DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Restriction/Election
Applicant’s election of Invention Group I (claims 27-29 and 31-40) in the reply filed 2/10/2026 is acknowledged. Since there are no statements to the contrary that distinctly/specifically pointing out errors in the restriction, the election is being treated as an election without traverse (MPEP § 818.01(a)).
Species Elections:
Re: Species of DMR-associated genes to be amplified for claims 27,34-40), applicant elects the “combination of BRD3, DDX50, DUSP8, EHMT1, HCN2, IL17D, MICAL3, NACC2, PKD1, and VWA1“which is interpreted to mean that election encompasses all of the genes as being included as the elected group (not that one or more genes is the elected group).
Re: One or more Primers (claim 30 from SEQ ID: 1-75): Applicant notes this election is moot, as claim 30 has been canceled.
The elected species combination was examined as a group of 10 genes, and no art was identified for this group. Therefore, since the claim also includes additional unelected species, the Examiner moved to unelected species, for which art was found, and is presented. Were the claim to be amended to encompass the combination of all 10 genes of the elected group (not “one or more”), it would be free of the present art search.
Status of the Claims
Claims 27-29, 31-40 are pending and under examination.
Claims 1-26, 30 and claim 41 (Invention II) and claim 42 (Invention III) have been cancelled by Applicant.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 27-29,31-40 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 27 is indefinite over the recitation of “at least one pair of primers designed to amplify at least one DMR-associated gene…wherein the primer pair comprises a first and a second primer that are complementary to the DMR-associated gene” since, as stated it is not entirely clear whether the primers are designed to amplify after bisulfite conversion, or not (e.g. the primer pair are complementary to the DMR-associated gene, but are provided in the reaction mixture comprising modified target DNA).
In claim 27, it is also important to be entirely clear re: whether “at least one pair of primers designed to amplify at least one DMR-associated gene” means that each DMR associated gene would be amplified by a unique set of primers that are complementary to that particular gene, such that if more than one gene is amplified, more than one primer pair is used, and each primer pair used is complementary to a unique gene; or that there are (any set of) genes recited that could be amplified by the same singular set of primers. It is notable that the Specification, [0011] recites “the methods described…and a pair of primers to amplify one or more DMR-associated genes…”) and [0043] recites that the fragment size to be amplified by the primer pair can range from <50bp to >10K bp.
Thus, further clarification is needed to establish metes and bounds of the claim. Claims 28,29-31-40 are indefinite in claim 27 and rejected for the same reason.
Claim 27 is indefinite over the recitation of “ A method of amplifying”….comprising steps of providing target DNA, primers; heating and cooling the reaction, repeating heating and cooling, wherein an amplified target DNA sample is formed.
It is not clear from the claim, how “an amplified target sample” would be amplified, since recited are a heat and cool step with primers (repeated), which is insufficient to be an amplification reaction. Specification section [0051] addresses several suitable methods for quantifying or assaying methylation and [0052] indicates that in some embodiments the target DNA is bisulfite modified, so further clarification on the method of the claim is necessary to establish metes and bounds.
It is also unclear, when there is more than one region-associated gene, whether this amplification and reaction mixture is intended as a multiplex reaction, or multiple singleplex reactions. Claims 28,29-31-40 are indefinite in claim 27 and rejected for the same reason.
Claims 34-40 are each indefinite over the recitation of comprising at least two reaction mixtures (or more for claims 35-40) …and at least one pair of primers designed to amplify at least one different DMA-associated gene. This phraseology does not allow for establishing metes and bounds of the claim given the use of “one different DMR-associated gene” since it is not established from what this gene differs as the claim is written.
Double Patenting - Obviousness
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. An obviousness nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 27-29, 31-33 are rejected on the ground of nonstatutory obviousness double patenting as being unpatentable over claims 1-3, 6,9, 10 of U.S. Patent No. US11542548B2.
