DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received 11/28/2025. Claims 1-19 are currently pending.
Election/Restrictions
Applicant's election without traverse of Group I (Claims 1-8) in the reply filed on 11/28/2025 is acknowledged.
Claims 9-19 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being
drawn to a nonelected inventions Groups II & III, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/28/2025.
Accordingly, claims 1-8 are examined herein.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or
under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in FIG. 1 are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Drawings
The drawings are objected to for the following reasons:
37 CFR 1.84 (u)(1) states “Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.”
In the current case, the view numbers for the partial views for FIGs 1 & 5 that appear on several sheets are followed by "(a)", “(b)”, etc. instead of a capital letter such as FIG. 1A, FIG. 1B, etc.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Objections
Claim 3 is objected to because of the following informalities: duplicate recitation of “HKP, HKP(+H)”. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, the recitation “A pharmaceutical composition comprising … wherein said copolymer solution comprises acetate present in the amount of about 11% to about 20% of the composition” creates indefiniteness as the phrase “the composition” seems to acquire antecedent basis from “A pharmaceutical composition”, yet the claim language says “said copolymer solution comprises acetate…”. It is unclear what the relationship is between “A pharmaceutical composition” and the amounts of “a nanoparticle formulation” that is “prepared by microfluidic mixing of (i) a solution comprising a histidine-lysine copolymer and (ii) a solution comprising an effective amount of at least one nucleic acid”. Without clarifying the relative volumes of said “pharmaceutical composition”, “copolymer solution”, “a solution comprising an effective amount of at least one nucleic acid”, and “nanoparticle formulation”, one with ordinary skill in the art would not be appraised of the amount of acetate that is required.
Furthermore, the recitation of “%” in “about 11% to about 20%” without specifying whether it is weight / weight, weight / volume, or other metrics, creates indefiniteness because different metrics require different amounts of acetate in the “copolymer solution” or to reach “about 11% to about 20%” of “the composition”.
Claims 2-8 are also rejected for depending from the rejected claims 1 and failing to remedy the indefiniteness therein.
Claim Interpretation
Despite the indefiniteness in claim 1, the following claim interpretations are provided to help advance the prosecution of the current application.
Claim 1 recites “and/or phosphate anion”. It is interpreted that “phosphate anion” is not required and therefore not a limitation.
Claim 1 recites “a nanoparticle formulation prepared by microfluidic mixing of (i) … and (ii) …” is a product-by-process claim. See MPEP §2113(I). However, there is no limitation regarding what “microfluidic mixing” entails, specifically, it is not specified that ‘microfluidic mixing” encompasses all components of the copolymer solution “(i)” and the nucleic acid solution “(ii)”. Roces et al. (Translating the fabrication of protein-loaded poly(lactic-co-glycolic acid) nanoparticles from bench to scale-independent production using microfluidics. Drug Deliv. and Transl. Res. 10, 582–593. 2020; Hereinafter, Roces) teaches that standard downstream purification process is required to eliminate excess unbound siRNA, solvent, or buffer salts for polymeric nanoparticle preparation protocols using microfluidic mixing (Page 583, last ¶ to the first ¶ on page 584). “Prepared by microfluidic mixing” does not mean “comprising”, nor is it defined as such in the specification.
Based on broadest reasonable interpretation (BRI) of the claim, see MPEP §2111, it is interpreted that acetate is not required in the “pharmaceutical composition”. The recitation of “…said copolymer solution comprises acetate present in the amount of about 11% to about 20% of the composition” clearly specifies that acetate is only required in the “copolymer solution” whereas the recitation of “the composition” merely references the “amount” and does not require a physical presence of “acetate” in the “pharmaceutical composition”. Moreover, without specifying the steps of how “a pharmaceutical composition” comprises the “nanoparticle formulation”, the claim does not require acetate in the “copolymer solution” but does require the “nanoparticles”. In plain interpretation, acetate is only required for the production of nanoparticles, but not required to be present in the pharmaceutical composition.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-6, 8 are rejected under 35 U.S.C. 103 as being unpatentable over Zhou et al. (WO2018081726A2, published May, 3rd, 2018,; Hereinafter, Zhou) in view of Abstiens et al. (Microfluidic manufacturing improves polydispersity of multicomponent polymeric nanoparticles. Journal of Drug Delivery Science and Technology, Volume 49, 2019,Pages 433-439; Hereinafter, Abstiens) in further view of Westfall et al. (2013. Chapter 9 Functions of Random Variables: Their Distributions and Expected Values. Understanding Advanced Statistical Methods. Texas Tech University: CRC Press. p. 243. ISBN 9781466512115; Hereinafter, Westfall).
