Prosecution Insights
Last updated: October 02, 2026
Application No. 17/965,366

COMPOSITIONS AND METHODS FOR THE TREATMENT OF HEMOGLOBINOPATHIES

Non-Final OA §103
Filed
Oct 13, 2022
Priority
Dec 28, 2015 — provisional 62/271,968 +3 more
Examiner
HOLLAND, PAUL J
Art Unit
1656
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Intellia Therapeutics Inc.
OA Round
1 (Non-Final)
58%
Grant Probability
Moderate
1-2
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allowance Rate
449 granted / 781 resolved
-2.5% vs TC avg
Strong +65% interview lift
Without
With
+64.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 12m
Avg Prosecution
45 currently pending
Career history
840
Total Applications
across all art units

Statute-Specific Performance

§101
7.6%
-32.4% vs TC avg
§103
42.9%
+2.9% vs TC avg
§102
13.0%
-27.0% vs TC avg
§112
26.1%
-13.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 781 resolved cases

Office Action

§103
DETAILED CORRESPONDENCE Application Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 2. Applicants’ amendment to the claims filed on 05/05/2026 in response to the Restriction Requirement mailed on 11/06/2025 is acknowledged. This listing of claims replaces all prior listings of claims in the application. 3. Claims 231-252 are pending. Election/Restrictions 4. Applicant's election with traverse of Group I, claims 231-235 and 240-241 in the reply filed on 05/05/2026 is acknowledged. The traversal is on the ground(s) that there would not be a serious burden on the Office to search and examine all of the pending claims of the application together as similar search parameters could be used to search the prior art for all groups. This is not found persuasive because as stated in the Restriction Requirement, the gRNA molecule of invention I can be used for entirely different purposes than the inventions of II, III and IV, and as such it would be serious search burden to examine all possible related art as encompassed by each individual groups. Furthermore, as it relates to the subcombinations of Inventions I and II, any claim(s) depending from or otherwise requiring all the limitations of the allowable subcombination will be examined for patentability. The requirement is still deemed proper and is therefore made FINAL. 5. Applicant’s election without traverse of the species SEQ ID NO: 253 in the reply filed on 05/05/2026 is acknowledged. 6. Applicant's election with traverse of the species SEQ ID NO: 7811 in the reply filed on 05/05/2026 is acknowledged. The traversal is on the ground(s) that the Office has not demonstrated that a serious search and/or burden exists. This is not found persuasive because as stated in the Restriction Requirement, each sequence has a unique structure and function. As such, a search for each sequence would require a different field of search and examination of art pertinent to said species, and the search of one of the species is not likely to result in the finding of art pertinent to all of the other species. The requirement is still deemed proper and is therefore made FINAL. 7. Claims 236-239 and 246-250 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 05/05/2026. Claims 231-235 and 240-241 are pending and will be examined to the extent they read on the species SEQ ID NO: 253 and 7811. Priority 8. Acknowledgement is made of this continuation of U.S. Non-provisional Application No. 16/066617, filed on 06/27/2018, which is a national stage entry of PCT/IB2016/058007, filed on 12/26/2016, which claims domestic priority to U.S. Provisional Application No. 62/347484 and 62/271968, filed on 06/08/2016 and 12/28/2015, respectively. Information Disclosure Statement 9. The IDSs filed on 09/14/2023 and 05/06/2026 have been considered by the examiner and a copy of the Form PTO/SB/08 is attached to the office action. Drawings 10. The Drawings filed on 10/13/2022 are acknowledged and accepted by the examiner. Specification 11. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. In the instant case, p. 43, 60, 379, 383, and 464 have embedded hyperlinks. Claim Rejections – 35 USC § 103 12. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 13. Claim(s) 231-232, 234 and 240-241 is/are rejected under 35 U.S.C. 103 as being unpatentable over Friedland et al. (WO 2015/148860 A1, filing date 03/26/2014; cited on IDS filed on 09/14/2023) in view of Orkin et al. (US Patent Application Publication 2015/0132269 A1, filed on 11/13/2014; cited on IDS filed on 09/14/2023). 14. Claims 231-232 and 234 are drawn in relevant part to a gRNA molecule comprising a tracr and crRNA, wherein the crRNA comprises a targeting domain that is complementary with a target sequence of a human BCLa enhancer, wherein the targeting domain comprises SEQ ID NO: 253. Claim 240 is drawn to a polynucleotide comprising a nucleic acid sequence that encodes the gRNA molecule of claim 231. Claim 241 is drawn to a vector comprising the polynucleotide of claim 240. 