Although the claims at issue are not identical, they are not patentably distinct from each other because the method steps are the same in the claims and only the DMR-associated genes recited have been expanded from a list of six in the parent patent (’548), to a list of 20 in the instant application, including the six found in the parent claim. Additional claims recited here are equivalent between the two applications. This, therefore, represents an obvious variant of the claimed invention, merely broadening the set of the class of DMR-associated genes. In sum, the instant claims are rejected because they are obvious in view of the parent (‘548) patent claims.
Claim 1 of ‘548 discloses a method of amplifying at least one of six differentially methylated region (DMR) associated genes comprising the steps of: (a) providing a reaction mixture comprising bisulfite modified target DNA from a subject and at least one pair of primers designed to amplify at least one DMR-associated gene selected from the group consisting of DIP2C, GRB10, INPP5A, GNAS, PDXK, and TRAPPC9, wherein the primer pair comprises a first and a second primer that are complementary to the DMR-associated gene; (b) heating the reaction mixture to a first predetermined temperature for a first predetermined time; (c) cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions to allow the first and second primers to hybridize with their complementary sequences on the target DNA; and (d) repeating steps (b) and (c) wherein an amplified target DNA sample is formed.
Claim 27 of the instant application discloses a method of amplifying one or more differentially methylated region (DMR) associated genes comprising the steps of:(a) providing a reaction mixture comprising bisulfite modified target DNA from a subject and at least one pair of primers designed to amplify at least one DMR-associated gene selected from the group consisting of DIP2C, GRB10, INPP5A, GNAS, PDXK, TRAPPC9, C17ORF97, CACNA2D4, CRTC1, MEGF6, HIVEP3, OPCML, PITPNM2, ZFPM1, RAP1GAP2, NFATC1, RNF126, FSTL3, SH3BP2, NEURL1B, MAD1LI, HSPA12B, IGF2, PEG10, PEG3, SLC16A3, SYTL1, ZIM2, BRD3, DDX50, DUSP8, EHMT1, HCN2, IL17D, MICAL3, NACC2, PKD1, and VWA1, wherein the primer pair comprises a first and a second primer that are complementary to the DMR-associated gene;(b) heating the reaction mixture to a first predetermined temperature for a first predetermined time;(c) cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions to allow the first and second primers to hybridize with their complementary sequences on the target DNA; and(d) repeating steps (b) and (c) wherein an amplified target DNA sample is formed.
The instant claim is not patentably distinct from the parent claim because both claims recite amplification employing the same method steps, where primers “amplify at least one DMR associated gene selected from the group…” of six genes (DIP2C, GRB10, INPP5A, GNAS, PDXK, and TRAPPC9) in the parent, and the instant claim expands “the group” including those exact six genes plus 32 more, merely enlarging the group of DMR associated genes recited but performing the same method, which is an obvious variant of the method.
Claim 2 of ‘548 includes additionally polymerase and free nucleotides, exactly the same as instant claim 28.
Claim 3 of ‘548 includes additionally reaction buffer and MgCl2, exactly the same as instant claim 29.
Claim 6 of ‘548 includes additionally at least one biotinylated primer, as does instant claim 31.
Claim 9 of ‘548 includes additionally that the sample is blood or saliva, as does instant claim 32.
Claim 10 of ‘548 includes additionally that the sample is human or non-human primate as does instant claim 33.
Thus, instant claims 27-29, 31-33 are not patentable over the ‘548 claims for the reasons discussed.
Claims 34-40 are rejected on the ground of nonstatutory obviousness double patenting as being unpatentable over claims 4 (depends from claim 1) and 7 of U.S. Patent No. US11542548B2.
Although the claims at issue are not identical, they are not patentably distinct from each other because the method steps are the same in the claims and only the particular number of samples or DMR-associated genes recited genes result in different scope, with the parent (‘548) more narrow, naming particular genes in claim 4, but providing selection from a group of genes in claim 7, where the instant claims draw from the group in claim 27, which overlaps with the genes of the parent.
