Prosecution Insights
Last updated: April 19, 2026
Application No. 17/995,675

METHOD

Final Rejection §102§112
Filed
Oct 06, 2022
Examiner
KALLIS, RUSSELL
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
British American Tobacco (Investments) Limited
OA Round
2 (Final)
87%
Grant Probability
Favorable
3-4
OA Rounds
2y 6m
To Grant
95%
With Interview

Examiner Intelligence

Grants 87% — above average
87%
Career Allow Rate
1003 granted / 1153 resolved
+27.0% vs TC avg
Moderate +8% lift
Without
With
+7.8%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
13 currently pending
Career history
1166
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
13.0%
-27.0% vs TC avg
§102
20.1%
-19.9% vs TC avg
§112
50.2%
+10.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1153 resolved cases

Office Action

§102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 3, 6-7, 9-11, 16-24, 27, 29-33 are pending and examined. Specification The title of the invention is not descriptive. A new title is required that is clearly indicative of the invention to which the claims are directed. The following title is suggested: A method for making tobacco having reduced levels of alkaloids, nicotine, or tobacco nitrosamines. Claim Objections In claim 9 reference to genes found in Tables 1 and 2 of the specification is objected to because where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) It is suggested that claim 9 should be amended to include the sequence identifiers for the Nic1 and Nic2 genes in Tables 1 and 2. Claim 29 should be amended from “A mutant of a plant” to “A tobacco plant” for clarity. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 3, 6, 7, and claims 10, 16-24, 27 and 32-33 dependent thereupon are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims 3, 6, and 7 recite the negative limitation “excluding the Nic3 gene SEQ ID NO: 73 and sequences with at least 95% identity thereto”. There is no express support or reasoning recited in the specification for any unspecified nic3 gene having less than 95% sequence identity to SEQ ID NO: 73 being either mutated or having modulated alkaloid content (claim 3), reduced nicotine content (claim 6), or decreased alkaloid content (claim 7) other than SEQ ID NO: 73, SEQ ID NO: 118, SEQ ID NO: 124, and SEQ ID NO: 127 having reduced activity or expression thereof in a plant transformed with a RNAi expression construct wherein the plant has reduced alkaloid content or reduced nicotine content. Applicants’ assert that “The MPEP and case law provide, “If alternative elements are positively recited in the specification, they may be explicitly excluded in the claims.” Citing in re Johnson, 558 F.2d 1008, 1019 (CCPA 1977). This is not found to be persuasive because Applicants’ specification has no support for a genus of Nic3 gene sequences with less than 95% identity to SEQ ID NO: 73 that when expressed in a tobacco plant as a gene repression construct reduced expression or activity and thereby decreased the alkaloid or nicotine content of a tobacco plant transformed therewith. Clearly there is no express support in the specification for “sequences with less than 95% identity to SEQ ID NO: 73” or for a genus of myc2a genes that are linked to modulated, reduced or decreased alkaloid or nicotine content.; and thus Applicants have not demonstrated possession of the invention as broadly claimed. