DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This application is a divisional of US application no. 16/02,570, filed 10/10/2018 (now abandoned), which was the national stage of PCT/EP17/59075, filed 04/14/2017, claiming foreign priority benefit of IT102016000039154, filed 04/15/2016.
Election/Restrictions
Applicant’s election without traverse of Group I in the reply filed on 16 February 2026 is acknowledged.
Claims 22 and 27 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 16 February 2026.
Claims 6-21 and new claims 28-30 correspond to elected Group I and are now under consideration herein.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see page 65). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d) (see in particular pages 34, 47, 52-53, and 59).
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d) (see in particular Figures 1-2 and 5). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
As the Drawings have been accepted, it is suggested that a substitute specification be provided (particularly as one is already required for related reasons, as indicated above).
Claim Interpretation
With regard to the term “low-pass whole genome sequencing” (see lines 1-2 of independent claim 6), the specification states (see page 14 of the specification):
By the term “Low-pass whole genome sequencing” it is intended a whole genome sequencing at a mean sequencing depth lower than 1.
By the term “Mean sequencing depth” it is intended here, on a per-sample basis, the total of number of bases sequenced, mapped to the reference genome divided by the total reference genome size. The total number of bases sequenced and mapped can be approximated to the number of mapped reads times the average read length.
Regarding the term “primary WGA DNA library (pWGAlib)”, it is noted that the specification states that this term refers to “a DNA library obtained from a WGA reaction” (see page 12).
Regarding the term “WGA library universal sequence adaptor”, based on the discussion of this term at pages 10-11 of the specification, this term is interpreted as encompassing any additional oligonucleotide of known sequence attached to or incorporated into template/target molecules of a WGA library.
Regarding claim 6 and claims dependent therefrom, it is noted that the recitation of “providing….obtained by:” (see lines 3-4) is interpreted as encompassing the subsequently recited “providing a primary WGA DNA library” and “re-amplifying the primary WGA DNA library” using 1PR and 2 PR primers, with the subsequently recited “pooling” and “sequencing” being interpreted as activities separate from the initial “providing….obtained by”. This interpretation is supported by the recitation of “and” between the “providing a library” and “re-amplifying” (such that these activities appear to be a combination of sub-steps), the use in the re-amplifying of primers including a primer required to include a sequencing barcode (such that these activities would be expected to result in provision of “barcoded” libraries), the fact that the “pooling” (while unclear) requires “different sequencing barcodes”, and the fact that the intended use of the claim is a “method of sequencing”, suggesting that the final recited activity of “sequencing” is a separate step (rather than an element of the “providing….libraries obtained by”).
Claim Objections
Claims 6-21 and 28-30 are objected to because of the following informalities: in independent claim 6 at line 5, the abbreviation “WGA” is employed without first providing the complete terminology (whole genome amplification). Appropriate correction is required; it is noted that, e.g., page 1 of the specification provides basis for reciting “Whole Genome Amplification (WGA)”.
Claims 29-30 are objected to because of the following informalities: in claim 29 at line 2, the abbreviation “DRS” is employed without first providing the complete terminology (Deterministic-Restriction Site). Appropriate correction is required; it is noted that, e.g., page 32 of the specification provides basis for reciting “Deterministic-Restriction Site (DRS)”.
Claim Rejections - 35 USC § 112(b)/second paragraph
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6-21 and 28-30 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 6-21 and 28-30, the claims are indefinite because it is unclear whether the claims do or do not require “low-pass whole genome sequencing”. While the preamble of independent claim 6 recites a method “for low-pass whole genome sequencing”, the body of claim 6 never employs this terminology, and the active steps of claim 6 conclude with the recitation “sequencing the pooled library”. As some persons of ordinary skill in the art would interpret the claim as requiring a sequencing meeting the requirement of being “low-pass” (given the language of the preamble), while others would interpret this as merely an intended use/application, with the claim actually encompassing any “sequencing”, further clarification is required to ensure that the boundaries of the claims are clear. For purposes of further examination, the claims have been interpreted as embracing any type of “sequencing” as set forth in the active steps of claim 6, as the claim language cannot currently be interpreted as clearly requiring “low-pass” sequencing.
Regarding claims 6-21 and 28-30, independent claim 6 recites the limitation "the original unamplified DNA prior to WGA" in lines 11-12. There is insufficient antecedent basis for this limitation in the claim, as the claim does not previously refer to “original unamplified DNA prior to WGA” or an apparently equivalent thereof.