Claim 4 of ‘548 is the method of claim 1, where a first reaction mixture comprises bisulfite-modified target DNA and a pair of DIP2C primers; a second reaction mixture with bisulfite-modified target DNA and INPP5A primers, a third reaction mixture with bisulfite-modified target DNA and PDXK primers, a fourth reaction mixture with bisulfite-modified target DNA and GNAS primers, a fifth reaction mixture with bisulfite-modified target DNA and GRB10 primer and a sixth mixture and TRAPPC9 primers.
Instant claim 34 discloses the method of claim 27 wherein step (a) comprises at least two reaction mixtures, each comprising bisulfite-modified target DNA, and at least one pair of primers for at least one different DMR associated gene; claim 27 recites DIP2Cand INPP5A.
Instant claim 35 is similar to instant claim 34, for at least three reactions; instant claim 27 also recites PDXK. Instant claim 36 is also similar, for at least four reactions; claim 27 also recites GNAS. Instant claim 37 for at least five reaction mixtures; claim 27 also recites GRB10.
Claim 7 of ‘548 discloses the method of claim 4, with additional reaction mixtures of one or more DMR-associated genes, where 22 genes are recited that overlap completely with the instant claim 27 group of genes.
Instant claim 38 for at least 10 reaction mixtures, instant claim 39, for at least 15 reaction mixtures, instant claim 40, for at least 20 reaction mixtures, encompass the same methods as the parent case, increasing the number of reactions.
Thus, instant claims 33-40 are not patentable over the ‘548 claims for the reasons discussed.
Claim Rejections - 35 USC § 103
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 27-29, 31, 33 are rejected under 35 U.S.C. 103 as being unpatentable over DeBoever (De Boever et al., WO2016/193151 A1 (published 8/12/2016) in view of von dem Knesebeck, (von dem Knesebeck, A., RANK (TNFRSF11A) is epigenetically inactivated and induces apoptosis in gliomas, 2012, Neoplasia, 14:6 526-534) in view of Green (Green M et al., The basic polymerase chain reaction, 2018, Cold Spring Harbor Laboratory Press, 338-345).
Re claims 27, 32-33 DeBoever teaches a method of amplifying one or more differentially methylated region (DMR) associated genes (DeBoever claims 2, 15, Pg 5, line 10) which include assaying DMR gene regions including DIP2C, TNFRSF11A, MAD1L1, and more, and amplification by PCR, or by methylation specific PCR) by providing reaction mixture of bisulfite modified target DNA from a subject, at least one pair of primers to amplify the at least one DMR-associated gene selected from a group (that includes the above two recited genes), wherein the primers are complementary to the DMR associated gene (De Boever, claims 2 and 15, Pg 20, ln 30-35,Pg 21, ln 15-30; Pg 30, ln 1-7). Amplification occurred using DNA polymerase (Pg 21, ln 25-28). The methods were performed on a blood sample from a human (claim 5, Pg 12 lines 5-7) (meeting instant claims 32, 33).
Re: claims 27 b) and 31, where 27 b recites heating the reaction mixture to a first predetermined temperature for a first predetermined time; (c) cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions to allow the first and second primers to hybridize with their complementary sequences on the target DNA; and (d) repeating steps (b) and (c) wherein an amplified target DNA sample is formed.
De Boever disclosed an amplified target formed (per above), and disclosed primers in general, PCR and amplification, but did not explicitly disclose particular primers or explicitly refer to the heating and cooling implicit to PCR amplification methods.
Von dem Knesebeck also addressed assessing methylation status of particular DMRs, TNFRSF11A methylation and use of PCR after bisulfite conversation (Abstract). For methylation analysis, bisulfite treatment (EpiTect bisulfite kit) was followed by amplification from bisulfite converted DNA of TNFRSF11A methylation sites, using these primers: forward primer (fw-5’-ggtaaggtaggagttagtgt-3’) and biotinylated reverse primer (ev-5′-aatacccaaactcccctaattta-3’) (Pg 527, right col final para).
To have obtained PCR products containing methylation sites (Pg 527, right col final para), it would have been necessary to heat and cool to amplify, which was not explicitly stated in DeBoever or in Von dem Knesebeck.
