussed below). Although Ex parte Levengood, 28 USPQ2d 1300, 1302 (Bd. Pat. App. & Inter. 1993) states that obviousness cannot be established by combining references "without also providing evidence of the motivating force which would impel one skilled in the art to do what the patent applicant has done" (emphasis added), reading the quotation in context it is clear that while there must be motivation to make the claimed invention, there is no requirement that the prior art provide the same reason as the applicant to make the claimed invention.
In the instant case, the Examiner has set forth explicit rationale as to why one of skill in the art would have had sufficient motivation and guidance to modify the combination of Ando et al., Mineno et al., Croce et al. and Baer et al. with the teachings of Pulè.
Thus, the teachings of the cited prior art in the obviousness rejection above provide the requisite teachings and motivations with a clear, reasonable expectation. The cited prior art meets the criteria set forth in both Graham and KSR.
Therefore, the claimed invention, as a whole, was clearly prima facie obvious in the absence of evidence to the contrary.
Applicant’s Arguments/Response to Arguments
Applicant argues: In the instant case, the pending claims are drawn to a method of inactivating a TCR gene in a cell, the method comprising integrating a transgene into the TCR gene by a zinc finger nuclease comprising a zinc finger protein that binds to a target site in the TCR gene, wherein the target site is within any of SEQ ID NO: 1, 7, 13, 18, 23, 29, 34, 37, 41, 45, 49, 54, 58 or 63, and further wherein the binding of the zinc finger protein at the target site in the TCR gene results in cleavage of the TCR gene such that the TCR gene is inactivated by integration of the transgene. All of the references are entirely silent as to the particularly claimed nuclease target sites and, on this basis alone, the rejection cannot be sustained.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. As noted above, Croce taught chromosomal abnormalities, translocations, inversions and deletions are nonrandomly associated with certain types of human leukemias. Particularly, in T-cell tumors, many such abnormalities involve the T-cell receptor alpha (TCRα) locus at chromosome band 14 q11. Croce teaches cells derived from three different patients with acute T-cell leukemia were analyzed and the breakpoint (region of the chromosome which is consistently involved in T-cell malignancies ((Col. 3, lines 44-47)) in this translocation was found within the TCRα locus in the region between the C alpha and V alpha genes on chromosome 14. Baer et al. taught the structure and rearrangement of the human TCRα gene in T-cell leukemic cells. Baer teaches the Constant (Cα) region segment is comprised of four exons (Abstract). Of note, Baer teaches exon 1 of the T-cell receptor constant region alpha-chain (TCRα) gene, which is 100% identical to SEQ ID NO: 41. In their teaching, Baer et al. suggests the four exons in the constant region of the human TCRα gene are associated with leukemia as they may undergo rearrangement.
One of ordinary skill in the art would have found it prima facie obvious to target the ZFN to the endogenous TCRα gene, in particular exon 1 of the constant region of TCRα gene, because Croce traced acute T-cell leukemia in three different patients to a translocation within the TCRα locus in the region between the C alpha and V alpha genes and Baer provides evidence that rearrangements of the exons of the constant region of the TCRα gene may be associated with leukemia. Thus, the skilled artisan would have targeted the endogenous TCRα gene so that it is inactivated.
Applicant argues: Furthermore, contrary to the Examiner's assertion, SEQ ID NO: 41 as a target site is not taught, suggested by, or in any way predictable from, the combined teachings of the references. Ando, Mineno, Baer and Pule are admittedly silent as to any of the claimed specific target sites.
In Response: Arguments drawn to SEQ ID NO: 41 as a target site has been addressed above. Moreover, note that that the reason or motivation to modify the reference may often suggest what the inventor has done, but for a different purpose or to solve a different problem. It is not necessary that the prior art suggest the combination to achieve the same advantage or result discovered by applicant. >See, e.g., In re Kahn, 441 F.3d 977, 987, 78 USPQ2d 1329, 1336 (Fed. Cir. 2006) (motivation question arises in the context of the general problem confronting the inventor rather than the specific problem solved by the invention); Cross Med. Prods., Inc. v. Medtronic Sofamor Danek, Inc., 424 F.3d 1293, 1323, 76 USPQ2d 1662, 1685 (Fed. Cir. 2005) ("One of ordinary skill in the art need not see the identical problem addressed in a prior art reference to be motivated to apply its teachings.");< In re Linter, 458 F.2d 1013, 173 USPQ 560 (CCPA 1972) (discussed below); In re Dillon, 919 F.2d 688, 16 USPQ2d 1897 (Fed. Cir. 1990), cert. denied, 500 U.S. 904 (1991) (discussed below). Although Ex parte Levengood, 28 USPQ2d 1300, 1302 (Bd. Pat. App. & Inter. 1993) states that obviousness cannot be established by combining references "without also providing evidence of the motivating force which would impel one skilled in the art to do what the patent applicant has done" (emphasis added), reading the quotation in context it is clear that while there must be motivation to make the claimed invention, there is no requirement that the prior art provide the same reason as the applicant to make the claimed invention.
