DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of group I (claims 93-103) in the reply filed on 8/27/25 is acknowledged.
Claims 104-111 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 8/27/25.
Applicant's election with traverse of species (aptamer 2, SEQ ID NOs: 47 and 48) in the reply filed on 8/27/25 is acknowledged. The traversal is on the ground(s) that Applicants respectfully submit that the claimed nucleic acid sequences of aptamer 1 and aptamer 2 are unified by a shared special technical feature: both sequences are designed to treat retinal disease including the wet form of advanced macular degeneration (wAMD), diabetic retinopathy and diabetic macular edema by targeting distinct but complementary pathways. Inhibiting VEGF prevents angiogenesis and vascularization while inhibiting IL8 prevents angiogenesis and vascularization but also inhibits inflammation and the recruitment of neutrophils, which can lead to further increases in the production of VEGF. Together, they contribute to the inhibition of angiogenesis and decrease inflammation more broadly than inhibition of either pathway alone, which is the shared therapeutic goal. Additionally, the aptamers share a common property or activity when provided as the claimed bispecific RNA aptamer. If provided alone, each individual aptamer is smaller and therefore would clear much faster than if the aptamers were combined into the bispecific RNA aptamer. When the aptamers are combined into the bispecific RNA aptamer, they have a larger size and hydrodynamic radius, which allows the bispecific RNA aptamer to clear more slowly and thus provides longer duration. This longer duration reduces the ocular injection burden on the patient. This is not found persuasive because the prior art cited in the restriction teaches that special technical feature is made obvious and the feature is not considered a contribution over the teaching in the prior art. In addition, the species requirement was separated between aptamer 1 (SEQ ID NOs 1-46 and 67) and aptamer 2 (SEQ ID NOs: 47 and 48). Even though the sequences for aptamer 1 or aptamer 2 share a common use they do not share common structure as discussed in the restriction mailed on 6/27/25, which is hereby incorporated herein.
Upon an interview summary with applicant to clarify the election of species requirement, applicant further elected SEQ ID NOs: 1 for aptamer 1 and SEQ ID NO: 47 for aptamer 2. See attached interview summary from 9/15/25.
The requirement is still deemed proper and is therefore made FINAL.
Upon further consideration, SEQ ID NO: 48 is rejoined with the elected species and examined.
SEQ ID NOs: 2-46 and 67 in claim 1 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 8/27/25.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. See figures 1a-e, 6, 7, and 9,
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Specification
The use of the term SELEX, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. See page 19. Please review the specification for any other trademarks.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. See page 16.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 98 and 99 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claimed invention embraces a bispecific RNA aptamer having formula I: X1-aptamer-X2-linker-Y2-indvT, wherein aptamer 1 is selected from SEQ ID NOs: 1-46 and 67 or at least about 70% identity thereto and aptamer 2 is selected from SEQ ID NOs: 47-48 or at least one nucleotide sequence having about 70% identity thereto.
The claims do not recite the definition for each variable, but page 22 of the as-filed specification provides a definition for the variables. X1 is 0-5 nucleotides in length that are designed to base pair with region X2. Y1 is 0-5 nucleotides in length that are designed to base pair with region Y2.
Pages 94-97 disclose SEQ ID NOs: 1-48 and 67 (VEGF-A aptamers), SEQ ID NOs: 47-48 (IL8 aptamers) and method of making the bispecific aptamer comprising the sequences.
Depending on the sequence for aptamer 1 or 2, SEQ ID NOs: 1-48 and 67 are 31-38 nucleotides in length. SEQ ID NOs: 47(48) are 29(34) nucleotides in length.
The claimed product reads on a large number of aptamer because 70% of the sequences of the instant sequences embraces removing or substituting at least about 10 nucleotides of the sequences. The specification provides written support and one of skill in the art (See Shatunova et al. Biomedicine 2020, 8, 527, pages 1-44) can envision an aptamer having at least 70% sequence identity to SEQ ID NOs: 1-46 and 67 (SEQ ID NOs: 47 and 48) with no functional limitation. However, with respect to claims 98 and 99, the specification does not appear to describe a core structure for the aptamer having at least about 70% identity to SEQ ID NOs: 1-46 and 67 (or SEQ ID NOs: 47-48) that specifically binds to VEGF or (IL8) or inhibits the function of VEGF or an isoform thereof and (IL8) by an amount between about 90% and 100%. Table 27 in the specification appears to provide written support for aptamer having at least 90% to SEQ ID NOs: 1-46 and 67 (or SEQ ID NOs: 47-48) having the desired biological activity. However, the specification does not describe what nucleotides can be removed or what nucleotides can be substituted to arrive at nucleotide sequence having at least 70% identity to aptamer 1 or aptamer 2 and still retain the functional limitations.