15. With respect to claims 231-232 and 240, Friedland et al. teach a gRNA molecule comprising a tracr and crRNA, wherein the crRNA comprises a targeting domain that is complementary with a target sequence of a human BCL11a enhancer [see Abstract; p. 2-3; p. 8, lines 11-27; p. 498; p. 642, lines 8-17]. With respect to claim 234, Friedland et al. teach the gRNA molecule wherein one or more nucleic acid molecules of the gRNA molecule comprises a phoshorotioate at the 3’ end or 5’ end or 2’ methyl modification of one or more nucleic acid molecules [see p. 64]. With respect to claim 241, Friedland et al. teach a vector comprising the polynucleotide encoding the gRNA [see p. 611, lines 5-21]. However, Friedland et al. does not teach the gRNA of claims 231-232, 234, and 241 comprising or consisting of SEQ ID NO: 253. Orkin et al. teach methods for genome engineering and targeting of BCL11a enhancer region with TALEN effectors or CRISPR/Cas systems that target the targeting domain of SEQ ID NO: 253 [see Abstract, paragraphs 0012-0015; 0022; alignment attached as APPENDIX A]. Before the effective filing date of the claimed invention, it would have been obvious for one of ordinary skill in the art to combine the teachings of Friedland et al. and Orkin et al. according to the teachings of Orkin et al. to design a gRNA to target SEQ ID NO: 253 because Friedland et al. teach a gRNA molecule comprising a tracr and crRNA for targeting of a BCL11a enhancer sequence. Orkin et al. teach similar methods for genome engineering of BCL11a enhancer region wherein the targeting sequence is SEQ ID NO: 253 of the BCL11a enhancer region. One of ordinary skill in the art would have had a reasonable expectation of success and a reasonable level of predictability to combine the teachings of Friedland et al. and Orkin et al. because Orkin et al. acknowledges targeting regions of BCL11a that are useful for gene therapy and genome engineering. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. 16. Claim 233 is rejected under 35 U.S.C. 103 as being unpatentable over Friedland et al. (WO 2015/148860 A1, filing date 03/26/2014; cited on IDS filed on 09/14/2023) in view of Orkin et al. (US Patent Application Publication 2015/0132269 A1, filed on 11/13/2014; cited on IDS filed on 09/14/2023) as applied to claims 231-232, 234 and 240-241 above, and further in view of Joung et al. (US Patent 9885033, filed 03/14/2014; examiner cited). 17. The relevant teachings of Friedland et al. and Orkin et al. as applied to claims 231-232, 234, and 240-241 are set forth above. 18. However, the combination of Friedland et al. and Orkin et al. does not explicitly teach SEQ ID NO : 7811. Joung et al. teach methods for increasing the specificity of RNA-guided genome editing using CRISPR/Cas9 systems using synthetic gRNA wherein one or more nucleotides are modified having a target complementary region flanked at the 3’ end with uracil nucleotides sharing 100% sequence identity to SEQ ID NO: 7811 [see Abstract; column 2; alignment attached as APPENDIX B]. Before the effective filing date of the claimed invention, it would have been obvious for one of ordinary skill in the art to combine the teachings of Friedland et al., Orkin et al. and Joung et al. according to the teachings of Joung et al. because Friedland et al. and Orkin et al. teach gRNA for targeted genome engineering using CRISPR/Cas systems. Joung et al. teach synthetic gRNA systems that increase specificity of RNA-guided genome editing. One of ordinary skill in the art would have had a reasonable expectation of success and a reasonable level of predictability to combine the teachings of Friedland et al., Orkin et al. and Joung et al. because Joung et al. acknowledges that these synthetic gRNA systems increase the specification of CRISPR/Cas genome editing systems. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Conclusion 19. Status of the claims: Claims 231-252 are pending. Claims 236-239 and 246-250 stand withdrawn pursuant to 37 CFR 1.142(b). Claims 231-234 and 240-241 are rejected. No claims are in condition for an allowance. Any inquiry concerning this communication or earlier communications from the examiner should be directed to PAUL J HOLLAND whose telephone number is (571)270-3537. The examiner can normally be reached Monday to Friday from 8AM to 5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath Rao can be reached at 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /PAUL J HOLLAND/Primary Examiner, Art Unit 1656 APPENDIX A Orkin et al. with SEQ ID NO: 253 CC PN US2015132269-A1. XX CC PD 14-MAY-2015. XX CC PF 13-NOV-2014; 2014US-00540729. XX PR 13-NOV-2013; 2013US-0903823P. PR 26-AUG-2014; 2014US-0042075P. XX CC PA (ORKI/) ORKIN S H. CC PA (REIK/) REIK A. CC PA (URNO/) URNOV F. XX CC PI Orkin SH, Reik