Zhou (2018) teaches that a pharmaceutical “composition comprising an siRNA molecule …, and a pharmaceutically acceptable carrier comprising a pharmaceutically acceptable histidine-lysine co-polymer” (HKP; Page 25, claim 38) is prepared “when an HKP aqueous was mixed with siRNA at a N/P ratio of 4: 1 by mass, the nanoparticles … were self-assembled” (Page 9, line 2-4). Zhou also teaches that “The nanoparticles were analyzed with a particle sizer (Brookhaven 190, NY, USA) and resulted in an average size of 150 nm±30 in diameter” (Page 3, lines 6-7). Based on the “the 68-95-99.7 rule (or empirical rule) taught by Westfall, for a normal distribution, nearly all data falls within three standard deviations of the mean: ~68% within average±standard deviation (SD), ~95% within average±2SD, and ~99.7% within average±3SD”. Hence, Zhou teaches that HKP-based nanoparticles can be produced with approximately 68% nanoparticles with a diameter between 120-180nm (150 nm±30). Hence, it reads on the instant claim limitations of “at least 40%, at least 45%, at least 50%, at least 55% or at least about 60% of said nanoparticles formed have a diameter in a range selected from the group consisting of between about 40 and about 200 nm, between about 50 and about 150 nm, between about 50 and about 100nm, and between about 60 and about 90 nm”.
Zhou does not teach: 1) mixing using microfluidic methods; 2) “said copolymer solution comprises acetate present in the amount of about 11 % to about 20% of the composition”;
However, Abstiens (2019) teaches improved techniques using microfluidic devices for mixing polymeric solutions to synthesize highly uniform and much smaller polymeric nanoparticles that range between 10-100nm in diameter with monodisperse distribution profiles. Abstiens teaches:” … particles were significantly smaller in size (24–43nm) and displayed a rather monodisperse size distribution when they were manufactured with a microfluidic system” (Page 433, Abstract). Abstiens further teaches that "Microfluidics has recently emerged as a new technology that offers precisely controlled reaction environments and has been harnessed to manufacture polymeric NPs with defined properties and excellent batch-to-batch consistency…which makes this technology highly valuable for … clinical applications… ” (Page 433, left column, last sentence – right column, line 18).
Neither Zhou, nor Abstiens, nor Westfall teaches that “said copolymer solution comprises acetate present in the amount of about 11 % to about 20% of the composition”, which, according to the instant specification, is based on the observation that “an acetate content between about 11 and about 18 percent provides an ideal nanoparticle size and PDI” (Page 27, ¶[0109]). Hence, the process step of addition of acetate (or acetic acid as taught by Example 1) to the polymeric nanoparticle solution only serves to reduce the size of nanoparticles, and to reduce the PDI, which are the only structural implications of this claimed process step in the method of manufacturing of polymeric nanoparticles that comprise histidine lysine copolymer (HKP) and siRNA.
Regarding claim 1, the only structure implied by the method step is the smaller size ranges of nanoparticle diameters and the more uniform size distribution (i.e. reduced PDI values). Zhou in view of Abstiens can achieve the same results without the claimed step in the current application.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the mixing technique in the polymeric nanoparticle production method taught by Zhou using microfluidic strategies taught by Abstiens to achieve production of the same caliber of smaller and uniform polymer-siRNA polyplex/nanoparticles without the claimed nanoparticle formulation production method step of adding acetate to the nanoparticle solution disclosed by the current application, for customizable nanoparticle size distribution and consistency to ultimately achieve improved delivery, targeting, and therapeutic efficacy. Based on the teachings of Abstiens, the refined and tunable microfluidics-based mixing particle production is a known advancement of the equivalent mechanical mixing process described by Zhou, whereas the clinical suitability of microfluidics-supported production of polymeric nanoparticles based on the teachings of Abstiens (Page 433, right column, line 14) and the examples of high quality polymeric nanoparticles produced using the microfluidic mixing strategies (Page 438, Fig. 8) provide reasonable expectation of success and motivation to apply the microfluidic strategies.
