Prosecution Insights
Last updated: April 19, 2026
Application No. 17/961,097

GENE CONSTRUCTS FOR SILENCING ANGIOPOIETIN-LIKE 3 (ANGPTL3) AND USES THEREOF

Non-Final OA §102§103
Filed
Oct 06, 2022
Examiner
ANGELL, JON E
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Uniqure IP B.V.
OA Round
1 (Non-Final)
71%
Grant Probability
Favorable
1-2
OA Rounds
3y 4m
To Grant
92%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allow Rate
572 granted / 809 resolved
+10.7% vs TC avg
Strong +21% interview lift
Without
With
+21.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 4m
Avg Prosecution
41 currently pending
Career history
850
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
26.8%
-13.2% vs TC avg
§102
25.0%
-15.0% vs TC avg
§112
25.5%
-14.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 809 resolved cases

Office Action

§102 §103
DETAILED ACTION This Action is in response to the communication filed on 07/25/2025. Claims 1-22 are currently pending. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Election/Restrictions Applicant’s election without traverse of Group I and the species: dsRNA, SEQ ID NO: 3, and SEQ ID NO: 12 in the reply filed on 07/25/2025 is acknowledged. Claim 22 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, and claims 2-3, are withdrawn from further consideration as being drawn to a non-elected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 07/25/2025. Claims 1, 4-21 are under consideration. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 4-8, 11, 14, 16-21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by US20140179768 (hereafter “Bettencourt”). Claim 1 is drawn to a nucleic acid comprising a nucleic acid sequence encoding an RNA molecule comprising a first RNA sequence and a second RNA sequence, wherein the first RNA sequence comprises a sequence that is substantially complementary to a target RNA sequence comprised in an RNA encoded by an Angiopoietin-like 3 (ANGPTL3) gene, wherein the sequence substantially complementary to the target RNA sequence has at least 19 nucleotides, and wherein the RNA molecule comprises a double stranded RNA (dsRNA) (the elected species). Regarding the term “substantially complementary”, it is noted that the specification states: The term “substantially complementary”, as used herein, refers to that two nucleic acid sequences are complementary and antiparallel to each other, and thereby the two nucleic acid sequences bind to each other. The term “substantially” means that the complementarity between the two sequences is sufficient to bind to each other for an amount of time sufficient to have an at least partial inhibitory effect. It is preferred of course that the complementarity is complete, but some gaps and/or mismatches may be allowed. The number of mismatches should be no higher than 10%. The important feature is that the complementarity is sufficient to allow for binding of the two strands in situ. The binding must be strong enough to exert an inhibitory effect. (Emphasis added, see page 25, lines 11-19). Accordingly, given the broadest reasonable interpretation consistent with the specification, the claims encompass a nucleic acid encoding a dsRNA molecule that is substantially complementary to a target RNA encoded by an ANGPTL3 gene and wherein the dsRNA comprises a strand that has at least 19 nucleotides complementary to the target RNA, wherein “substantially complementary” means that the complementarity is sufficient to allow for binding of the two strands in situ and the binding must be strong enough to exert an inhibitory effect. Bettencourt teaches dsRNA compositions targeting the ANGPTL3 gene as well as methods of inhibiting expression of ANGPTL3 and treating subjects having a disorder of lipid metabolism using the dsRNA compositions (see abstract). Bettencourt teaches a nucleic acid vector can encode a dsRNA that it complementary to a mRNA encoding ANGPTL3 wherein the dsRNA is 30 base pairs or less and region of complementarity may be 19 to 21 nucleotides in length (see paragraph [0020]). Regarding claim 4, Bettencourt teaches that the region of complementarity to the target sequence is between 15 and 30 nucleotides in length (see [0100]), and further teaches that the dsRNA is between about 25 and about 30 nucleotides in length (see [0101]), including about 30, 29, 28, 27, 26, 25, 24, 23, 22, nucleotides or less in length ([0097]), and teaches a dsRNA wherein the antisense sequence was 23 nucleotides in length ([0367]). Regarding claim 5, Bettencourt teaches that the sequence substantially complementary to the target RNA sequence (i.e., the antisense strand) has at most 30 nucleotides (e.g., see [0020], [0097], [0367], as indicated above). Regarding claims 6-10, Bettencourt teaches a dsRNA wherein the sequence