Prosecution Insights
Last updated: October 02, 2026
Application No. 17/996,287

IDENTIFICATION OF NSP1 GENE AS TARGET OF SARS-COV-2 REAL-TIME RT-PCR USING NANOPORE WHOLE GENOME SEQUENCING

Final Rejection §103§112
Filed
Oct 14, 2022
Priority
Apr 21, 2020 — provisional 63/013,282 +1 more
Examiner
WANG, RUIXUE
Art Unit
1672
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The University of Hong Kong
OA Round
2 (Final)
57%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
75%
With Interview

Examiner Intelligence

Grants 57% of resolved cases
57%
Career Allowance Rate
66 granted / 115 resolved
-2.6% vs TC avg
Strong +18% interview lift
Without
With
+17.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 4m
Avg Prosecution
61 currently pending
Career history
172
Total Applications
across all art units

Statute-Specific Performance

§101
4.6%
-35.4% vs TC avg
§103
42.7%
+2.7% vs TC avg
§102
15.9%
-24.1% vs TC avg
§112
34.2%
-5.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 115 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Acknowledgement is hereby made of receipt and entry of the communication filed on Mar. 17, 2026. Claims 1-4, 6, 8, 13-17, 20-25 and 28 are pending. Claims 13-17 and 20-25 are withdrawn. Claims 1-4, 6, 8 and 28 are examined. Drawing Objection (Previous objection- withdrawn) The drawings are objected to under 37 CFR 1.83(a). The drawings must show every feature of the invention specified in the claims. Some Figures are difficult to read, such as the alignment of the NSP1 primers and probes in Fig. 1 and the coverage map of Fig. 2. Therefore, the Fig. 1-2 must clearly show the sequences and labels. This objection is withdrawn in view of the amendment filed on Mar. 17, 2026. Claim Objections (Previous objection- withdrawn) Claim 1 is objected to because of the following informalities: The base claim 1 recites the abbreviation NSP1 without spelling it out the first time it appears in the claims set. This objection is withdrawn in view of the amendment filed on Mar. 17, 2026. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION. —The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. (Previous rejection- withdrawn) Claim 8 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This rejection is withdrawn in view of the amendment filed on Mar. 17, 2026. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. (New Rejection-necessitated by amendment) Claims 1-4, 6, 8 and 28 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. These claims are drawing a composition comprising a primer and probe that has at least 90% nucleic acid sequence identity to the SEQ ID NO: 1, 2 and 3 for detecting the NSP1 gene of SARS-COV-2, respectively. The written description rejection is made because the claims are interpreted as being drawn to a composition comprising the primer and probe as being “at least 90%” sequence identity to the instant claimed SEQ ID NOs 1, 2, 3. This means that up to 10% of the nucleic acid sequence of the primers SEQ ID NO: 1, 2 and probe 3 can vary. The applicable standard for the written description requirement can be found in MPEP 2163; University of California v. Eli Lilly, 43 USPQ2d 1398 at 1407; PTO Written Description Guidelines; Enzo Biochem Inc. v. Gen-Probe Inc., 63 USPQ2d 1609; Vas- Cath Inc. v. Mahurkar, 19 USPQ2d 1111; and University of Rochester v. G.D. Searle & Co., 69 USPQ2d 1886 (CAFC 2004). The instant specification discloses that sequences for detection of SARS-CoV-2 are provided and can, for example, include or consist of a sequence of any of CATTCAGTACGGTCGTAGTGGTGAG (SEQ ID NO: 1 ), CCTTGCGGTAAGCCACTGGTA (SEQ ID NO:2), CCCACATGAGGGACAAGGACACCA (SEQ ID NO:3), a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, a nucleic acid sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitution(s), addition(s), deletion(s), or a combination thereof relative thereto, or the reverse complement of any of the foregoing (See [0008]). However, the specification does not indicate if these variations with up to 10% difference can still amplify a NSP1 gene for SARS-COV-2 detection as claimed. It is common knowledge in the art that the primer and probe variations significantly affect PCR results, impacting specificity, sensitivity, amplification efficiency, and quantification accuracy. This can be evidenced by Simsek’s study (J Sci Res Med Sci. 2000 Jan;2(1):11-4). Simsek studies the effect of single mismatches at 3′–end of primers on polymerase chain reaction and teaches that the primers having G/A or G/G mismatches at the 3′-end did not produce any specific polymerase chain reaction (PCR) fragment at all the annealing temperatures used, except a barely detectable 268 bp product for the G/G mismatch at 45 and 50°C (See Results). Therefore, there is no evidence or support to demonstrate that the NSP1 gene can still be amplified with up to 10% variations in the primer/probe. The court clearly states in Vas-Cath Inc. v. Mahurkar, 19 USPQ2d 1111, that "applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the 'written description' inquiry, whatever is now claimed." (See page 1117.). As discussed above, the skilled artisan cannot envision the detailed primer/probe sequence that are "at least 90% identical” to the claimed SEQ ID NOs. therefore, the full breadth of the claims does not meet the written description provision of 35 U.S.C. 112, first paragraph. