Prosecution Insights
Last updated: August 06, 2026
Application No. 17/970,170

IMMUNOSTIMULATORY COMPOSITIONS

Non-Final OA §102§103§112
Filed
Oct 20, 2022
Priority
Apr 10, 2020 — EU 20169224.1 +1 more
Examiner
POPA, ILEANA
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
BAYER AKTIENGESELLSCHAFT
OA Round
1 (Non-Final)
22%
Grant Probability
At Risk
1-2
OA Rounds
11m
Est. Remaining
36%
With Interview

Examiner Intelligence

Grants only 22% of cases
22%
Career Allowance Rate
179 granted / 834 resolved
-38.5% vs TC avg
Moderate +15% lift
Without
With
+14.6%
Interview Lift
resolved cases with interview
Typical timeline
4y 8m
Avg Prosecution
59 currently pending
Career history
895
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
48.1%
+8.1% vs TC avg
§102
7.7%
-32.3% vs TC avg
§112
21.0%
-19.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 834 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 1. Claims 12-15 have been cancelled. Claims 4-11 have been amended. Claims 16-24 are new. Claims 1-11 and 16-24 are pending and under examination. Claim Objections 2. Claim 1 should be rewritten as follows: An immunostimulatory composition comprising a liposome-nucleic acid complex wherein said complex contains: - a liposome comprising or consisting of a zwitterionic lipid and a cationic lipid; and - one or more immunostimulatory oligonucleotides and/or one or more immunostimulatory polynucleotides. 3. Claim 3 is objected to because of the recitation “wherein the zwitterionic lipid used as the first lipid is”. Appropriate correction to “wherein the zwitterionic lipid is” is required. 4. Claim 4 should recite “The immunostimulatory composition of claim 1, wherein the cationic lipid is selected from”. 5. Claim 5 should be rewritten as follows: The immunostimulatory composition of claim 1, wherein the zwitterionic lipid is DOPE and the cationic lipid is DOTMA or wherein the zwitterionic lipid is DOPE and the cationic lipid is DOTAP. 6. Claim 6 should be rewritten as follows: The immunostimulatory composition of claim 1, wherein the zwitterionic lipid constitutes at least 40 wt % based on the total weight of lipids in the liposome. 7. Claim 7-10 and 17-20 should recite “The immunostimulatory composition of claim 1” in the preamble. 8. Claims 9 and 21 are objected to because of the recitations “some phosphodiester moieties” and “phosphorothioate moieties”. Appropriate correction to “some of the phosphodiester linkages” and “phosphorothioate linkages” is required. 9. Claim 10 should be rewritten as follows: The immunostimulatory composition of claim 1, wherein the liposome-nucleic acid complex has a diameter of 20 to 600 nm. 10. Claim 11 should be rewritten as follows: A method for preparing an immunostimulatory composition comprising a liposome-nucleic acid complex, wherein the complex contains a liposome comprising a zwitterionic lipid and a cationic lipid, and one or more immunostimulatory oligonucleotides and/or one or more immunostimulatory polynucleotides, the method comprising: providing the liposome comprising the zwitterionic lipid and the cationic lipid; and contacting the provided liposome with the one or more immunostimulatory oligonucleotides and/or the one or more immunostimulatory polynucleotides to form the liposome-nucleic acid complex. 11. Claim 16 should be rewritten as follows: A method for preparing an immunostimulatory composition comprising a liposome-nucleic acid complex, wherein the complex contains a liposome comprising a zwitterionic lipid and a cationic lipid, and one or more immunostimulatory oligonucleotides and/or one or more immunostimulatory polynucleotides, the method comprising: contacting the zwitterionic lipid and the cationic lipid with the one or more immunostimulatory oligonucleotides and/or the one or more immunostimulatory polynucleotides before or during liposome formation to form the liposome-nucleic acid complex. 12. Claim 17 should be rewritten as follows: The immunostimulatory composition of claim 1, wherein the zwitterionic lipid constitutes at least 45 wt % based on the total weight of lipids in the liposome. 13. Claim 18 should be rewritten as follows: The immunostimulatory composition of claim 1, wherein the zwitterionic lipid constitutes at least 50 wt % based on the total weight of lipids in the liposome. 14. Claim 22 should be rewritten as follows: The immunostimulatory composition of claim 1, wherein the liposome-nucleic acid complex has a diameter of 40 to 500 nm. 15. Claim 23 should be rewritten as follows: The immunostimulatory composition of claim 1, wherein the liposome-nucleic acid complex has a diameter of 60 to 300 nm. 16. Claim 24 should be rewritten as follows: The immunostimulatory composition of claim 1, wherein the liposome-nucleic acid complex has a diameter of 60 to 220 nm. Claim Rejections - 35 USC § 112(b) 17. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 18. Claim 9 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 9 recites the broad recitation “at least some phosphodiester moieties are modified”, and the claim also recites “in particular” the modification is phosphorothioate, which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claim. Claim Rejections - 35 USC § 102 19. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. 20. Claims 1-9, 11, 16-19, and 21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Yotsumoto et al. (J. Immunol., 2008, 180: 809-816), as evidenced by MedChemExpress. Yotsumoto et al. teach an immunostimulatory complex comprising DOTAP/DOPE liposomes and the immunostimulatory CpG ODN having the sequence TCCATGACGTTCCTGATGCT with a phosphorothioate backbone; the liposomes consist of DOTAP:DOPE at a molar ratio of 2:3; the complex is obtained by contacting the DOTAP/DOPE liposomes with the immunostimulatory CpG ODN (claims 1-5, 9, 11, 16, and 21) (see Abstract; p. 811, column 1, first paragraph and paragraph bridging columns 1 and 2). Given that the molecular weights for DOTAP and DOPE are 699 and 744, respectively, the molar ratio of 2:3 results in a liposome where DOPE constitutes about 61 wt% of the lipids (claims 6, 17, and 18). As evidenced by MedChemExpress, TCCATGACGTTCCTGATGCT is the sequence of the class B CpG ODN 1668. A comparison between the ODN 1668 sequence and the claimed SEQ ID NO: 3 revealed that they are identical (claims 7, 8, and 19) (see also the specification, p. 33-34, Table 2). Thus, Yotsumoto et al. teach all claim limitations and anticipate the claimed invention. 21. Claims 1-5, 7-11, 16, 19, and 21-23 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Slϋtter et al. (J. Control. Rel., 2011, 154: 123-130), as evidenced by Calderon-nieva (Master of Science Thesis, 2017). Slϋtter et al. teach an immunostimulatory complex of PC/DOTAP/DOPE-liposomes (average size 260 nm) and the immunostimulatory CpG-ODN 2006, where CpG-ODN 2006 is a vaccine adjuvant; the immunostimulatory complex is obtained by contacting the PC/DOTAP/DOPE liposomes with the ODN 2006 (claims 1-5, 10, 11, 16, 22, and 23) (see p. 123; paragraph bridging p. 124 and 125; p. 125, column 1, second and third full paragraphs; p. 126, column 1, first paragraph). As evidenced by Calderon-nieva, ODN 2006 is a class B CpG ODN with a phosphorothioate backbone and having the nucleotide sequence set forth by the claimed SEQ ID NO: 4 (claims 7-9, 19, and 21) (see Calderon-nieva, Table 2 on p. 29; compare the sequence disclosed in Table 2 with the claimed SEQ ID NO: 4). Thus, Slϋtter et al. teach all claim limitations and anticipate the claimed invention. 22. Claims 1, 3, 4, 7, 11, 16, and 19 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Gursel et al. (J. Immunol., 2001, 167: 3324-3328), as evidenced by Katsenelson et al. (Eur. J Immunol., 2007, 27: 1785-1795). Gursel et al. teach an immunostimulatory complex of DC-Chol/DOPE/PEG-PE liposomes (having a diameter of less than 150 nm) and the immunostimulatory CpG-ODN 1555; the immunostimulatory complex is obtained by contacting the DC-Chol/DOPE/PEG-PE liposomes with the ODN 1555 (claims 1, 3, 4, 11, and 16) (see Abstract; p. 2324, column 2; p. 3325, Table I). As evidenced by Katsenelson et al., ODN 1555 is a B-class CpG ODN (claims 7 and 19) (see p. 1786, column 2, third paragraph). Thus, Gursel et al. teach all claim limitations and anticipate the claimed invention. Claim Rejections - 35 USC § 103 23. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 24. Claims 1-5, 7-11, 16, and 19-23 are rejected under 35 U.S.C. 103 as being unpatentable over Slϋtter et al. as evidenced by Calderon-nieva, in view of Vollmer et al. (Eur. J. Immunol., 2004, 34: 251-262). The teachings of Slϋtter et al. are applied as above for claims 1-5, 7-11, 16, 19, and 21-23. Slϋtter et al. do not teach the CpG-ODN set forth by the claimed SEQ ID NO: 1 (claims 8 and 20). Vollmer et al. teach that, as compared to CpG ODN 2006, the C-class CpG ODN 2395 is a potent adjuvant which might have broader therapeutic applications in different cancers or infectious diseases (see Abstract; p. 252, column 1, second full paragraph, paragraph bridging columns 1 and 2, and Fig. 1; p. 253, paragraph bridging columns 1 and 2; p. 254, column 2, last paragraph; p. 259, column 1). Based on these teachings, one of skill in the art would have found obvious to