Regarding claim 2, Zhou teaches a HKP-siRNA nanoparticle composition with a PDI of 0.205 (Figure 7, lower panel, circled text “Polydispersity: 0.205”, see Figure 7 below), which is between 0.2 and
PNG
media_image1.png
641
902
media_image1.png
Greyscale
0.3. And Abstiens further teaches PDI values are tunable by adjusting microfluidic device parameters such as polymer concentration and total flow rate and examples are provided to show PDI values between 0.2 and 0.1 (Page 436, Fig. 4; see below). Both PDI value ranges fall within the claimed ranges “wherein the nanoparticles in said composition have a polydispersity index (PDI) selected from the group consisting of between about 0.4 and about 0.3, between about 0.3 and about 0.2, between about 0.2 and about 0.1, between about 0.1 and about 0.05, between about 0.05 and about 0.03, or between
PNG
media_image2.png
311
472
media_image2.png
Greyscale
about0.03 and about 0.01”.
Regarding claims 3 & 8, Zhou further teaches the use of HKP by reciting “We have developed a process to formulate Histidine-Lysine Polymer (HKP) with selected siRNA duplexes…” on page 2, line 2.
Regarding claim 4, Zhou further teaches the inclusion of siRNA by stating “The current invention provides … a composition comprising and siRNA molecule …, and a pharmaceutically acceptable carrier comprising a … histidine-lysine polymer….” In the Abstract and claim 1 (Page 23, line 4).
Regarding claim 5, Zhou further teaches that the siRNA molecules used for HKP nanoparticle complexing are 25nt long (Page 23, claim 10, line2 24-28) for reciting “composition comprising the siRNA molecule hmTF-25-2: sense, 5'-(CCCAAGGGCUACCAUGCCAACUUCU)-3 ', anti-sense, 5 ' -(AGAAGUUGGCAUGGUAGCCCUUGGG)-3 ', the siRNA molecule hmCX-25-1: sense, 5'-(GGUCUGGUGCCUGGUCUGAUGAUGU)-3', antisense, 5'-(ACAUCAUCAGACCAGGCACCAGACC)-3'…”
Regarding claim 6, Zhou further teaches “A method of …, comprising administering to the tissue a therapeutically effective amount of a composition comprising an siRNA molecule that binds to an mRNA that codes for TGF-β1…, and a pharmaceutically acceptable carrier comprising a pharmaceutically acceptable histidine-lysine co-polymer” (Claim 1, page 23, lines 2-7).
Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Zhou, in view of Abstiens and Westfall as applied to claims 1-6, 8 above, in further view of Lu et al. (WO2019226940A1. Composition and methods of controllable co-coupling polypeptide nanoparticle delivery system for nucleic acid therapeutics; Published 11/28/2019; Hereinafter, Lu) and He et al. (Location of a single histidine within peptide carriers increases mRNA delivery. J Gene Med. 2021 Feb;23(2):e3295. Epub 2020 Dec 21; Hereinafter, He).
The teachings of Zhou are discussed above.
Regarding claim 7, Zhou does not teach the use of HKP(+H).
However, Lu (2019) teaches the use of HKP(+H) for dual siRNA delivery (Figure 2A; Page 30, Claim 20) “as a co-delivery agent consisting of a branched polypeptide (HKP). This peptide has an appropriate positive charge and has a functional group which can be further modified for targeting specificity and reducing toxicity” (Page 3, line 14-16). Lu and Zhou share the same motivation as inventors from the same assignee in that both inventions explore novel yet divergent strategies involving histidine lysine copolymer-based nanoparticle formulations to optimize targeted siRNA delivery to treat a broad range of human diseases. One with ordinary skill in the art would readily encounter both arts while exploring prior arts for novel teachings in the field.
Lu does not articulate the benefits of HKP(+H) or provide a clear motivation for using HKP(+H).
However, He teaches that “… the additional histidine [(+H)] in the second domain enhanced transfection through increased stability of the polyplexes, perhaps by non-ionic interactions between the polymers. Analogous to other carries of nucleic acids including mRNA, selective pegylation and cross-linking of HK carriers is expected to augment the stability of the polyplex in vivo.” (Page 9, right column, lines 12-14.). He belongs to a key innovation group in the field of HK-siRNA nanomedicine and the innovations of which are often cited in the applications of Zhou and Lu.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the compositions disclosed by Zhou using microfluidics strategies disclosed by Abstiens and would have evaluated the nanoparticle size distribution profile based on Westfall’s calculations, in addition to using the HKP(+H) formulation disclosed by Lu, with the teachings, suggestions, and motivations provided by He for the goal of improving the therapeutic RNA delivery efficiency and arrive at the same invention as claimed.
Relevant Art Cited
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
-Leng Q, Scaria P, Zhu J, et al. Highly branched HK peptides are effective carriers of siRNA. J Gene Med 2005; 7: 977-986. Provides all molecular structure disclosures included in the FIG. 1 of the instant applications (see Figure 1 and Figure 3A).
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636