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. (Previous rejection-maintained with edition) Claims 1-4, 6, 8 and 28 are rejected under 35 U.S.C. 103 as being unpatentable over Jung et al. (bioRxiv preprint doi: https://doi.org/10.1101/2020.02.25.964775; this version posted February 27, 2020) as evidenced by Ghaleh et al. (bioRxiv [Preprint]. 2022 Jul 25:2022.07.22.501212), CFX96 (https://www.labservis.com/sites/default/files/2020-03/pcr_real_time_amplificator_cfx_96.pdf) and Corman et al. (Euro Surveill. 2020 Jan;25(3):2000045). The base claim 1 is directed to a composition comprising a nucleic acid primer pair for the detection of SARS-CoV-2 NSP1 gene wherein the primer pair comprises SEQ ID NO:1 and SEQ ID NO:2, or a nucleic acid sequence having at least 90% sequence identity to any of the foregoing, and an optionally a probe comprising SEQ ID NO:3 or a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:3. Jung et al. teaches a comparative analysis of various primer-probe sets targeting RdRp/Orf1 and N region of SARS-CoV-2 for the laboratory confirmation of SARS-CoV-2 (See page 3, paragraph 3). Although Jung et al. does not explicitly use a word “composition” as claimed, a primer-probe set for qRT-PCR using the CFX 96 touch real-time PCR detection system (See page 5) can be reasonably considered as a “composition” containing the PCR components in the set. The teaching can be evidenced by the handbook of the CFX 96 touch real-time PCR detection system. The CFX96 teaches that the optimal real-time PCR results rely on the synergy of all the products, so Bio-Rad created optimized components for each step of customer’s experiment (See page 6) and a FAM-labeled detection probe with iQ™ Supermix shows an excellent uniformity (See page 4, all Figures). Jung et al. teaches using seven primer-probe sets for N gene and the three primer-probe sets for Orf1 gene to detect SARS-COV-2, and the result of the comparative analysis represented that the ‘2019-nCoV_N2, N3’ of USA and the ‘ORF1ab’ of China are the most sensitive primer-probe sets for N and Orf1 genes, respectively. Therefore, the appropriate combination from ORF1ab (China), 2019-nCoV_N2, N3 (USA), and NIID_2019-nCOV_N (Japan) sets should be selected for the sensitive and reliable laboratory confirmation of SARS-CoV-2. (See Abstract; Figure 1, page 11 and below), where the Orf1ab contains the NSP1 gene as claimed, which can be evidenced by Ghaleh’s study. Ghaleh teaches that NSP1 is located in the N-terminal region of the ORF1ab sequence that is susceptible to many mutations (See page 2, right column, paragraph 2.1.). Although Jung does not explicitly recite a specific example for using the claimed SEQ ID NOs: 1-3 as primer/probe, Jung teaches that a relative position of qRT-PCR primer-probe set can be at the ORF1ab region (See Fig. 1 and below), and the GenBank MN908947.3 used by Jung comprises the claimed SEQ ID NOs: 1-3 as claimed (See Table A, B and C below). It is a common knowledge that the PCR primer and probe design is a routine technique in the art. Based on the description above, it would be obvious for one of ordinary skill in the art to design a primer pair and probe as claimed through routine experimental optimization. Therefore, the claimed composition with the primers and probe would have been obvious unless there is evidence showing that they produce unexpected results. Also, the descriptions above teach the claims 2-4 and 6 for comprising or consisting of the nucleic acid sequence of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3 as claimed (See Table A, B and C below), and teach the claims 8 and 28 at comprising a 5' fluorescent reporter and a 3' quencher as claimed at the probe in CFX96 system can be labeled with 5’-Fam and with a 3’-quencher (See CFX96, page 4), which can be evidenced by one of Jung’s references, Corman’s study. Corman’s primer/probe Table 1 (See page 2 and below) shows that the probes are labeled 5' fluorescent reporter FAM and a 3' quencher BBQ. PNG media_image1.png 634 888 media_image1.png Greyscale PNG media_image2.png 967 695 media_image2.png Greyscale PNG media_image3.png 466 865 media_image3.png Greyscale Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Responses to Applicant’s Remarks Applicant’s arguments filed on Mar. 17, 2026 has been received and fully considered. 1). Applicant’s amendment on the drawing is considered. The objection is withdrawn. 2). Applicant’s amendment on the claim 1 objection is considered. The objection is withdrawn. 3). Applicant’s amendment on claim 8 is considered. The 112 (b) rejection for claim 8 is withdrawn. 4). Applicant’s amendment and argument on the rejection under 35 U.S.C. 112(a) is not found persuasive as follows: Applicant argued that a 90% sequence identity corresponds to about 2 nucleotide(s) difference within the NSP1 primer or probe sequences of SEQ ID NOs: 1-3, and one of ordinary skill in the art would readily recognize from the sequence alignments in Figures 1 which nucleotide positions cannot be altered without compromising assay specificity (See Remarks, page 8). The argument is not persuasive. First, the “at least 90%” in the amended claims does not cite limitations to compare with what strain of the coronaviruses as argued in the Fig. 1 (See Fig. 1, instant specification and below). Therefore, one of ordinary skill in the art would not readily recognize from any sequence alignments which nucleotide positions cannot be altered without compromising assay specificity. PNG media_image4.png 376 1020 media_image4.png Greyscale Second, it is common knowledge in the art that the primer and probe variations significantly affect PCR results, impacting specificity, sensitivity, amplification efficiency, and quantification accuracy. This can be evidenced by Simsek’s study (J Sci Res Med Sci. 2000 Jan;2(1):11-4). Simsek studies the effect of single mismatches at 3′–end of primers on polymerase chain reaction and teaches that the primers having G/A or G/G mismatches at the 3′-end did not produce any specific polymerase chain reaction (PCR) fragment at all the annealing temperatures used, except a barely detectable 268 bp product for the G/G mismatch at 45 and 50°C (See Results). 