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 3, 6, 7, 9-11, 16-24, 27, 29-31, and 32-33 dependent there upon are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. In claims 3, 7, and 9, the recitation of “modulating alkaloid content” and/or “modulated activity of or expression of”. The limitations “modulating alkaloid content” and/or “modulated activity of or expression of” encompass both increasing and decreasing “alkaloid content” and “activity or expression of at least one Nic3 gene”, and since claims 3, 7, and 9 fail to set forth the metes and bounds of the “alkaloid content”, and/or “activity of” or “expression of”; claims 3, 7, and 9 are indefinite. Claims 3, 6, and 7 which recite “excluding the Nic3 gene SEQ ID NO: 73 and sequences with at least 95% identity thereto” are indefinite because there is nothing in the claim limiting the Nic3 locus. Although the limitation indicates what is not claimed, it does not tell us what is in the Nic3 locus that is less than 95% identical to SEQ ID NO: 73. In addition, the limitation “at least one mutation in a Nic3 gene in a Nic3 locus” is indefinite because neither claim 3, 6, or 7, has set any structural limitation for a Nic3 locus gene. Claim 9 recites the limitation "a Nic3 gene selected from SEQ ID NO: 73" in line 6; and since claim 9 depends from claim 7 that recites “excluding the Nic3 gene SEQ ID NO: 73” there is insufficient antecedent basis for "a Nic3 gene selected from SEQ ID NO: 73" in line 6 of claim 9. Amending the claim to delete “SEQ ID NO: 73”, to be consistent with the rest of claim 9 would obviate this rejection. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 11 recites the broad recitation in line 3 “wherein said at least one mutation in a Nic3 gene in the Nic3 locus is in a Nic3 gene selected from SEQ ID NO: 118, 124, or 127”, and the claim also recites in line 7 part i) “a mutation in the Nic3 gene”—“that results in a mutation in amino acid residues 120-584 of SEQ ID NO: 120” which is the narrower statement of the range/limitation. In a similar fashion parts ii) and iii) repeat this type of narrowing limitation with respect to SEQ ID NOs: 126 and 129 respectively. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. Regarding claim 24, the phrase "such as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d). A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 29 recites the broad recitation “said heritable mutations decrease the alkaloid content”, and the claim also recites “at least one heritable mutation” which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. In addition, since each “at least one heritable mutation” is recited in the alternative and “optionally”, “said heritable mutations” suggest that all are required for there to be a decrease in the alkaloid content and that the single gene alternatives of the claim construction are not included, thereby narrowing he claim. Additionally, claims 30 and 31 do not properly reference the “at least one heritable mutation” for each alternative established early in claim 29. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 9 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. In line 6, “SEQ ID NO: 73” is a claim element previously deleted from claim 7 from which claim 9 depends. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 3, 6-7, 9, 18-24 and 27 are rejected under 35 U.S.C. 102(a)(1) as being clearly anticipated by U.S. Patent 9988640 issued 6/05/2018. Claims 3 and 6 recite a method of modulating alkaloid content (claims 3 and 6) and having decreased alkaloid content (claim 6) by modulating the activity or expression of at least one Nic3 gene excluding SEQ ID NO: 73 and sequences with at least 95% sequence identity thereto Claims 7, 18-24 and 27 are broadly drawn to a tobacco plant having modulated activity or expression of a Nic3 gene and reduced alkaloid or nicotine content and processed tobacco leaves and cured tobacco material including blends and combustible smoking articles (i.e. cigars and cigarettes), and a smokeless delivery system (i.e. snuff). Claim 9 inadvertently recites in line 6 “a Nic3 gene selected from SEQ ID NO: 73” and continues “or a sequence which has at least 90% identity thereto” and further continues with “or orthologue of said gene” (i.e. SEQ ID NO: 73). U.S. Patent 9988640 teaches reduced alkaloid tobacco plants of N. benthamiana having reduced (i.e. modulated or modified) gene expression of NbTF5 of SEQ ID NO: 9 of the claims of the ‘640 Patent and in Example 3 in lines 15-17; and NbTF1 found in Example 3 in column 28 in lines 7-11; that are Nic3 genes from N. benthamiana, indentified as myc2 orthologues in col 26 in Table 1; 1st and 4th entries NbTF1 and NbTF5 having 93.8% and 46.9% sequence identity to instant SEQ ID NO: 73 (or SEQ ID NO: 74 the open reading frame of SEQ ID NO: 73) of the instant claims (see sequence alignments below); and further teaches cured cigarette tobacco and smokeless tobacco such as snuff (see claims 1-6; and in column 10 in lines 40-46 for tobacco products); wherein analysis of the alkaloid content of the tobacco plants of the claims of the ‘640 Patent inherently teach extracts as broadly claimed in claim 27; Further, in figure 1 and figure 4, suppression of NbTF5 and NbTF1 by VIGS in N. benthamiana plants with and without methyl-jasmonate treatment (Ex. 2 in col. 24) and RNAi suppression in transformed N. benthamiana plants (Ex. 3 col. 26-28) resulted in suppressed levels of nicotine that reads upon the modulation of a Nic3 gene activity or expression recited in Claim 3. Applicants’ assertion in the response filed 11/19/2005 states that SEQ ID NO; 73 and 74 of the instant Application (which are the genomic and cDNA polynucleotide sequences encoding the amino acid sequence of SEQ ID NO: 75; SEQ ID NO: 75 was recited in the previous rejection under 102) have 95.8% identity to SEQ ID NO: 9 of the claims of the ‘640 Patent (i.e. NbTF5). However, Applicants provide no evidence for 95.8% at the nucleotide level. Contrary to this assertion, the alignment below provides evidence that SEQ ID NO: 9 of the ‘640 Patent has 93.8% identity which is less than 95% identity to instantly claimed sequences “excluding the Nic3 gene and sequences with at least 95% sequence identity thereto” (to the Nic3 gene of SEQ ID NO: 73). In addition, SEQ ID NO: 2 of the ‘640 Patent also teaches a Myc2 orthologue from N. benthamiana falls within the scope of sequences comprising those “excluding the Nic3 gene and