Claims 6-21 and 28-30 are indefinite over the recitation in independent claim 6 of the limitation “pooling samples obtained using different sequencing barcodes (BC)” (see line 17), because it is unclear how this limitation relates to the rest of the claim. While the claim does previously refer to providing “a plurality of barcoded massively-parallel sequencing libraries”, there is no prior use of the term sample/samples in the claim, and it is not clear whether the activity of “pooling samples” necessarily relates to the prior providing of “libraries”, or (given the use of different terminology) embraces the “pooling” of something broader/different (so long as the “samples” involved were “obtained using different sequencing barcodes”. As there are multiple reasonable interpretations of the claim language having different meanings and boundaries, further clarification is needed.
Regarding claims 6-21 and 28-30, independent claim 6 recites the limitation "the pooled library” in line 18. There is insufficient antecedent basis for this limitation in the claim, as while the claim does previously refer to multiple libraries and also recite a pooling of “samples”, there is no prior reference to a “pooled library”, and it is not clear what previously recited product(s) correspond to the limitation “the pooled library”. Further, given this lack of clear antecedent basis, it is not clear with respect to what product/sample/library/etc. the “sequencing” of the claim is to be performed. Further clarification is required.
Claims 7-21 are indefinite over the recitation of the limitation “the step of pooling samples using different sequencing barcodes” in claim 7 because it is unclear what is being referenced. Claim 6, from which these claims depend, recites an activity of “pooling samples obtained using different sequencing barcodes”, but this is not equivalent to “pooling samples using” barcodes, and there is no other activity in the claims that appears to correspond to what is required by claim 7. Clarification is therefore required.
Claims 7-21 are also indefinite over the recitation in claim 7 of the limitation “normalizing the amount of barcoded, massively-parallel sequencing libraries” because it is unclear where or with respect to what such “normalizing” takes place. While it is clear that “normalizing” embraces such activities as adjusting concentration to a desired proportion (including the embodiment of equalizing amounts), it is not clear whether this claim language – particularly in view of the recitation of “the amount” (which lacks antecedent basis) - is intended to require that multiple libraries be combined and normalized within a common solution or “pool”, whether such “normalizing” may occur in separate environments, etc. Clarification is required to ensure that the boundaries of the claims are clear.
Regarding claims 8-21, in view of the recitation in claim 8 of the limitation ‘wherein the step of pooling samples using different sequencing barcodes (BC) further comprises the step of selecting DNA fragments…” – which is a further limitation of an activity that is not itself clear and definite (i.e., the activity of “pooling samples using different” BC) – it is also unclear how the “selecting DNA fragments” of claim 8 and claims dependent therefrom relates to and further limits the claims.
Claims 15-21 are indefinite over the recitation in claim 15 of the limitation “further comprising the step of selecting DNA fragments comprising the first sequencing adaptor and the second sequencing adaptors”. As the claims previously recite “at least one second sequencing adaptor” but not multiple “second sequencing adaptors”, clear antecedent basis is lacking, and it is unclear whether the claims embrace fragments including any such second adaptors, whether the claims are referencing particular multiple “second sequencing adaptors”, etc. Further clarification is therefore required.
Regarding claims 16-21, regarding the recitation of the limitation “the step of selecting DNA fragments comprising the first sequencing adaptor and the second sequencing adaptors is carried out by contacting the massively parallel sequencing library to at least one solid phase”, it is noted that: a) the reference to “the second sequencing adaptors” is unclear for the reasons noted above regarding claim 15; and b) the limitation “the massively parallel sequencing library” lacks clear antecedent basis, as the claims previously recite multiple “massively-parallel sequencing libraries” as well as a ”primary WGA library” and a “pooled library”, but do not reference a single “massively parallel sequencing library”. Further clarification is needed.
Claims 19-20 are indefinite over the recitation in claim 19 of the limitation “selected fragments are obtained eluting from the beads non-biotinylated ssDNA fragments” (see lines 3-4). This language appears to be an incomplete phrase, and it is not clear whether the claim language requires that “selected fragments” are in fact “non-biotinylated ssDNA fragments”, or something other than such fragments, etc. (such that there are multiple reasonable interpretations of the claim language having different meanings). Further clarification is needed.
Regarding claim 21, the limitation “the retained ssDNA fragments” lacks clear antecedent basis, as the claims do not previously refer to such fragments. Further clarification is therefore needed regarding what fragments are being referenced/required.