modify Slϋtter et al. by replacing ODN 2006 with ODN 2395, with the reasonable expectation that doing so would result in a composition with a broad therapeutic benefits. As evidenced by Calderon-nieva, ODN 2395 has a phosphorothioate backbone and it is set by the claimed SEQ ID NO: 1 (see Calderon-nieva ,Table 2 on p. 29; compare the sequence discloses in Table 2 with the claimed SEQ ID NO: 1; see the specification, Table 2 on p. 33-34). Thus, the claimed invention was prima facie obvious at the time of its effective filing date. 25. Claims 1-5, 7-11, 16, 19, and 21-24 are rejected under 35 U.S.C. 103 as being unpatentable over Slϋtter et al. as evidenced by Calderon-nieva, in view of Gursel et al. The teachings of Slϋtter et al. are applied as above for claims 1-5, 7-11, 16, 19, and 21-23. Slϋtter et al. do not teach a size of 60-220 nm (claim 24). Gursel et al. teach that liposomes with sizes of less than 150 nm can be obtained via extrusion through a polycarbonate filter (see p. 3324, column 2, fifth paragraph). One of skill in the art would have found obvious to modify Slϋtter et al. by using extrusion as taught by Gursel et al. to achieve the predictable result of obtaining liposomes of less than 150 nm, when obtaining such liposomes was desired. The range of less than 100 nm overlaps with the 60-200 nm recited in claim 24. In the case where the claimed ranges “overlap or lie inside ranges disclosed by the prior art” a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). See MPEP 2144.05. Thus, the claimed invention was prima facie obvious at the time of its effective filing date. 26. Claims 1-11, 16-19, 21, and 22-24 are rejected under 35 U.S.C. 103 as being unpatentable over Yotsumoto et al. as evidenced by MedChemExpress, in view of Gursel et al. The teachings of Yotsumoto et al. are applied as above for claims 1-9, 11, 16-19, and 21. Yotsumoto et al. do not teach the ranges recited in claims 10 and 22-24. Gursel et al. teach that liposomes with sizes of less than 150 nm can be obtained via extrusion through a polycarbonate filter (see p. 3324, column 2, fifth paragraph). One of skill in the art would have found obvious to modify Slϋtter et al. by using extrusion as taught by Gursel et al. to achieve the predictable result of obtaining liposomes of less than 150 nm, when obtaining such liposomes was desired. The range of less than 100 nm overlaps with the 60-200 nm recited in claims 10 and 22-24. In the case where the claimed ranges “overlap or lie inside ranges disclosed by the prior art” a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). See MPEP 2144.05. Thus, the claimed invention was prima facie obvious at the time of its effective filing date. 27. Claims 1-5, 7, 10, 11, 16, 19, 22-24 are rejected under 35 U.S.C. 103 as being unpatentable over Gursel et al. as evidenced by Katsenelson et al The teachings of Gursel et al. are applied as above for claims 1-5, 7, 11, 16, and 19. While not identical, the range of less than 150 nm taught by Gursel et al. overlaps with the ranges recite in claims 10 and 22-24. In the case where the claimed ranges “overlap or lie inside ranges disclosed by the prior art” a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). See MPEP 2144.05. Thus, the claimed invention was prima facie obvious at the time of its effective filing date. 28. No claim is allowed. No claim is free of prior art. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ILEANA POPA whose telephone number is (571)272-5546. The examiner can normally be reached 8:00 am to 4:30 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ILEANA POPA/Primary Examiner, Art Unit 1633
Read full office action

Prosecution Timeline

Oct 20, 2022
Application Filed
Nov 29, 2023
Response after Non-Final Action
Jul 14, 2025
Non-Final Rejection mailed — §102, §103, §112
Feb 19, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12685785
POLYNUCLEOTIDES ENCODING PROPIONYL-COA CARBOXYLASE ALPHA AND BETA SUBUNITS FOR THE TREATMENT OF PROPIONIC ACIDEMIA
3y 1m to grant Granted Jul 21, 2026
Patent 12678515
LIPIDS AND LIPID NANOPARTICLE FORMULATIONS FOR DELIVERY OF NUCLEIC ACIDS
8y 0m to grant Granted Jul 14, 2026
Patent 12668616
WT1 VACCINE
3y 5m to grant Granted Jun 30, 2026
Patent 12622981
IMMOLATIVE CELL-PENETRATING COMPLEXES FOR NUCLEIC ACID DELIVERY
2y 2m to grant Granted May 12, 2026
Patent 12605399
IMPROVED COMPOSITIONS FOR CFTR MRNA THERAPY
3y 5m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
22%
Grant Probability
36%
With Interview (+14.6%)
4y 8m (~11m remaining)
Median Time to Grant
Low
PTA Risk
Based on 834 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month