substantially complementary to the target RNA sequence (i.e., the antisense strand sequence) is a 90.9% match with instant SEQ ID NO: 12 (see sequence alignment below). Specifically, Bettencourt teaches a dsRNA identified as Duplex ID AD-45909.1 (see TABLE 3 on page 57) where the antisense strand (SEQ ID NO: 224) is AGCAAAUCUUGAUUUUGGCTT and matches nucleotides 2-21 of instant SEQ ID NO: 12 (see sequence alignment below). Since the dsRNA taught by Bettencourt comprises an antisense sequence 90.9% identical to SEQ ID NO: 12 including 100% match with nucleotides 2-21 of 22 total nucleotides, the dsRNA is necessarily targeted to a sequence of at least one exon comprised in the ANGPTL3 gene, wherein the exon is one of exon 1, exon, 3, exon 5, or exon 6, wherein part of the at least one exon comprises in the ANGPTL3 gene comprises SEQ ID NO: 3 (the elected species). Regarding claim 11, Bettencourt teaches that the dsRNA can be expressed from a DNA vector (e.g., see [0189]). Regarding claim 14, Bettencourt teaches that AAV vectors may be used to deliver the dsRNA of the invention (see [0198]). Regarding claim 16, Bettencourt teaches a composition comprising the AAV vector and an excipient (e.g., see [0198], [0094]-[0095], [0289], etc.). Regarding claims 17-21, Bettencourt teaches that the dsRNA or pharmaceutical comprising thereof, may be used in combination with other pharmaceuticals including statins, and explicitly teaches atorvastatin (e.g., see 0346]). SEQUENCE ALIGNMENT INFORMATION: Publication No. US20140179768A1 GENERAL INFORMATION APPLICANT: ALNYLAM PHARMACEUTICALS TITLE OF INVENTION: ANGIOPOIETIN-LIKE 3 (ANGPTL3) IRNA COMPOSITIONS AND METHODS OF TITLE OF INVENTION: USE THEREOF CURRENT FILING DATE: 2013-12-18 PRIOR APPLICATION NUMBER: PCT/US12/43378 SEQ ID NO 224 LENGTH: 21 Query Match 90.9%; Score 20; Length 21; Qy 2 AGCAAATCTTGATTTTGGCT 21 (SEQ ID NO: 12) ||||||:|::||::::|||| Db 1 AGCAAAUCUUGAUUUUGGCT 20 (BETTENCOURT’S SEQ ID NO: 224) Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 9-10 are rejected under 35 U.S.C. 103 as being unpatentable over US20140179768 (hereafter “Bettencourt”). As indicated in the rejection above, Bettencourt teaches a nucleic acid encoding a dsRNA molecule that is substantially complementary to a target RNA encoded by an ANGPTL3 gene and wherein the dsRNA comprises a strand that has at least 19 nucleotides complementary to the target RNA, wherein the dsRNA, identified as Duplex ID AD-45909.1 (see TABLE 3 on page 57), comprises an antisense strand (SEQ ID NO: 224) that matches nucleotides 2-21 of instant SEQ ID NO: 12. Thus, Bettencourt teaches a dsRNA comprising a sequence that matches 20 contiguous nucleotides of SEQ ID NO: 12, which is 22 nucleotides in length. The only nucleotides of SEQ ID NO: 12 that are not taught by Bettencourt’s SEQ ID NO: 224 is nucleotide 1, and nucleotide 22. It is noted that Bettencourt’s SEQ ID NO: 224 comprises 19 nucleotides perfectly complementary to a sequence encoding ANGPTL3 and an additional 2 nucleotide dTdT sequence at the 3’ end. Bettencourt does not explicitly teach that the antisense sequence is SEQ ID NO: 12 (the elected species). However, since Bettencourt teaches a dsRNA having an antisense sequence perfectly complementary to 19 nucleotides of a sequence encoding ANGPTL3 and further teaches that the antisense sequence can be between 15 and 30 nucleotides in length (see [0100]), including 21-22 nucleotides in length ([0054], [0099]), and about 22 nucleotides in length ([0097]), and further considering that the ANGPTL3 sequence was known (as evidenced by Bettencourt), it would have been prima facie obvious to one of ordinary skill in the art prior to the day the claimed invention was filed to modify the dsRNA taught by Bettencourt to make a dsRNA with an antisense sequence that is 22 nucleotides in length and 100% (i.e., perfectly) complementary to a sequence encoding ANGPTL3 and identical to instant SEQ ID NO: 12, with a reasonable expectation of success. The motivation to make a dsRNA with an antisense sequence 22 nucleotides in length is provided by Bettencourt, which explicitly teaches that the antisense sequence can be 21-22 nucleotides in length (e.g., see [0099]). Furthermore, since Bettencourt teaches a dsRNA with an antisense sequence (SEQ ID NO: 224) wherein nucleotides 1-20 perfectly match nucleotides 2-21 of instant SEQ ID NO: 21, and considering that there are a finite number of possible nucleotides that can be added to the antisense sequence taught by Bettencourt to make an antisense sequence that is 21-22 nucleotides in length and that perfectly match the ANGPTL3 target sequence, It would have been a matter of “obvious to try” using a finite number of different possibilities. Furthermore, there would have been a reasonable expectation