Claim 30 is indefinite over the recitation of the limitation “and the MALBAC library universal sequence adaptor is SEQ ID NO: 283 (MALBAC)”. First, as there is no prior reference to a “MALBAC library universal sequence adaptor”, there is insufficient antecedent basis for this limitation in the claims. Second, it is not clear how the inclusion of the limitation “(MALBAC)” might further limit SEQ ID NO: 283. Finally, as there is no prior recitation of or requirement for anything related to preparation of a “MALBAC library”, it is unclear how and whether the inclusion of this limitation further limits what is being claimed (particularly as claims 29-30 recite a requirement for a DRS-WGA library universal sequencing adaptor). Clarification is therefore required.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 6-15 and 28 are rejected under 35 U.S.C. 103 as being unpatentable over Kurihara et al (WO 2014/071361 A1 [08 May 2014]; cited in IDS) in view of Rohland et al (Genome Research 22:939-946 [2012]; cited herein) and Singh et al (Molecular and Cellular Probes 27:80-85 [2013]; cited herein).
Kurihara et al teach methods of “barcoding nucleic acids, such as genomic DNA”, with the invention generally being directed to methods “of making dual barcoded nucleic acid molecules for sequencing” (see entire reference, particularly the Abstract and paragraph 6). The methods of Kurihara et al are disclosed as generally comprising steps of added a first barcode to a nucleic acid molecule terminus via the couple of stem-loop oligonucleotides, followed by addition of a second barcode via the use of a primer complementary to the first barcode in nucleic acid extension or amplification/PCR (see, e.g., paragraphs 7 and 31-32). Regarding the “providing”, “pooling”, and “sequencing” of independent claim 6, Kurihara et al teach that prior art methods of sequencing a gDNA library may comprise, e.g., preparation of a gDNA fragment library via ligation of barcoded adaptors, followed by amplification and pooling or pooling and amplification, which approach requires a large population of different ligation adaptors (paragraph 33). Kurihara et al teach that their methods provide an improvement via use of a smaller number of ligated adaptors including “first” barcodes, followed by introduction of additional/second barcodes in primer sequences (paragraphs 34-36). With regard to the structure of the fragments of the ”primary” library set forth in claim 6, Kurihara et al also teach a preferred embodiment of their methods in which step-loop adaptors comprising a common/identical inverted repeat are coupled to each end of the target/insert for sequencing, resulting in a “nucleic acid molecule comprising terminal inverted repeats thereby allowing the molecule to form a stem-loop” (see paragraphs 10 and 53; see also Fig. 2), such that Kurihara et al teach “library fragments” for sequencing that meet the structural requirements of a 3SS reverse complementary to a 5SS. It is noted that Kurihara et al teach attaching stem-loop oligonucleotides to sequencing templates/targets via blunt-end ligation (see, e.g., paragraphs 9 and 54), and also teach that their primers incorporating second barcodes may include a 3’-portion that anneals to the first barcode and a 5’ portion comprising the second barcode, which is consistent with the orientation of both the first primer (IPR) and second primer (2PR) of claim 6 (see, e.g., paragraphs 34-36, and 56, and see again Fig 2). Kurihara et al thus teach methods of preparing a gDNA sequencing library including “providing” fragments possessing the required structural orientation and features of claim 6 other than explicitly teaching a “WGA library” and “WGA library universal sequence adaptor”, as well as the re-amplifying of such a library with primers including a primers that incorporate second barcodes, as well as pooling and sequencing such amplification products. It is also noted that Kurihara et al tout the flexibility of their methods, stating that “the present invention may be used in combination with a wide variety of techniques for generating a nucleic acid library”, citing several examples (paragraph 17).
While Kurihara et al clearly teach the practice of their methods on genomic DNA, they fail to explicitly teach sequencing of whole genome amplification (WGA) products and the use of a WGA library universal sequence adaptor (nor does Kurihara et al discuss “low-pass whole genome sequencing”, although it is reiterated that the claims are not presently clearly limited by the inclusion of this claim language). Kurihara et al also fail to teach the use of two primers having all required structural elements of 1PR and 2 PR of claim 6.
Rohland et al teach methods of preparation for high-throughput DNA sequencing libraries, which methods are taught as involving library preparation via a modified blunt-end ligation method “originally developed for the 454 Life Sciences (Roche) platform”, as well as incorporation of adaptors and barcodes, including “second barcodes”, depending upon the intended application (see entire reference, particularly page 939, right column-page 941, including Figure 2). Among the applications of such methods taught by Rohland et al are low-pass whole genome sequencing, with Rohland et al stating that such methods may be used to produce libraries usable in low-pass whole genome sequencing (see Abstract and page 943, left column); it is further noted that such libraries inherent constitute a type of “barcoded, massively-parallel sequencing libraries” given the manner in which Rohland et al employ the libraries.