In the instant case, owing to the fact that Croce teaches the breakpoint in translocation of cells derived from three different patients with acute T-cell leukemia was found within the TCR alpha locus in the region between the C alpha and V alpha genes and the fact that Baer suggest the exons of the constant region of TCRα gene are associated with T-cell leukemia, one of ordinary skill in the art would have found it prima facie obvious to use a ZFN to inactivate the endogenous constant region of the TCRα gene in the T-cell of a patient with leukemia and replace said endogenous region with a transgene encoding a constant region of a TCRα gene, for the purposes of administering the resulting T-cell to said patient for the purposes of treating leukemia.
Applicant argues: In fact, contrary to the Examiner's allegation, Ando does not teach or suggest genomic modification within any target endogenous gene. Examiner cited paragraphs [0011] and [0122] of Ando as allegedly supporting this allegation.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. As copied below, Examiner also cites para. 7 of Ando which is also copied below.
PNG
media_image1.png
292
732
media_image1.png
Greyscale
PNG
media_image2.png
160
570
media_image2.png
Greyscale
Note that Ando does not limit the target gene to the CCR-5 gene, as argued by Applicant.
Applicant argues: Similarly, Mineno is directed to inhibition of endogenous TCR expression by RNA interference (see claims 12 and 19, also cited by the Examiner) not by the ZFN-mediated genomic editing of the locus.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. Note that Examiner did not cite Mineno for teaching ZFN. As such, Applicant’s arguments are off point.
Applicant’s argument: Pule teaches retroviral delivery of a TCR transgene. Integration of a transgene into the genome using retrovirus is not target-specific.
In Response: Applicant’s arguments regarding Pule are unclear.
Applicant’s argument: For its part, Croce teaches away from the claimed subject matter. This reference relates to primers used to amplify wild-type TCR fragments. Therefore, by definition, Croce teaches sequences that require a completely intact TCR gene in order to serve as a primer site for the wild-type gene. Accordingly, Croce actively teaches away using any TCR sequences as target sites for nuclease-mediated modification.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. Specifically, Croce was not cited for teaching an intact TCR gene or a fragmented TCR gene. Rather, Croce was cited for teaching cells derived from three different patients with acute T-cell leukemia were analyzed and the breakpoint (region of the chromosome which is consistently involved in T-cell malignancies ((Col. 3, lines 44-47)) in this translocation was found within the TCRα locus in the region between the C alpha and V alpha genes on chromosome 14.
Applicant argues: Moreover, the Examiner errs in asserting that Baer somehow teaches or suggests the target site of SEQ ID NO:41. In fact, SEQ ID NO:41 is 28 base pairs long while Baer discloses sequences (exons 1 to 4) of 1,500 base pairs with absolutely no teaching or suggestion as to selecting a target site within one of these exons, let alone the particular 28 base pair target of SEQ ID NO:41.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. As noted above, Croce taught chromosomal abnormalities, translocations, inversions and deletions are nonrandomly associated with certain types of human leukemias. Particularly, in T-cell tumors, many such abnormalities involve the T-cell receptor alpha (TCRα) locus at chromosome band 14 q11. Croce teaches cells derived from three different patients with acute T-cell leukemia were analyzed and the breakpoint (region of the chromosome which is consistently involved in T-cell malignancies ((Col. 3, lines 44-47)) in this translocation was found within the TCRα locus in the region between the C alpha and V alpha genes on chromosome 14. Baer et al. taught the structure and rearrangement of the human TCRα gene in T-cell leukemic cells. Baer teaches the Constant (Cα) region segment is comprised of four exons (Abstract). Of note, Baer teaches exon 1 of the T-cell receptor constant region alpha-chain (TCRα) gene, which is 100% identical to SEQ ID NO: 41. In their teaching, Baer et al. suggests the four exons in the constant region of the human TCRα gene are associated with leukemia as they may undergo rearrangement.
One of ordinary skill in the art would have found it prima facie obvious to target the ZFN to the endogenous TCRα gene, in particular exon 1 of the constant region of TCRα gene, because Croce traced acute T-cell leukemia in three different patients to a translocation within the TCRα locus in the region between the C alpha and V alpha genes and Baer provides evidence that rearrangements of the exons of the constant region of the TCRα gene may be associated with leukemia. Thus, the skilled artisan would have targeted the endogenous TCRα gene in any one of exons 1-4 so that it is inactivated.
Because Applicant’s arguments were not found persuasive, the rejection is maintained.
Authorization to Initiate Electronic Communications
The examiner may not initiate communications via electronic mail unless and until applicants authorize such communications in writing within the official record of the patent application. See M.P.E.P. § 502.03, part II. If not already provided, Applicants may wish to consider supplying such written authorization in response to this Office action, as negotiations toward allowability are more easily conducted via e-mail than by facsimile transmission (the PTO's default electronic-communication method). A sample authorization is available at § 502.03, part II.
Conclusion
No claim is allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TITILAYO MOLOYE whose telephone number is (571)270-1094. The examiner can normally be reached Working Hours: 5:30 a.m-3:00 p.m. M-F. Off first Friday of biweek..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached on 571- 272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TITILAYO MOLOYE/ Primary Examiner, Art Unit 1632