of success based on the fact that Bettencourt teaches a functional dsRNA that is 21 nucleotides in length and further based on the fact that a dsRNA with perfectly matched sequence of 22 nucleotides would be expected to be functional as well based on the teachings of Bettencourt (e.g., see [0101]). The combination of prior art cited satisfies the factual inquiries as set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966). Once this has been accomplished the holdings in KSR can be applied (KSR International Co. v. Teleflex Inc. (KSR), 550 USPQ2d 1385 (2007): “Exemplary rationales that may support a conclusion of obviousness include: (A) Combining prior art elements according to known methods to yield predictable results; (B) Simple substitution of one known element for another to obtain predictable results; (C) Use of known technique to improve similar devices (methods, or products) in the same way; (D) Applying a known technique to a known device (method, or product) ready for improvement to yield predictable results; (E) “Obvious to try” – choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success; (F) Known work in one field of endeavor may prompt variations of it for use in either the same field or a different one based on design incentives or other market forces if the variations are predictable to one of ordinary skill in the art; (G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention.” Claims 12-13 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over US20140179768 (hereafter “Bettencourt”), as applied to the claims in the rejections above, in view of WO2016172008 (hereinafter “Gao”, of record - cited in IDS). As indicated in the rejections above, Bettencourt teaches a composition comprising a nucleic acid comprising an expression cassette encoding a dsRNA molecule that is substantially complementary to a target RNA encoded by an ANGPTL3 gene, and teaches that the nucleic acid encoding the dsRNA can be inserted into an AAV vector for delivery. Bettencourt does not teach that the expression cassette encoding the dsRNA comprises a promoter, and a poly A tail wherein the expression cassette is flanked by inverted terminal repeats (ITR)s, wherein the promoter is a liver specific promoter, or that the AAV is comprises an AAV5 capsid protein sequence. Gao teaches a recombinant AAV vector which can be used to deliver RNAi molecules (e.g., see abstract). Gao teaches that the AAV can comprise a promoter, as well as a polyA sequence (see Figure 16 and the description thereof). Gao teaches that the AA can have ITRs (e.g., see claims 1, 4, etc.), and can have an AAV5 capsid protein sequence (e.g., see claim 46). Gao also teaches the use of tissue-specific regulatory sequences including the liver-specific thyroxin binding globulin (TBG) promoter (see page 18, lines 27-33). Therefore, it would have been prima facie obvious to one of ordinary skill in the art prior to the day the claimed invention was filed to substitute the AAV vector taught by Gao, which includes a liver-specific promoter, polyA tail sequence, ITRs flanking an insert sequence, an AAV5 capsid protein sequence for the AAV vector taught by Bettencourt, with a reasonable expectation of success. It would have been a matter of simple substitution of one known element (the AAV vector of Gao) for another (Bettencourt’s AAV vector) to obtain predictable results. Furthermore, there would have been a reasonable expectation of success based on the positive results reported by Gao and Bettencourt. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to J. E. Angell whose telephone number is (571)272-0756. The examiner can normally be reached Monday-Friday (8:30-5:00). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. J. E. Angell Primary Examiner Art Unit 1637 /J. E. ANGELL, Ph.D./Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Oct 06, 2022
Application Filed
Oct 30, 2025
Non-Final Rejection — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600965
MODIFIED DOUBLE STRANDED OLIGONUCLEOTIDE
2y 5m to grant Granted Apr 14, 2026
Patent 12590310
METHODS AND COMPOSITIONS FOR TREATING INFLAMMATORY CONDITIONS ASSOCIATED WITH INFECTIOUS DISEASE
2y 5m to grant Granted Mar 31, 2026
Patent 12584127
EXOSOMES AND MICRO-RIBONUCLEIC ACIDS FOR TISSUE REGENERATION
2y 5m to grant Granted Mar 24, 2026
Patent 12570980
METHODS AND COMPOSITIONS FOR TREATING INFLAMMATORY CONDITIONS ASSOCIATED WITH INFECTIOUS DISEASE
2y 5m to grant Granted Mar 10, 2026
Patent 12559748
COMPOSITIONS AND METHODS FOR THE TREATMENT OF HEMOGLOBINOPATHIES
2y 5m to grant Granted Feb 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
71%
Grant Probability
92%
With Interview (+21.0%)
3y 4m
Median Time to Grant
Low
PTA Risk
Based on 809 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month