Singh et al also teach methods of massively parallel sequencing employing the 454 platform (i.e., the same platform taught by Rohland et al), which methods employ hairpin selectors/adaptors attached to each end of a template, followed by amplification with multiple primers, each comprising a 3’-located adaptor-targeting sequencing, as well as (from 5’ to 3’) a 454-platform specific adaptor, a 4 bp key, and 10 bp multiplex adaptor (MID). Singh et al thus teach the use of primers pairs meeting the requirements of 1PR and 2PR of claim 6 (as well as dependent claim 28), which primers are taught as being used for enrichment of target amplicons, and which are disclosed as being pooled and sequenced following enrichment (see entire reference, particularly pages 80-81, including the Abstract, Fig 1. And the Materials and Methods on page 81, both columns). Singh et al teach that their method is a “novel target enrichment method for 454 pyrosequencing” providing a “feasible and practical way to analyze a large set of” targets, and further that “the number of target genes and test strains could be readily increased” (page 82, right column, last paragraph).
In view of the teachings of Rohland et al and Singh et al, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the methods of Kurihara et al so as to have employed as amplification targets WGA library fragments having the properties taught by Rohland et al (including the presence therein of a WGA library universal sequencing adaptor). Kurihara et al teach the use in their methods of genomic DNA and amplification products thereof, and teach that their method is adaptable for use in a variety of applications, while Rohland et al provide several examples of library types that are targets of high-throughput sequencing, of which WGA libraries are one disclosed type. Thus, an ordinary artisan would have recognized the use of a WGA library/library fragments as input for the method of Kurihara et al as the simple substitution of one known type of library target for another to achieve the predicable result of obtaining sequencing data of interest to a practitioner. Further, given Rohland et al’s disclosure of the use of such a library in low-pass sequencing, an ordinary artisan would have been motivated to have performed low-pass sequencing on such a library (although it is reiterated that the claims do not clearly require low-pass sequencing). Furthermore, given the successful target enrichment and discrimination disclosed by Singh et al as being provided by the use of their primer pairs/combinations, an ordinary artisan also would have been motivated to have modified the primers of Kurihara et al so as to have incorporated the further structural elements taught by Singh et al into both primers employed during re-amplification of library fragments, simply for the benefit of improving enrichment while also facilitating discrimination of a greater number of targets. Additionally, given the detailed guidance provided by each of Kurihara et al, Rohland et al, and Singh et al and the adaptability of their methods taught by Kurihara et al, an ordinary artisan would have had a reasonable expectation of success in performing such methods.
With further regard to dependent claim 7 and claims dependent therefrom, Rohland et al teach that quantitating and normalizing are employed when pool samples to ensure even read coverage of samples being sequenced simultaneously (see page 945, left column), such that the combined teachings of Kurihara et al, Rohland et al, and Singh et al suggest such further steps (for the benefit of obtaining even read coverage, as taught by Rohland et al). Regarding claim 8 and claims dependent therefrom, and particularly claims 9-14, Rohland et al disclose targeting a mean insert of 300 bp (and attempting to remove fragments larger than 400 and smaller than 200 bp) (page 944, right column), Singh et al teach a target size of approximately 200-400 bp but employ an enzyme generating fragments from 191-604 bp in length for their target genes (page 81, right column), and Kurihara et al teach that their methods may be used to target inserts/templates of a desired minimal size while excluding undesirable short products such as adaptor dimers (see, e.g., paragraphs 45-46). Given these teachings, the prior art suggests methods in which any of a range of sizes and/or target size may be selected, which size may vary depending upon the goals and preferences of a practitioner, and thus (absent a showing of unexpected results) is sufficient to suggest any of the various targets of claims 9-14. Regarding claim 15, it is reiterated that Singh et al disclose selection of fragments comprising both first and second sequencing adaptors, such that the combined teachings of Kurihara et al, Rohland et al, and Singh et al suggest what is claimed. Regarding claim 28, it is reiterated that Singh et al disclose first and second primers meeting the requirements of the claims, as discussed above.
Claim(s) 16-21 are rejected under 35 U.S.C. 103 as being unpatentable over Kurihara et al in view of Rohland et al and Singh et al, as applied to claim 6-15 and 28 above, and further in view of Galan et al (BMC Genomics 11:296 [2010]; cited herein).