While it is acknowledged that methods of making aptamers are well-known (see Shatunova, supra) in the prior art and one of skill in the art can make aptamers to a desired target, this does not provide written support for the genus of claimed aptamers having the desired biological activity. “…For example, disclosure of an antigen fully characterized by its structure, formula, chemical name, physical properties, or deposit in a public depository does not, without more, provide an adequate written description of an antibody claimed by its binding affinity to that antigen, even when preparation of such an antibody is routine and conventional..” See Amgen Inc. v. Sanofi, 872 F.3d 1367, 1378, 124 USPQ2d 1354, 1361 (Fed. Cir. 2017)(“knowledge of the chemical structure of an antigen [does not give] the required kind of structure-identifying information about the corresponding antibodies”); see also Centocor Ortho Biotech, Inc. v. Abbott Labs., 636 F.3d 1341, 1351-52, 97 USPQ2d 1870, 1877 (Fed. Cir. 2011)(patent disclosed the antigen the claimed antibody was supposed to bind, but did not disclose any antibodies with the specific claimed properties). See MPEP 2163(II)(3)(a).
The written description requirement for the claimed genus of aptamers having the functional limitations in claims 98-99 is not satisfied through sufficient description of a representative number of species. While the specification provides a representative number of species for an aptamer having at least 90% sequence identity to the instant SEQ ID NOs 1-46 and 67 or 47 and 48, the species are not representative of the entire genus of aptamers having the desired biological activity. The specification does not describe what nucleotides are considered essential for the claimed functional limitations. There is a substantial variation within the genus of aptamers because removing or substituting at least 10 nucleotides from the instant SEQ ID NOs: would require further experimentation to determine if these aptamers have the desired biological activity. The specification of the instant disclosure does not provide a sufficient variety of species to reflect the variation within the genus. See Enzo Biochem., 323 F.3d at 966, 63 USPQ2d at 1615; Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004)(“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”).
In view of the foregoing, it is clear that the specification of the instant disclosure fails to convey to the skilled artisan that the applicant had possession of the claimed genus of bispecific RNA aptamers in claims 98 and 99 as of the effective filing date.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 93-103 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 93 recites the limitation "X1-(aptamer 1)-X2-(linker)-Y1-(aptamer 2)-Y2-invdT Formula I" in line 2. There is insufficient antecedent basis for this limitation in the claim because the claims do not define the metes and bounds of the variables: X1, X2, Y1, and Y2 in the formula. Claims 94-103 are also rejected because they depend on claim 93.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 95 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 95 indicates that the linker a non-nucleotide linker, but depends on claim 94 which already limited the linker to a nucleotide linker having five or more 2’ O-methyl uridine residues. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Page 98 of the specification discloses that either nucleotide or a non-nucleotide is used as the linker. It appears that claim 95 should depend on claim 93 instead of claim 94.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 93, 98-100 and 102-103 are rejected under 35 U.S.C. 103 as being obvious over Erickson (WO 2020146801 (filing date 1/11/19)) taken with Vitrisa Therapeutics (WO 2019222344, published on 11/21/19 and filing date 5/15/18) and Vitrisa Therapeutics (WO2019210097, published 10/31/19 and filing date 4/25/18), all of record.
The applied references (WO 2020146801 and WO2019210097) has a common applicant or joint inventor with the instant application. Based upon the earlier effectively filed date of the references, it constitutes prior art under 35 U.S.C. 102(a)(2).
’801 teaches an VEGF-A aptamer comprising SEQ ID NO: 412 (Db) having an inverted deoxythymidine (idT), which is 100% identical to instant SEQ ID NO: 1 (Qy) (pages 174 and 180-192, claim 116). Additional sequences taught in ‘801 read on a nucleotide comprising at least 90% sequence identity to instant SEQ ID NO: 1. For example, SEQ ID NOs: 361-402, 421, and 426-427. One or more aptamers that bind to a receptor binding domain of VEGF-A (abstract). Page 31 discloses that the aptamer may be used to treat an ocular disease involving one or more factors that upregulated VEGF expression and/or activity, including EGF, TGF-alpha, TGF-beta, KGF, IGF-1, FGF, PDGF, IL-1-alpha, IL6, and IL8. Pages 8, 34-45, and 95-100 discloses modifying the nucleotides of the aptamer with 2’-F modified nucleotides or a 2’OMe modified nucleotides or both. The aptamer can be conjugated to a polyethylene glycol (PEG) molecule. Pages 16-17 disclose that the aptamer can comprise a linker. Pages 125-126 discloses making a pharmaceutical composition comprising a pharmaceutically carrier. The composition can be used to treat a retinal disease.