sequences with at least 95% sequence identity thereto” and reduction in alkaloid or nicotine content in plants expressing VIGS or transformed with RNAi constructs as stated supra. GenCore version 6.5.2 Copyright (c) 1993 - 2026 Biocceleration Ltd. OM nucleic - nucleic search, using sw model Run on: February 23, 2026, 17:38:12; Search time 1 Seconds (without alignments) 11.282 Million cell updates/sec Title: NASEQ1_02232026_173809 Perfect score: 1971 Sequence: 1 ATGACGGATTGTAGAAGACC..........CTAGAATTGCTGAATCGCGA 1971 Scoring table: IDENTITY_NUC Gapop 10.0 , Gapext 1.0 Searched: 1 seqs, 2862 residues Total number of hits satisfying chosen parameters: 2 Minimum DB seq length: 0 Maximum DB seq length: inf Post-processing: Minimum Match 0% Maximum Match 100% Database : US-17-995-675-73_f1_t2862.seq:* SUMMARIES % Result Query No. Score Match Length DB ID Description ---------------------------------------------------------------------------- 1 1849.4 93.8 2862 1 US-17-995-675-73_f1_t2862 ALIGNMENTS RESULT 1 SEQ ID NO:9 of U.S. Patent 9988640 vs US-17-995-675-73_f1_t2862 Query Match 93.8%; Score 1849.4; DB 1; Length 2862; Best Local Similarity 96.4%; Matches 1905; Conservative 0; Mismatches 66; Indels 6; Gaps 1; Qy 1 ATGACGGATTGTAGAAGACCAACGATGACTAATATATGGAGCAATACTACATCCGATGAT 60 |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| Db 410 ATGACGGATTATAGAATACCAACGATGACTAATATATGGAGCAATACTACATCCGATGAT 469 Qy 61 AATATGATGGAAGCTTTTTTATCTTCTGATCCGTCGTCGTTTTGGGCTGGAACTACTACT 120 ||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||| Db 470 AATATGATGGAAGCTTTTTTATCTTCTGATCCGTCGTCGTTTTGGCCCGGAACAACTACT 529 Qy 121 ACACCAACTCCTCGGAGTTCAGTTTCTCCGGCGCCGGCGCCGGTGACGGGGATTGCCGTA 180 ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| | Db 530 ACACCAACTCCCCGGAGTTCAGTTTCTCCAGCGCCGGCGCCGGTGACGGGGATTGCCGGA 589 Qy 181 GACCCATTAACATCTATGCCATATTTCAACCAAGAGTCACTGCAACAGCGACTTCAGACT 240 |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| Db 590 GACCCATTAAAGTCTATGCCATATTTCAACCAAGAGTCACTGCAACAGCGACTCCAGACT 649 Qy 241 TTAATCGACGGGGCTCGCGAAGCGTGGACGTATGCCATATTCTGGCAATCGTCTGTTGTG 300 |||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||| Db 650 TTAATCGATGGGGCTCGCGAAGGGTGGACGTATGCCATATTTTGGCAATCGTCTGTTGTG 709 Qy 301 GATTTCACGACCCACTCGGTTTTGGGGTGGGGAGATGGGTATTATAAAGGTGAAGAAGAT 360 |||||| ||| || |||||||||||||||||||||||||||||||||||||||||||||| Db 710 GATTTCGCGAGCCCCTCGGTTTTGGGGTGGGGAGATGGGTATTATAAAGGTGAAGAAGAT 769 Qy 361 AAAAATAAGCGCAAAACGGCGTCGTTTTCGCCTGATTTTATCACGGAGCAAGCACACCGG 420 ||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||| Db 770 AAAAATAAGCGTAAAACGGCGTCGTTTTCGCCTGACTTTATCACGGAACAAGCACACCGG 829 Qy 421 AAAAAGGTTCTCCGGGAGCTGAATTGTTTAATTTCCGGCACACAAACTGGTGGTGAAAAT 480 ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| Db 830 AAAAAGGTTCTCCGGGAGCTGAATTCTTTAATTTCCGGCACACAAACCGGTGGTGAAAAT 889 Qy 481 GATGCTGTAGATGAAGAAGTAACGGATACTGAATGGTTTTTTCTGATTTCCATGACTCAA 540 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| Db 890 GATGCTGTAGATGAAGAAGTAACTGATACTGAATGGTTTTTTCTGATTTCCATGACACAA 949 Qy 541 TCGTTCGTTAACGGAAGCGGGCTTCCGGGCCTGGCGATGTACAGCTCAAGCCCGATTTGG 600 ||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||| Db 950 TCGTTTGTTAACGGAAGCGGGCTTCCGGGCCTGGCGATGTATAGTTCAAGCCCGATTTGG 1009 Qy 601 GTTACTGGAGCAGAGAGATTAGCTGCTTCGCACTGTGAACGGGCCCGACAGGCCCAAGGT 660 ||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||| Db 1010 GTTACTGGAACAGAGAGATTAGCTGTTTCTCACTGTGAACGGGCCCGACAGGCCCAAGGT 1069 Qy 661 TTCGGGCTTCAGACTATTGTTTGTATTCCTTCAGGTAATGGTGTTGTTGAGCTCGGGTCA 720 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Db 1070 TTCGGGCTTCAGACTATTGTTTGTATTCCTTCAGCTAATGGTGTTGTTGAGCTCGGGTCA 1129 Qy 721 ACTGAGTTGATATTCCAGACTGCTGATTTAATGAACAAGGTTAAAGTTTTGTTTAATTTT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1130 ACTGAGTTGATATTCCAGACTGCTGATTTAATGAACAAGGTTAAAGTTTTGTTTAATTTT 1189 Qy 781 AATATTGATATGGGTGCGACTACGGGCTCAGGATCGGGCTCATGTGCTATTCAGGCCGAG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1190 AATATTGATATGGGTGCGACTACGGGCTCAGGATCGGGCTCATGTGCTATTCAGGCCGAG 1249 Qy 841 CCCGATACTTCAGCCCTTTGGCTGACGGATCCAGCTTCCTCAGCTGTGGAAGTCAAGGAT 900 |||||| ||||||||||||||||||| ||||| ||||| |||| |||||||||||||||| Db 1250 CCCGATCCTTCAGCCCTTTGGCTGACTGATCCGGCTTCTTCAGTTGTGGAAGTCAAGGAT 1309 Qy 901 TCGTCTAATACAGTTCCTTCAAGTAATAGCAGTAAGCAACTTGTGTTTGGAAATGAGAAT 960 ||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||| Db 1310 TCGTCGAATACAGTTCCTTCAAGGAATACCAGTAAGCAACTTGTGTTTGGAAATGAGAAT 1369 Qy 961 TCTGAAAATGGTAATCAAAATTCTCAGCAAACACAAGGATTTTTCACCAGGGAGTTGAAT 1020 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 1370 TCTGAAAATGGTAATCAAAATTCTCAGCAAACACAAGGATTTTTCACTAGGGAGTTGAAT 1429 Qy 1021 TTTTCCGAATATGGATTTGATGGAAGTAATACTCGG------AATGGGAATGTGAATTCT 1074 |||||||||||||||||||||||||||||||||||| |||||||||| ||||||| Db 1430 TTTTCCGAATATGGATTTGATGGAAGTAATACTCGGTATGGAAATGGGAATGCGAATTCT 1489 Qy 1075 TCGCGTTCTTGCCAGCCTGAGTCTGGTGAAATCTTGAATTTTGGTGATAGTACTAAGAGA 1134 |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Db 1490 TCGCGTTCTTGCAAGCCTGAGTCTGGTGAAATCTTGAATTTTGGTGATAGTACTAAGAGG 1549 Qy 1135 AGTGCTTCAAGTGCAAATGGGAGCTTGTTTTCGGGCCAATCACAGTTTGGGCCCGGGCCC 1194 ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| Db 1550 AGTGCTTGCAGTGCAAATGGGAGCTTGTTTTCGGGCCAATCACAGTTCGGGCCCGGGCCT 1609 Qy 1195 GCGGAGGAGAACAAGAACAAGAACAAGAAAAGGTCACCTGCATCAAGAGGAAGCAACGAT 1254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1610 GCGGAGGAGAACAAGAACAAGAACAAGAAAAGGTCACCTGCATCAAGAGGAAGCAACGAT 1669 Qy 1255 GAAGGAATGCTTTCATTTGTTTCGGGTGTGATTTTGCCAAGTTCAAACACGGGGAAGTCT 1314 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Db 1670 GAAGGAATCCTTTCATTTGTTTCGGGTGTGATTTTGCCAAGTTCAAACACGGGGAAGTCC 1729 Qy 1315 GGTGGAGGTGGCGATTCGGATCAATCAGATCTCGAGGCTTCGGTGGTGAAGGAAGCGGAT 1374 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Db 1730 GGTGGAGGTGGCGATTCGGATCAATCAGATCTCGAGGCTTCGGTGGTGAAGGAGGCGGAT 1789 Qy 1375 AGTAGTAGAGTTGTAGACCCGGAGAAGAAGCCGAGGAAACGAGGGAGGAAACCGGCTAAC 1434 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Db 1790 AGTAGTAGAGTTGTAGACCCCGAGAAGAAGCCGAGGAAACGAGGGAGGAAACCGGCTAAC 1849 Qy 1435 GGGAGAGAGGAGCCATTGAATCATGTGGAGGCAGAGAGGCAAAGGAGGGAGAAATTAAAT 1494 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| Db 1850 GGGAGAGAGGAGCCATTGAATCATGTGGAGGCAGAGAGACAAAGGAGGGAGAAATTGAAT 1909 Qy 1495 CAAAGATTCTATGCACTTAGAGCAGTTGTACCAAATGTGTCAAAAATGGATAAAGCATCA 1554 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Db 1910 CAAAGATTCTATGCACTTAGAGCTGTTGTACCAAATGTGTCAAAAATGGATAAAGCATCA 1969 Qy 1555 CTTCTTGGTGATGCAATTGCATTTATCAATGAGTTGAAATCAAAGGTTCAGAATTCTGAC 1614 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1970 CTTCTTGGTGATGCAATTGCATTTATCAATGAGTTGAAATCAAAGGTTCAGAATTCTGAC 