The relevant teachings of Kurihara et al, Rohland et al, and Singh et al are set forth above. It is further noted that Rohland et al disclose that a biotinylated bait may be used to capture library molecules (see Figure 2); however, none of Kurihara et al, Rohland et al, and Singh et al teach solid phase selection/capture of fragments comprising first and second sequencing adaptors (as set forth in claim 16), including via the preferred procedures of claims 17-21 (involving the use of streptavidin coated paramagnetic beads to capture biotinylated fragments).
Galan et al teach a 454 high throughput multiplex sequencing method in which biotinylated primers complementary to adaptor sequences are employed in capturing template amplicons, which are subsequently separated via the use of streptavidin-coated magnetic beads; the capture procedure also employs incubation, washing, and elution (see entire reference, particularly page 5, left column). In view of the teachings of Galan et al, and particularly given the indefiniteness of the claims, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have included steps of capturing sequencing templates via the use of biotin labeled primers, capture of such labeled produces via streptavidin coated beads, washing, and elution, and thereby to have performed methods meeting the requirements of claims 16-21 (as well as, e.g., related methods involving these same well-known, routine techniques for capturing targets of interest). An ordinary artisan would have been motivated to have so modified the methods of Kurihara et al, Rohland et al, and Singh et al simply for the benefit of capturing targets of interest for further analysis, sequencing, etc. Further, given the detailed guidance provided by all of Kurihara et al, Rohland et al, Singh et al, and Galan et al, an ordinary artisan would have had a reasonable expectation of success in performing such methods.
Claim(s) 29-30 are rejected under 35 U.S.C. 103 as being unpatentable over Kurihara et al in view of Rohland et al and Singh et al, as applied to claim 6-15 and 28 above, and further in view of Fontana et al (WO 2014/068519 A1 [08 May 2014]; cited in IDS).
It is reiterated that the claims do not previously reference or require use of a “MALBAC” adaptor, and that it is not clear how such an adaptor relates to what is being claimed; accordingly this rejection addresses the “DRS-WGA” adaptor of SEQ ID NO: 282 (which is a product/material actually required by the methods as claimed; see claim 29).
The relevant teachings of Kurihara et al, Rohland et al, and Singh et al are set forth above. While the methods suggested by the teachings of Kurihara et al, Rohland et al, and Singh et al clearly employ adaptors, including adaptors meeting the requirements of a WGA library adaptor as set forth in claim 6, the particular type of adaptor specified in claims 29-30 is not taught by any of Kurihara et al, Rohland et al, and Singh et al.
Fontana et al disclose methods of deterministic restriction-site whole genome amplification (DRS-WGA; see page 2) in which SEQ ID NO: 1 is employed as a universal primer; see Example 1 at page 16, as well as the illustration in Figure 2.
SEQ ID NO: 1 of Fontana et al aligns with instant SEQ ID NO: 282 as shown:
Query Match 100.0%; Score 21; Length 21;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AGTGGGATTCCTGCTGTCAGT 21
|||||||||||||||||||||
Db 1 AGTGGGATTCCTGCTGTCAGT 21
Fontana et al further teach using SEQ ID NO: 1 in designing primers for use in their improved methods of target sequence detection (see entire reference, and see again page 16).
In view of the teachings of Fontana et al, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have employed a library prepared using and containing the DRS-WGA library universal adaptor of SEQ ID NO: 1, as taught by Fontana et al – corresponding to instant SEQ ID NO: 282 - in the methods suggested by Kurihara et al, Rohland et al, and Singh et al. Given that Fontana et al teach that their SEQ ID NO: 1 is a known WGA universal adaptor, an ordinary artisan would have recognized such a modification as the simple substitution of one well-known target library type for another, usable in achieving the predicable result of sequencing a target library or libraries of interest. Additionally, to the extent that the claimed methods might involve the preparation of such libraries for sequencing, an ordinary artisan would have recognized such a modification as providing the benefit of savings in time, specifically in using an adaptor known to function successfully in such library preparation (as compared to, e.g., experimenting to identify such a usable universal adaptor). Given the guidance and teachings of Kurihara et al, Rohland et al, Singh et al, and Fontana et al, an ordinary artisan also would have had a reasonable expectation of success in performing such methods.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DIANA B JOHANNSEN whose telephone number is (571)272-0744. The examiner can normally be reached Monday-Friday, 7:30 am-3:30 pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached at (571) 272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DIANA B JOHANNSEN/Primary Examiner, Art Unit 1682