Qy 1 CCGCGCGGAGGGGUUUCAUAAUCCCGUUUGUCG 33
Db 5 CCGCGCGGAGGGGUUUCAUAAUCCCGUUUGUCG 37
‘801 does not specifically teach an IL8 aptamer comprising instant SEQ ID NOs: 47 or 48 or at least 70% identity thereto.
‘344 teaches an IL-8 aptamer comprising SEQ ID NO: 645 (Db) that is 100% identical to instant SEQ ID NO: 47 (Qy) (page 89).
Qy 1 GCGGUGGGAAAUGUGAGAUGGGUUGCCGC 29
Db 1 GCGGUGGGAAAUGUGAGAUGGGUUGCCGC 29
Several additional aptamers from ‘344 also read on SEQ ID NO: 47. For example, see SEQ ID NOs: 652-670. The aptamer can comprise one or more modified comprises a 2’-F-modified nucleotide, a 2’-OMe modified nucleotide or a combination thereof (pages 217-218). Page 220 also teaches inhibiting a function associated with IL8 with CXCR1, CXCR2, or both and anti-VEGF composition. The composition can be used to treat an ocular disease or disorder.
‘344 and/or ‘801 do not specifically teach a bispecific aptamer comprising an IL-8 aptamer and a VEGF-A aptamer comprising the instant SEQ ID NOs.
However, ‘097 teaches making a bi-specific aptamer including two or more aptamers conjugated to a linker molecule (PEG polymer). See pages 10-13, 41, and 60-66. The aptamers maybe be used in the treatment of a disease associated with aberrant VEGF, ANG2, IL8 and/or PDGF expression. Pages 15-25 discloses that aptamers may comprise modified nucleotides and/or nucleotide analogs and/or conjugating a PEG polymer. Page 43 discloses a hexaethylene glycol spacer linking two compounds. Pages 43, 50 and 54 discloses a 3’-3’ inverted deoxythymidine (invdT) on a terminus of an aptamer. Page 56 discloses a composition comprising an aptamer for intravitreal administration to a subject.
It would have been obvious to a person of ordinary skill in the art to combine the teaching of ‘344, ‘801 and ‘097 to combine a aptamer comprising a VEGF aptamer with an IL8 aptamer to make a bispecific aptamer comprising SEQ ID NO: 1 and SEQ ID NO: 47 to study a possible additive effect in treating a condition associated (ocular disorder or disease) with IL-8 and VEGF. In view of page 22 of the as-filed specification and the lack of definition for the variable in claim 93, the variables in formula I in claim 93 can be zero. In view of the broadest reasonable interpretation of the claimed product, the claim product embraces aptamer1-linker-aptamer2-invdT. It would have been obvious for one of ordinary skill in the art to add an invdT to the terminus of the aptamer to inhibit degradation by 3’ exonucleases and extension by DNA polymerase. Instant claims 98 and 99 appear to be a functional limitation that would be inherent for the bispecific RNA aptamer made obvious by the prior art of record because all of the structures are discloses in the references, so the functional limitation of the compositions are made obvious by the aptamers taught by ‘344 or 801. In addition, it would have been obvious to a person of ordinary skill in the art to add a PEG moiety to the end of the aptamer to improve pharmacokinetic or pharmacodynamic properties of the aptamer. Since an IL-8 aptamer comprising SEQ ID NO: 645 and a VEGF aptamer comprising SEQ ID NO: 412 are known in the prior art, it would have been obvious to try using these two aptamers in a bispecific aptamer for studying possible treatment of a disease associated with aberrant expression of VEGF and IL-8. See MPEP 2143(I)E. Aptamers (e.g., SEQ ID NO: 372) taught by ‘801 comprise modified nucleotide including 2’-fluoro and 2’-O-methyl and a 1,3,-propanediol spacer. One of ordinary skill in the art would have been motivated to chemically modify one or more nucleotides with at least one 2’OMe or 2’F to increase the bioavailability of the aptamer. It would have been obvious to make a pharmaceutical composition comprising the aptamer and a pharmaceutically acceptable carrier to deliver the aptamer to cells or a subject. ‘097 teaches a composition formulated for intravitreal administration.
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 94 and 96-97 are rejected under 35 U.S.C. 103 as being obvious over WO 2020146801 taken with WO 2019222344 and WO2019210097 as applied to claims 93, 98-100 and 102-103 above, and further in view of Shi et al. (US 20120141382).
The applied reference has a common assignee or joint inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
Aptamers (SEQ ID NO: 372) taught by ‘801 comprise modified nucleotide including 2’-fluoro and 2’-O-methyl and a 1,3,-propanediol spacer.
