Prosecution Insights
Last updated: October 04, 2026
Application No. 17/961,097

GENE CONSTRUCTS FOR SILENCING ANGIOPOIETIN-LIKE 3 (ANGPTL3) AND USES THEREOF

Final Rejection §103
Filed
Oct 06, 2022
Priority
Apr 07, 2020 — EU 20168507.0 +2 more
Examiner
ANGELL, JON E
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Uniqure IP B.V.
OA Round
2 (Final)
71%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
92%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allowance Rate
587 granted / 827 resolved
+11.0% vs TC avg
Strong +21% interview lift
Without
With
+21.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 3m
Avg Prosecution
30 currently pending
Career history
862
Total Applications
across all art units

Statute-Specific Performance

§101
6.7%
-33.3% vs TC avg
§103
27.6%
-12.4% vs TC avg
§102
23.2%
-16.8% vs TC avg
§112
26.6%
-13.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 827 resolved cases

Office Action

§103
DETAILED ACTION This Action is in response to the communication filed on 04/02/2026. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Claims 1-8, 10-22 are currently pending. Claims 2-3 and 22 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention (claim 22) or as being drawn to a non-elected species (claims 2-3), there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 07/25/2025. Claims 1, 4-8, 10-21 are under consideration. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 4-8, 10-11, 14, 16-21 are rejected under 35 U.S.C. 103 as being unpatentable over US20140179768 (hereafter “Bettencourt”; of record). As previously indicated, Bettencourt teaches dsRNA compositions targeting the ANGPTL3 gene as well as methods of inhibiting expression of ANGPTL3 and treating subjects having a disorder of lipid metabolism using the dsRNA compositions (see abstract). Bettencourt teaches a nucleic acid vector can encode a dsRNA that it complementary to a mRNA encoding ANGPTL3 wherein the dsRNA is 30 base pairs or less and region of complementarity may be 19 to 21 nucleotides in length (see paragraph [0020]). Regarding claim 4, Bettencourt teaches the dsRNA wherein the antisense sequence is 23 nucleotides in length ([0367]). Regarding claim 5, Bettencourt teaches that the sequence substantially complementary to the target RNA sequence (i.e., the antisense strand) has at most 30 nucleotides (e.g., see [0020], [0097], [0367], as indicated above). Regarding claims 6-10, Bettencourt teaches a dsRNA wherein the sequence substantially complementary to the target RNA sequence (i.e., the antisense strand sequence) is a 90.9% match with instant SEQ ID NO: 12 (see sequence alignment below). Specifically, Bettencourt teaches a dsRNA identified as Duplex ID AD-45909.1 (see TABLE 3 on page 57) where the antisense strand (SEQ ID NO: 224) is AGCAAAUCUUGAUUUUGGCTT and matches nucleotides 2-21 of instant SEQ ID NO: 12 (see sequence alignment below). Since the dsRNA taught by Bettencourt comprises an antisense sequence 90.9% identical to SEQ ID NO: 12 including 100% match with nucleotides 2-21 of 22 total nucleotides, the dsRNA is necessarily targeted to a sequence of at least one exon comprised in the ANGPTL3 gene, wherein the exon is one of exon 1, exon, 3, exon 5, or exon 6, wherein part of the at least one exon comprises in the ANGPTL3 gene comprises SEQ ID NO: 3 (the elected species). Regarding claim 11, Bettencourt teaches that the dsRNA can be expressed from a DNA vector (e.g., see [0189]). Regarding claim 14, Bettencourt teaches that AAV vectors may be used to deliver the dsRNA of the invention (see [0198]). Regarding claim 16, Bettencourt teaches a composition comprising the AAV vector and an excipient (e.g., see [0198], [0094]-[0095], [0289], etc.). Regarding claims 17-21, Bettencourt teaches that the dsRNA or pharmaceutical comprising thereof, may be used in combination with other pharmaceuticals including statins, and explicitly teaches atorvastatin (e.g., see 0346]). Thus Bettencourt teaches a nucleic acid encoding a dsRNA molecule that is substantially complementary to a target RNA encoded by an ANGPTL3 gene and wherein the dsRNA comprises a strand that has at least 19 nucleotides complementary to the target RNA, wherein the dsRNA, identified as Duplex ID AD-45909.1 (see TABLE 3 on page 57), comprises an antisense strand (SEQ ID NO: 224) that matches nucleotides 2-21 of instant SEQ ID NO: 12. Thus, Bettencourt teaches a dsRNA comprising a sequence that matches 20 contiguous nucleotides of SEQ ID NO: 12, which is 22 nucleotides in length. The only nucleotides of SEQ ID NO: 12 that are not taught by Bettencourt’s SEQ ID NO: 224 is nucleotide 1, and nucleotide 22. It is noted that Bettencourt’s SEQ ID NO: 224 comprises 19 nucleotides perfectly complementary to a sequence encoding ANGPTL3 and an additional 2 nucleotide dTdT sequence at the 3’ end. Bettencourt does not explicitly teach that the antisense sequence is SEQ ID NO: 12 (the elected species) which is now present in claims 1 and 10. However, since Bettencourt teaches