Re: claim 27 cont., c) heating to a first temperature for a first time and d) cooling to a second temperature for a second time and d) repeating these steps wherein amplified target DNA is formed
De Boever nor Von dem Knesebeck explicitly state heating and cooling but Green disclosed amplification, with a Table inclusive of c) denaturation for 30 sec and 94 degrees C, which is heating, d) followed by annealing at 30 sec for 55 degrees C, or cooling for primer hybridization, and d) repeating this for 30 cycles to amplify nucleic acids. This procedure is disclosed as the foundation for all subsequent variations of PCR (Abstract, Pg 340, step 4).
It would have been obvious, prior to the effective filing date, to one of ordinary skill to have used the basic ‘heating and cooling to amplify’ typical of PCR and explicitly disclosed in Green, in the amplification of De Boever, that would have included the bisulfite converted TNFRSF11A DNA amplification by PCR with the primers disclosed by Von dem Knesebeck, because these primers were known to successfully amplify this target after bisulfite conversion, the intended use for which they were to be applied here, where successful use also provided a motivation the use them.
Re: Claims 28-29 Green also disclosed procedures required to amplify DNA in a PCR reaction, where the reagents recited included: polymerase, and a plurality of all four nucleotides (ATGC) or dNTPs (Pg 338, 340). Green disclosed the reagents also included amplification buffer (“reaction buffer”) and MgCl2 (Pg 338,340).
Prior to the effective filing date, it would have been prima facie obvious to have used the reaction mixture ingredients of Green in the heating and cooling of Green for the amplification of De Boever employing the primers of Von dem Knesebeck since these basic reagents were known in the art for this type of work and were employed by Green in amplification by heating and cooling, which would motivate their use for heating and cooling amplification.
Claim 34 is rejected under 35 U.S.C. 103 as being unpatentable over DeBoever (De Boever et al., WO2016/193151 A1 (published 8/12/2016) in view of von dem Knesebeck, RANK(TNFRSF11A) is epigenetically inactivated and induces apoptosis in gliomas, 2012, Neoplasia, 14:6 526-534) in view of Green (Green M et al., The basic polymerase chain reaction, 2018, Cold Spring Harbor Laboratory Press, 338-345), further in view of Giuliani (Giuliani, C. et al., Epigenenetic variability across human populations: a focus on DNA methylation profiles of the KRTCAP3, MAD1L1, and BRSK2 genes, 2016 Genome Biol Evol.
The contributions of DeBoever, von dem Knesebeck and Green have been discussed regarding claim 27 and an amplification of a DMR associated region.
Claim 34 recites two reaction mixtures of bisulfite modified DNA and primers to amplify at least one different DMR associated gene…
Giuliani addressed CpG sites in MAD1L1 (Pg 2762, right col para 2, 3rd to last line) and conducted bisulfite conversion on human blood samples ((Pg 2762, right col para 3) where bisulfite treated DNA was PCR amplified with primers that were recited (F-AGGAAGAGAGTGAAGATTTATTT TTGGAGTGGGTA and R- CAGTAATACGACTCACTATAGGGA GAAGGCTTAACACCAACCAAAACACACCTAA for the MAD1L1 gene, Pg 2762 right col final para, to 2763 left col para 1).
Since DeBoever taught a method of amplifying at least one differentially methylated region (DMR) associated gene (DeBoever claims 2, 15, Pg 5, line 10) which included assaying DIP2C, TNFRSF11A, MAD1L1 and more, and in view of von dem Knesebeck, and Green, instant claim 27 was taught, but this art did not teach the second set of explicit primers, it would be obvious to have used the post bisulfite conversion primers of Giuliani to amplify an additional gene that was already recited in DeBoever’s plurality, being motivated by the desire to amplify more than one and the success of Giuliani in having already used the primers successfully themselves for this same type of amplification.
Conclusion
All claims rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Lisa Horth whose telephone number is (703)756-4557. The examiner can normally be reached Monday-Friday 8-4 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/LISA HORTH/Examiner, Art Unit 1681
/GARY BENZION/Supervisory Patent Examiner, Art Unit 1681