2029 Qy 1615 TCAGATAAAGAGGAGTTGAGGAACCAAATTGAATCTTTAAGGAATGAATTAGCCAACAAG 1674 |||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| Db 2030 TCAGATAAAGAGGACTTGAGGAACCAAATCGAATCTTTAAGGAATGAATTAGCCAACAAG 2089 Qy 1675 GGATCAAACTATACCGGTCCTCCACCGTTAAATCAAGAACTCAAGATTGTAGATATGGAT 1734 ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| Db 2090 GGATCAAACTATACCGGTCCTCCCCCGTCAAATCAAGAACTCAAGATTGTAGATATGGAC 2149 Qy 1735 ATCGACGTTAAGGTGATCGGATGGGATGCTATGATTCGTATACAATCTAATAAAAAGAAC 1794 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2150 ATCGACGTTAAGGTGATCGGATGGGATGCTATGATTCGTATACAATCTAATAAAAAGAAC 2209 Qy 1795 CATCCAGCCGCGAAGTTAATGGCCGCTCTCATGGAATTGGACTTAGATGTGCACCATGCT 1854 ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| Db 2210 CATCCAGCCGCGAGGTTAATGACCGCTCTCATGGAATTGGACTTAGATGTGCACCATGCT 2269 Qy 1855 AGTGTTTCAGTGGTCAACGAGTTGATGATCCAACAAGCAACTGTGAAAATGGGGAGTCGG 1914 ||||||||||| |||||||||||||||||||||||||| |||||||||||||| || ||| Db 2270 AGTGTTTCAGTTGTCAACGAGTTGATGATCCAACAAGCGACTGTGAAAATGGGAAGCCGG 2329 Qy 1915 CTTTACACGCAAGAACAACTTCGGATATCATTGACATCTAGAATTGCTGAATCGCGA 1971 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 2330 CTTTACACGCAAGAACAACTTCGGATATCATTGACATCCAGAATTGCTGAATCGCGA 2386 GenCore version 6.5.2 Copyright (c) 1993 - 2026 Biocceleration Ltd. OM nucleic - nucleic search, using sw model Run on: March 4, 2026, 16:47:26 ; Search time 1 Seconds (without alignments) 8.090 Million cell updates/sec Title: US-17-995-675-74_f1_t1980 vs NbTF1 SEQ ID NO: 2 of US PAT 9988640 Perfect score: 1980 Sequence: 1 atgacggattatagaatacc..........gaattgctgaatcgcgatga 1980 Scoring table: IDENTITY_NUC Gapop 10.0 , Gapext 1.0 Searched: 1 seqs, 2043 residues Total number of hits satisfying chosen parameters: 2 Minimum DB seq length: 0 Maximum DB seq length: inf Post-processing: Minimum Match 0% Maximum Match 100% Listing first 2 summaries Database : NASEQ2_03042026_164721.seq:* SUMMARIES % Result Query No. Score Match Length DB ID Description ---------------------------------------------------------------------------- 1 928 46.9 2043 1 NASEQ2_03042026_164721 c 2 19 1.0 2043 1 NASEQ2_03042026_164721 ALIGNMENTS RESULT 1 NASEQ2_03042026_164721 Query Match 46.9%; Score 928; DB 1; Length 2043; Best Local Similarity 72.8%; Matches 1385; Conservative 0; Mismatches 400; Indels 117; Gaps 10; Qy 145 TCTCCAGCGCCGGCGCCGGTGACGGGGATTGCCGGAGACCCATTAAAGTCTATGCCATAT 204 ||| | | | | || || | | | | || | | ||| || ||| | ||| Db 193 TCTTCTTGTGCTTCTACTGTCACAGCTGTGCCTGTCGATGCTTCAAAATCGATGTCTTAT 252 Qy 205 TTCAACCAAGAGTCACTGCAACAGCGACTCCAGACTTTAATCGATGGGGCTCGCGAAGGG 264 ||||||||||| | || |||||||| ||||| || | || ||||| ||||| ||| | Db 253 TTCAACCAAGAAACTCTTCAACAGCGTCTCCAAACCCTCATTGATGGTGCTCGTGAAACG 312 Qy 265 TGGACGTATGCCATATTTTGGCAATCGTCTGTTGTGGATTTCGCGAGCCCCTCGGTTTTG 324 ||||| || |||||||||||||| || || ||||| ||||| |||| || | ||| Db 313 TGGACCTACGCCATATTTTGGCAGTCATCCGTTGTTGATTTAACGAGTCCGATTTTGTTG 372 Qy 325 GGGTGGGGAGATGGGTATTATAAAGGTGAAGAAGATAAAAATAAGCGTAAAACGGCGTCG 384 | ||||||||||| || || |||||||||||||||||| || | ||| || Db 373 GTCTGGGGAGATGGTTACTACAAAGGTGAAGAAGATAAAGCCAATAGGAAATTAGCTGTT 432 Qy 385 TTTTCGCCTGACTTTATCACGGAACAAGCACACCGGAAAAAGGTTCTCCGGGAGCTGAAT 444 | ||| |||| | ||| | || |||| ||||||||||||||||||||| ||||||||| Db 433 TCTTCTCCTGCTTATATAGCTGAGCAAGAACACCGGAAAAAGGTTCTCCGTGAGCTGAAT 