‘334 teaches using one or more non-nucleotidyl linkers to connect to nucleotide sequences (page 213).
‘097 teaches using a hexaethylene glycol or 6-carbon amino containing linker to connect two aptamers (pages 19, 35 and 43). ‘097 teaches that a nucleic acid linker can be used comprising two or more nucleic acids (page 19).
‘801, ‘344 and ‘097 do not specifically teach using a linker comprising 5 or more 2’OMe uridine residues.
However, ‘382 connecting two aptamers with a single strand poly-uridine (U) linker to break the possible rigid stacking of the two stems in a particular configuration (paragraph 155 and Figs 7B-D). Using the linker allows more flexibility between the two aptamers.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘801, ‘344, and ‘097 taken ‘382 with to using a linker comprising 5 or more 2’OMe uridine residues, namely to arrive at the claimed invention. A person of ordinary skill in the art would have been motivated to try a polyU linker to connect the aptamers together as taught by ‘382. In addition, one of ordinary skill in the art to try using uridines to determine if the linker can assist in avoiding interference with the binding activity of the aptamer to their target sites. One of ordinary skill in the art would have been motivated to chemically modify the uridines in the polyU linker with 2’OMe to increase the stability of the aptamer.
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 95 is rejected under 35 U.S.C. 103 as being unpatentable over WO 2020146801 taken with WO 2019222344 and WO2019210097 and 20120141382 as applied to claims 94 and 96-97 above, and further in view of Haruta (WO 2017094897). NOTE: see English translation US 20190381088, which claims priority to the ‘897 document. The citations in the rejection will be from the ‘088 publication.
The applied reference has a common assignee with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
‘334 teaches using one or more non-nucleotidyl linkers to connect to nucleotide sequences (page 213).
‘097 teaches using a hexaethylene glycol or 6-carbon amino containing linker to connect two aptamers (pages 19, 35 and 43). ‘097 teaches that a nucleic acid linker can be used comprising two or more nucleic acids (page 19).
‘801, ‘344,‘097, and ‘382 do not specifically teach using a linker comprising 5 or more 2’OMe uridine residues and a non-nucleotidyl linker that is a hexaethylene glycol.
However, ‘897 teaches IL-17 aptamer or a conjugate comprising a plurality of IL-17 aptamers (pages 6-8 and Figures 1 and 2 of ‘088). The conjugation can be achieved by tandem binding in the conjugation using a linker (nucleotides 1-20 nucleotides) and non-nucleotide chains, including hexaethylene glycol. In the tandem binding of the conjugate of a plurality of aptamers a spacer can be used to elongate the aptamer length. The spacer is not directly involved in the binding activity of the aptamer. The spacer can be a nucleotide chain or a non-nucleotide chain.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘801, ‘344, ‘097, and ‘382 taken with ‘897(See English translation) with to using a linker comprising 5 or more 2’OMe uridine residues and a non-nucleotide that is a hexaethylene glycol, namely to arrive at the claimed invention. A person of ordinary skill in the art would have been motivated to try a polyU linker to connect the aptamers together as taught by ‘382. One of ordinary skill in the art would have been motivated to chemically modify the uridines in the polyU linker with 2’OMe to increase the stability of the aptamer. One of ordinary skill in the art would have been motivated to combine the teaching to try the nucleotide linker comprising the chemically modified uridine residues and a hexaethylene glycol as suggested by ‘382 to study the activity of the bi-specific aptamer in cells or a subject.
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 101 is rejected under 35 U.S.C. 103 as being unpatentable over WO 2020146801 taken with WO 2019222344 and WO2019210097 as applied to claims 93, 98-100 and 102-103 above, and further in view of Genentech, Inc. (US 20180293360).
The applied reference has a common assignee with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
‘801, ‘344 and ‘097 does not specifically teach using a linker comprising 5 or more 2’OMe uridine residues and a non-nucleotide that is a triethylene glycol or hexaethylene glycol.
‘801, ‘344, and ‘097 do not specifically teach making the aptamer have a hydrodynamic radius greater than about 10 nM
However, ‘360 studied therapeutic agents-polymer conjugates after intravitreal injection within a rabbit eye as a function of hydrodynamic radius (figure 1 and pages 1-6 and 17-19). The hydrodynamic radius can be greater than about 10 nM.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘801, ‘344, and ‘097 taken with ‘360 to make the aptamer have a hydrodynamic radius greater than about 10 nM, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to increase half-life and durability of the aptamer by increasing the hydrodynamic radius of the aptamer thereby slowing down the diffusion from the eye.
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Conclusion
See attached PTO-326 for disposition of claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636