a dsRNA having an antisense sequence perfectly complementary to 19 nucleotides of a sequence encoding ANGPTL3 and further teaches that the antisense sequence can be between 15 and 30 nucleotides in length (see [0100]), including 21-22 nucleotides in length ([0054], [0099]), and about 22 nucleotides in length ([0097]), and further considering that the ANGPTL3 sequence was known (as evidenced by Bettencourt), it would have been prima facie obvious to one of ordinary skill in the art prior to the day the claimed invention was filed to modify the dsRNA taught by Bettencourt to make a dsRNA with an antisense sequence that is 22 nucleotides in length and 100% (i.e., perfectly) complementary to a sequence encoding ANGPTL3 and identical to instant SEQ ID NO: 12, with a reasonable expectation of success. The motivation to make a dsRNA with an antisense sequence 22 nucleotides in length is provided by Bettencourt, which explicitly teaches that the antisense sequence can be 21-22 nucleotides in length (e.g., see [0099]). Furthermore, since Bettencourt teaches a dsRNA with an antisense sequence (SEQ ID NO: 224) wherein nucleotides 1-20 perfectly match nucleotides 2-21 of instant SEQ ID NO: 21, and considering that there are a finite number of possible nucleotides that can be added to the antisense sequence taught by Bettencourt to make an antisense sequence that is 21-22 nucleotides in length and that perfectly match the ANGPTL3 target sequence, It would have been a matter of “obvious to try” using a finite number of different possibilities. Furthermore, there would have been a reasonable expectation of success based on the fact that Bettencourt teaches a functional dsRNA that is 21 nucleotides in length and further based on the fact that a dsRNA with perfectly matched sequence of 22 nucleotides would be expected to be functional as well based on the teachings of Bettencourt (e.g., see [0101]). The combination of prior art cited satisfies the factual inquiries as set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966). Once this has been accomplished the holdings in KSR can be applied (KSR International Co. v. Teleflex Inc. (KSR), 550 USPQ2d 1385 (2007): “Exemplary rationales that may support a conclusion of obviousness include: (A) Combining prior art elements according to known methods to yield predictable results; (B) Simple substitution of one known element for another to obtain predictable results; (C) Use of known technique to improve similar devices (methods, or products) in the same way; (D) Applying a known technique to a known device (method, or product) ready for improvement to yield predictable results; (E) “Obvious to try” – choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success; (F) Known work in one field of endeavor may prompt variations of it for use in either the same field or a different one based on design incentives or other market forces if the variations are predictable to one of ordinary skill in the art; (G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention.” Claims 12-13 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over US20140179768 (hereafter “Bettencourt”), as applied to the claims in the rejections above, in view of WO2016172008 (hereinafter “Gao”, of record - cited in IDS). Bettencourt, as applied in the instant rejection, is described in the rejection above. Bettencourt does not teach that the expression cassette encoding the dsRNA comprises a promoter, and a poly A tail wherein the expression cassette is flanked by inverted terminal repeats (ITR)s, wherein the promoter is a liver specific promoter, or that the AAV is comprises an AAV5 capsid protein sequence. Gao teaches a recombinant AAV vector which can be used to deliver RNAi molecules (e.g., see abstract). Gao teaches that the AAV can comprise a promoter, as well as a polyA sequence (see Figure 16 and the description thereof). Gao teaches that the AA can have ITRs (e.g., see claims 1, 4, etc.), and can have an AAV5 capsid protein sequence (e.g., see claim 46). Gao also teaches the use of tissue-specific regulatory sequences including the liver-specific thyroxin binding globulin (TBG) promoter (see page 18, lines 27-33). Therefore, it would have been prima facie obvious to one of ordinary skill in the art prior to the day the claimed invention was filed to substitute the AAV vector taught by Gao, which includes a liver-specific promoter, polyA tail sequence, ITRs flanking an insert sequence, an AAV5 capsid protein sequence for the AAV vector taught by Bettencourt, with a reasonable expectation of success. It would have been a matter of simple substitution of one known element (the AAV vector of Gao) for another (Bettencourt’s AAV vector) to obtain predictable results. Furthermore, there would have been a reasonable expectation of success based on the positive results reported by Gao and Bettencourt. SEQUENCE ALIGNMENT INFORMATION: Publication No. US20140179768A1 GENERAL INFORMATION APPLICANT: ALNYLAM PHARMACEUTICALS TITLE OF INVENTION: ANGIOPOIETIN-LIKE 3 (ANGPTL3) IRNA COMPOSITIONS AND METHODS OF TITLE OF INVENTION: USE THEREOF CURRENT FILING DATE: 2013-12-18 PRIOR APPLICATION NUMBER: PCT/US12/43378 SEQ ID NO 224 LENGTH: 21 Query Match 90.9%; Score 20; Length 21; Qy 2 AGCAAATCTTGATTTTGGCT 21 (SEQ ID NO: 12) ||||||:|::||::::|||| Db 1 AGCAAAUCUUGAUUUUGGCT 20 (BETTENCOURT’S SEQ ID NO: 224) Response to Arguments With respect to the rejection of claims under 35 USC 102, Applicant’s arguments have been fully considered and in view of the amendment to claim 1, are persuasive. The rejection has been withdrawn. With respect to the rejection of claims under 35 USC 103 as set forth herein, Applicant's arguments have been fully considered but they are not persuasive. Applicant argues in order to modify the sequence of Bettencourt to arrive at the claimed sequence would require systematically adding two nucleotides, each of which could be one of G, C, U, or A for every combination of possibly inserted nucleotides, which is estimated to be over 4,500 combinations for the addition of just two nucleotides. In response, Bettencourt indicates that the antisense sequence can be 22 nucleotides in length, thus modifying Bettencourt’s sequence (SEQ ID NO: 224) to arrive at the claimed elected species sequence (SEQ ID NO: 12), there would only need to be 2 additional nucleotides. There are only 16 different possible combinations of the two additional nucleotides, considering that each nucleotide can be any one of 4 different possibilities (G, C, U, A), as 4 x 4 = 16. Thus, instead of over 4,500 possibilities, there are only 16, which is considered to be a finite number of different possibilities. In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Applicant also argues that not all nucleotide sequences have the same inhibitory activity, referring to Figure 3 which applicant cites as evidence that not all sequences have similar outcomes. In response, it is first noted that it is not clear what exactly is disclosed in Figure 3, as the sequence for each miANG construct used to obtain the data of Figure 1 is not provided – thus it is not clear if the miANG sequences are perfectly complementary to the target sequence or not. Nevertheless, Figure 3does appear to show that the miANG constructs did have an inhibitory effect, even if some constructs had less of an inhibitory effect than others. Furthermore, the rejection is based on modifying an oligonucleotide that the art (Bettencourt) teaches is an inhibitory sequence, which only needs to be modified by 2 nucleotides. To be clear, it is not the Examiner’s position that all dsRNA oligonucleotides directed to a target RNA would be expected to be inhibitory. Rather, the Examiner’s position is that Bettencourt teaches an dsRNA inhibitory oligonucleotide that is very similar to the claimed dsRNA oligonucleotide, and that there are a finite number of different possibilities required to arrive at the claimed nucleic acid, it would have been obvious to try the limited number of different possibilities and there would have been a reasonable expectation of success. It is noted that MPEP 2144.08(e) states, “[O]bviousness does not require absolute predictability, only a reasonable expectation of success, i.e., a reasonable expectation of obtaining similar properties.” Such is the case here where there would have been a reasonable expectation of success based on the teachings provided by Bettencourt. Therefore, Applicant’s arguments are not persuasive. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Specifically, the amendment to claim 1 obviates the rejection under 35 USC 102 and necessitates the new grounds for rejection of claim 1 under 35 USC 103. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to J. E. Angell whose telephone number is (571)272-0756. The examiner can normally be reached Monday-Friday (8:30-5:00). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. J. E. Angell Primary Examiner Art Unit 1637 /J. E. ANGELL/ Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Oct 06, 2022
Application Filed
Nov 03, 2025
Non-Final Rejection mailed — §103
Apr 02, 2026
Response Filed
Jun 17, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12746253
BLOOD-BRAIN BARRIER PERMEABLE HETERODUPLEX NUCLEIC ACID
4y 2m to grant Granted Sep 29, 2026
Patent 12741996
Modulation of Wnt5a to Treat Glaucoma
2y 9m to grant Granted Sep 22, 2026
Patent 12741035
UTILIZATION OF GENE TARGETING ANTIBODY FUSION PROTEINS TO PERFORM IN VIVO THERAPEUTIC GENE EDITING
1y 5m to grant Granted Sep 22, 2026
Patent 12709742
RNA expression modulating or editing method via regulation of Cas13 protein
3y 10m to grant Granted Aug 18, 2026
Patent 12702693
TREATMENT OF CYSTIC FIBROSIS BY DELIVERY OF CODON-OPTIMIZED mRNA ENCODING CFTR
4y 10m to grant Granted Aug 11, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
71%
Grant Probability
92%
With Interview (+21.1%)
3y 3m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 827 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month