492 Qy 445 TCTTTAATTTCCGGCACACAAACCGGTGGTGAAAATGATGCTGTAGATGAAGAAGTAACT 504 || || || |||||||| |||||||| | |||||||| || ||||||||||| || Db 493 TCGTTGATCTCCGGCACGCAAACCGGCACT---AATGATGCCGTCGATGAAGAAGTTACC 549 Qy 505 GATACTGAATGGTTTTTTCTGATTTCCATGACACAATCGTTTGTTAACGGAAGCGGGCTT 564 || ||||||||||| || || ||||||||||| | |||||||||||||||||| |||||| Db 550 GACACTGAATGGTTCTTCCTTATTTCCATGACCCCATCGTTTGTTAACGGAAGTGGGCTT 609 Qy 565 CCGGGCCTGGCGATGTATAGTTCAAGCCCGATTTGGGTTACTGGAACAGAGAGATTAGCT 624 ||||| | ||| | || | ||| ||||| |||||||| ||| |||||| ||| || Db 610 CCGGGTCAGGCCTTATACAATTCCAGCCCTATTTGGGTCTTCGGAGCAGAGAAATTGGCA 669 Qy 625 GTTTCTCACTGTGAACGGGCCCGACAGGCCCAAGGTTTCGGGCTTCAGACTATTGTTTGT 684 | ||| ||||| |||||||| || |||||||| || |||||||||||||| || |||||| Db 670 GCTTCCCACTGCGAACGGGCTCGGCAGGCCCAGGGATTCGGGCTTCAGACAATGGTTTGT 729 Qy 685 ATTCCTTCAGCTAATGGTGTTGTTGAGCTCGGGTCAACTGAGTTGATATTCCAGACTGCT 744 ||||||||||| || || || ||||| | || || || |||||||| | |||| | || Db 730 ATTCCTTCAGCAAACGGCGTGGTTGAATTGGGCTCCACGGAGTTGATTATTCAGAGTTCT 789 Qy 745 GATTTAATGAACAAGGTTAAAGTTTTGTTTAATTTTAATATTGATATGGGTGCGACTACG 804 ||| | || |||||||||| ||| |||||||| || |||| |||| || Db 790 GATATCATCAACAAGGTTAGAGTATTGTTTAACTTCAATAATGATTTG------------ 837 Qy 805 GGCTCAGGATCGGGCTCATGTGCTATTCAGGCCGAGCCCGATCCTTCAGCCCTTTGGCTG 864 || || || || || ||| | ||| ||||| |||||| || || |||||||| Db 838 ------GGCTCTGGTTCGTGGGCTGTGCAGCCCGAGAGCGATCCGTCCGCTCTTTGGCTC 891 Qy 865 ACTGATCCGGCTTCTTCAGTTGTGGAAGTCAAGGATT------------CGTCGAATACA 912 |||||||| | || ||| ||| || || |||| | | ||| || Db 892 ACTGATCCATCGCCTGCAGCTGTACCTGTGAAAGATTTAAATACAGTTGAGGCAAATTCA 951 Qy 913 GTTCCTTCAAGGAATACCAGTAAGCAACTTGTGTTTGGAAATGAGAATTCTGAAAATGGT 972 ||||| |||| |||| ||||||||||||||||||| ||||||||| || | || Db 952 GTTCCACCAAGTAATAGTAGTAAGCAACTTGTGTTTGATAATGAGAATAATGGTCAAAGT 1011 Qy 973 AATCAAAA------------------TTCTCAGCAAACACAAGGATTTTTCACTAGGGAG 1014 | | || | || |||||||||||||||||||| |||||| Db 1012 TGTGATAATCAGCAACAGCACCATTCTCAGCAACAAACACAAGGATTTTTCACAAGGGAG 1071 Qy 1015 TTGAATTTTTCCGAATATGGATTTGATGGAAGTAATACTCGGTATGGAAATGGGAATGCG 1074 ||||||||||| |||| || ||||||||| |||||| | | | |||||| Db 1072 TTGAATTTTTCAGAATTCGGGTTTGATGGATGTAATAAT---------ATTAGGAATGGT 1122 Qy 1075 AATTCTTCGCGTTCTTGCAAGCCTGAGTCTGGTGAAATCTTGAATTTTGGTGATAGTACT 1134 ||||| || |||||||||||| ||||| || ||||||||||||||| ||||||| || Db 1123 AATTCATCAGTTTCTTGCAAGCCAGAGTCGGGGGAAATCTTGAATTTTTGTGATAGCCCT 1182 Qy 1135 AAGAGGAGTGCTTGCAGTGCAAATGGGAGCTTGTTTTCGGGCCAATCACAGTTCGGGCCC 1194 |||| ||||||||||||| ||| |||||| | || || || || ||| | Db 1183 AAGAAA---------AGTGCAAATGGGAACTTATTTTCGTGTCAGTCCCATTTTGGGGCA 1233 Qy 1195 GGGCCTGCGGAGGAGAACAAGAACAAGAACAAGAAAAGGTCACCTGCATCAAGAGGAAGC 1254 || | | |||| |||||||||||||||||| |||| || ||||||||| Db 1234 GG------------GGAGGAGAATAAGAACAAGAAAAGGTCAGCTGCTTCCAGAGGAAGC 1281 Qy 1255 AACGATGAAGGAATCCTTTCATTTGTTTCGGGTGTGATTTTGC---CAAGTTCAAACACG 1311 || || |||||||| |||||||||||||| ||| || |||| || ||| || Db 1282 AATGAAGAAGGAATGCTTTCATTTGTTTCAGGTACAATCTTGCCTGCAGCTTCTGGTGCG 1341 Qy 1312 GGGAAGTCCGGTGGAGGTGGCGAT---------TCGGATCAATCAGATCTCGAGGCTTCG 1362 |||||| |||| | | || | || ||||| |||||||| ||||| || Db 1342 ATGAAGTCAATTGGATGCGTCGCTGAAGGCTCCTCTGATCATTCAGATCTTGAGGCCTCA 1401 Qy 1363 GTGGTGAAGGAGGCGGATAGTAGTAGAGTTGTAGACCCCGAGAAGAAGCCGAGGAAACGA 1422 ||||||| || || || ||||||||||||||||| ||||| |||| ||| | ||| ||| Db 1402 CTGGTGAAAGAAGCTGAAAGTAGTAGAGTTGTAGAACCCGAAAAGAGGCCAAAGAAGCGA 1461 Qy 1423 GGGAGGAAACCGGCTAACGGGAGAGAGGAGCCATTGAATCATGTGGAGGCAGAGAGACAA 1482 || ||||| || || || || | ||||| || |||||||| || || |||||||| ||| Db 1462 GGAAGGAAGCCAGCAAATGGACGTGAGGAACCTTTGAATCACGTCGAAGCAGAGAGGCAA 1521 Qy 1483 AGGAGGGAGAAATTGAATCAAAGATTCTATGCACTTAGAGCTGTTGTACCAAATGTGTCA 1542 ||||| |||||||| || ||||| ||||| || | ||||||||||| || |||||||| Db 1522 AGGAGAGAGAAATTAAACCAAAGGTTCTACGCTTTAAGAGCTGTTGTTCCGAATGTGTCC 1581 Qy 1543 AAAATGGATAAAGCATCACTTCTTGGTGATGCAATTGCATTTATCAATGAGTTGAAATCA 1602 |||||||| || |||||||| ||||| ||||||||| ||| ||| |||||| |||| | Db 1582 AAAATGGACAAGGCATCACTGCTTGGAGATGCAATTTCATATATTAATGAGCTGAAGTTG 1641 Qy 1603 AAGGTTCAGAATTCTGACTCAGATAAAGAGGACTTGAGGAACCAAATCGAATCTTTAAGG 1662 ||| |||| ||| | || |||||| || |||||| || |||||| ||| ||| | | Db 1642 AAGCTTCAAAATACAGAAACAGATAGGGAAAACTTGAAGAGCCAAATAGAAGATTTGAAG 1701 Qy 1663 AATGAATTAGCCAACAAGGGATCAAACTATACCGGTCCTCCCCCGTCAAATCAAGAACTC 1722 || |||||||| | || | |||| | |||||||| || |||||||||| | | Db 1702 AAAGAATTAGCTAGTAAAGACTCAAGGCGCCCTGGTCCTCCACCACCAAATCAAGATCAC 1761 Qy 1723 AAGA------------------------TTGTAGATATGGACATCGACGTTAAGGTGATC 1758 |||| |||||||| |||| || || |||||||| || Db 1762 AAGATGTCTAGCCATACTGGGAGCAAGGTTGTAGATGTGGATATAGATGTTAAGGTAATT 1821 Qy 1759 GGATGGGATGCTATGATTCGTATACAATCTAATAAAAAGAACCATCCAGCCGCGAGGTTA 1818 ||||||||||| |||||| || |||||| ||||||||| ||||| ||||| || |||||| Db 1822 GGATGGGATGCGATGATTAGTGTACAATGTAATAAAAATAACCACCCAGCTGCAAGGTTA 1881 Qy 1819 ATGACCGCTCTCATGGAATTGGACTTAGATGTGCACCATGCTAGTGTTTCAGTTGTCAAC 1878 ||| || |||| ||| || || |||||||||||||||| ||||||||||| || ||| Db 1882 ATGGTAGCCCTCAAGGAGTTAGATCTAGATGTGCACCATGCCAGTGTTTCAGTGGTGAAC 1941 Qy 1879 GAGTTGATGATCCAACAAGCGACTGTGAAAATGGGAAGCCGGCTTTACACGCAAGAACAA 1938 || ||||||||||||||||| || ||||||||||| ||| | ||||||||| |||| ||| Db 1942 GATTTGATGATCCAACAAGCCACAGTGAAAATGGGTAGCAGACTTTACACGGAAGAGCAA 2001 Qy 1939 CTTCGGATATCATTGACATCCAGAATTGCTGAATCGCGATGA 1980 ||| ||||| |||||||||||||| |||||||| | || | | Db 2002 CTTAGGATAGCATTGACATCCAGAGTTGCTGAAACACGCTAA 2043 Conclusion All claims remain rejected. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUSSELL KALLIS whose telephone number is (571)272-0798. The examiner can normally be reached Monday-Friday 8AM-5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 5712707058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RUSSELL KALLIS/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Oct 06, 2022
Application Filed
May 05, 2023
Response after Non-Final Action
Aug 15, 2025
Non-Final Rejection — §102, §112
Nov 19, 2025
Response Filed
Mar 04, 2026
Final Rejection — §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12599085
SOYBEAN VARIETY
2y 5m to grant Granted Apr 14, 2026
Patent 12599096
SOYBEAN CULTIVAR 24360225
2y 5m to grant Granted Apr 14, 2026
Patent 12593794
SOYBEAN CULTIVAR 27080914
2y 5m to grant Granted Apr 07, 2026
Patent 12593801
SOYBEAN CULTIVAR 21031508
2y 5m to grant Granted Apr 07, 2026
Patent 12593802
SOYBEAN CULTIVAR 21120033
2y 5m to grant Granted Apr 07, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
87%
Grant Probability
95%
With Interview (+7.8%)
2y 6m
Median Time to Grant
Moderate
PTA Risk
Based on 1153 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month