A, Urnov F; XX DR WPI; 2015-30268U/34. XX CC PT New genetically modified cell comprising a genomic modification within CC PT endogenous B-cell chronic lymphocytic leukemia/lymphoma-11A enhancer CC PT sequence, made by a nuclease, useful e.g. to treat a patient having a CC PT globinopathy e.g. thalassemia. XX CC PS Claim 7; SEQ ID NO 40; 111pp; English. XX CC The present invention relates to a novel genetically modified cell, CC useful for treating a patient having globinopathy. The genetically CC modified cell comprises a genomic modification made by a nuclease, where CC the genomic modification is within an endogenous BCL11A enhancer CC sequence, the nuclease is zinc finger nuclease (ZFN) or transcription CC activator-like effector nuclease (TALEN), and the genomic modification is CC one of insertions and/or deletions. The invention further relates to: (1) CC a genetically modified differentiated cell descended from the stem cell; CC (2) a DNA-binding protein comprising a zinc finger protein or a TALE- CC effector protein (TALE); (3) a fusion protein comprising a zinc finger CC protein (ZFP) or TALE protein and a wild-type or engineered cleavage CC domain or cleavage half-domain; (4) a polynucleotide encoding the DNA- CC binding protein; (5) an isolated hematopoietic stem cell comprising the CC DNA-binding protein or its encoding polynucleotide; (6) a kit comprising CC the DNA-binding protein; (7) a method for altering globin gene expression CC in a cell, which involves introducing into the cell at least one CC polynucleotide, under conditions so that the proteins are expressed and CC expression of the globin gene is altered; (8) a method for producing the CC genetically modified cell; (9) a kit for producing the genetically CC modified cell; and (10) a method for treating a patient in need of an CC increase in globin gene expression. The genetically modified cell of the CC invention can be used for treating a patient in need of an increase in CC globin gene expression, where the patient is known to have, is suspected CC of having, or is at risk of developing a genetic disease, e.g., CC hemoglobinopathy (thalassemia (beta-thalassemia) or sickle cell disease CC (sickle cell anemia)). The present sequence is a human BCL11A enhancer CC region fragment sequence, used in the invention as a target for TALEN, CC which is altered for increasing globin gene expression. XX SQ Sequence 21 BP; 6 A; 5 C; 2 G; 8 T; 0 U; 0 Other; Query Match 100.0%; Score 20; Length 21; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTAACAGTTGCTTTTATCAC 20 |||||||||||||||||||| Db 1 CTAACAGTTGCTTTTATCAC 20 APPENDIX B Joung et al. with SEQ ID NO: 253 US-14-776-620A-15 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 15, US/14776620A Patent No. 9885033 GENERAL INFORMATION APPLICANT: THE GENERAL HOSPITAL CORPORATION TITLE OF INVENTION: INCREASING SPECIFICITY FOR RNA-GUIDED GENOME EDITING FILE REFERENCE: 40174-0009US1 CURRENT APPLICATION NUMBER: US/14/776,620A CURRENT FILING DATE: 2015-09-14 PRIOR APPLICATION NUMBER: PCT/US2014/029304 PRIOR FILING DATE: 2014-03-14 PRIOR APPLICATION NUMBER: 61/921,007 PRIOR FILING DATE: 2013-12-26 PRIOR APPLICATION NUMBER: 61/838,178 PRIOR FILING DATE: 2013-06-21 PRIOR APPLICATION NUMBER: 61/838,148 PRIOR FILING DATE: 2013-06-21 PRIOR APPLICATION NUMBER: 61/799,647 PRIOR FILING DATE: 2013-03-15 NUMBER OF SEQ ID NOS: 115 SEQ ID NO 15 LENGTH: 80 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic guide RNA oligonucleotide FEATURE: NAME/KEY: misc_feature OTHER INFORMATION: Description of Combined DNA/RNA Molecule: Synthetic guide RNA oligonucleotide Query Match 100.0%; Score 80; Length 80; Best Local Similarity 72.5%; Matches 58; Conservative 22; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT 60 |::::|||||:|||||:||||||::||||:|||||:||:|||::|:||||::|||||||: Db 1 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 60 Qy 61 GGCACCGAGTCGGTGCTTTT 80 |||||||||||||:||:::: Db 61 GGCACCGAGTCGGUGCUUUU 80
Read full office action

Prosecution Timeline

Oct 13, 2022
Application Filed
Jul 07, 2026
Non-Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747432
Modulating Human Cas9-Specific Host Immune Response
2y 2m to grant Granted Sep 29, 2026
Patent 12734252
ADENO-ASSOCIATED VIRAL VECTOR VARIANTS
2y 11m to grant Granted Sep 15, 2026
Patent 12729227
DECORIN COMPOSITIONS AND USE THEREOF
5y 2m to grant Granted Sep 08, 2026
Patent 12729391
BACILLUS CELL WITH REDUCED LIPASE AND/OR ESTERASE SIDE ACTIVITIES
3y 5m to grant Granted Sep 08, 2026
Patent 12708651
METHODS AND COMPOSITIONS USING BIFIDOBACTERIUM LONGUM TO MODULATE EMOTIONAL REACTIVITY AND TREAT OR PREVENT SUB-CLINICAL MOOD DISTURBANCES
5y 9m to grant Granted Aug 18, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+64.6%)
2y 12m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 781 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month