5). Applicant’s arguments on the rejection under 35 U.S.C. § 103 is not found persuasive. i). Applicant argued that there is no motivation or teaching in Jung, Corman, or a combination thereof to design primer probes for the NSPJ gene (See Remarks, pages 10-11). The argument is not percussive because Jung teaches their study shows that the ‘ORF1ab’ of China are the most sensitive primer-probe sets for N and Orf1 genes, respectively (See Abstract). Although Jung does not use the primers in NSP1 region to perform the analysis, Jung’s ORF1ab comprises the sequences of SEQ ID NOs: 1-3 as claimed (See Table A-C above). It would be obvious for one of ordinary skill in the art to design a primer pair and probe as claimed through routine experimental optimization. Therefore, the claimed composition with the primers and probe would have been obvious unless there is evidence showing that they produce unexpected results. Also, Jung teaches that “Since the human-to-human transmission occurred easily and the human infection is rapidly increasing, the sensitive and early diagnosis is essential to prevent the global outbreak” (See Abstract), which can be a motivation for optimizing a primer pair and probe to detect Sars-Cov-2. At the same time, Jung teaches the ORF1ab is the sensitive region for detecting SARS-COV-2 (See Abstract). Although Jung designed the primers/probe from NSP12, one of the skilled in the art can have a motivation to design a primer/probe through all the ORF1ab gene including NSP1. This is also a response to the argument at “as stated in Jung, Seven of the 10 sets of primers were derived from the N gene and the other three sets were derived from Orfl gene (RdRp, ORF lbnsp 14 and ORF 1-NsplO (see Jung, page 4, para. 1, last three lines). RdRp (RNA-dependent RNA polymerase is also known as nsp12 (See Remarks, page 11). ii). Applicant argued that Jung is entirely silent on primer-probe sets for targeting the nsp 1 gene in particular. Further, Jung does not even provide any rationale as to why one may choose to design primer probe sets for any particular region within the SARS-CoV-2 genome. All Jung provides is a list of primer-probe sets that were known at the time and a comparison of their sensitivities (See Remarks, page 12). The argument is not persuasive. Jung does not specifically point out the NSP1, but Jung teaches the ORF1ab that comprises the NSP1. Primer/probe is a common technique in the art. It would be obvious for one of ordinary skill in the art to design a primer pair and probe as claimed through routine experimental optimization. Therefore, the claimed composition with the primers and probe would have been obvious unless there is evidence showing that they produce unexpected results. In addition, applicant allegedly argued that “As the Examiner may recall, at the time the SARS-CoV-2 genome was published, the world was in the midst of an unprecedented global health emergency. The emergence of SARSCoV-2 created a situation of scientific uncertainty and urgency unlike any seen in recent history. When the initial genomic sequences of SARS-CoV-2 isolates were initially studied, little was known about the virus's biology, mutation patterns, or gene expression. Laboratories around the world were racing to understand how the SARS-CoV-2 virus spread, how it could be detected, and develop diagnostic assays that could be rapidly deployed to control its transmission. In this context, there was no clear guidance or consensus regarding which genomic regions could reliably distinguish SARS-CoV-2 from other coronaviruses with high sensitivity” (See Remarks, bridging pages 12-13). Based on the alleged arguments, it actually demonstrates that one of the skilled in the art would have the motivation to test any primer/probe designed from all the ORF1ab including the NSP1 to search a sensitive assay for the pandemic pathogen detection because the SARS-COV-2 genome information is limited as the alleged argument by then. In addition, as for the alleged argument on the “rationale” and “guidance”, the instant claims do not have these limitations. (iii). Applicant also argued that before Applicant's own discovery of nsp 1' s expression using their own sequencing data (FIG. 3, instant Application), one of ordinary skill in the art would have been led to the assumption that nsp 1 would not be a reliable target for selective diagnostic testing. The widespread uncertainty, coupled with the lack of empirical data at the time, demonstrates that a person of ordinary skill in the art could not have predicted which nucleotide regions would yield specific and sensitive detection of SARS-CoV-2 (See Remarks, page 13). The argument is not persuasive. Based on the information discussed above, one of ordinary skill in the art would have been a motivation to design primer/probe in the ORF1ab region including the NSP1 gene. Also, Jung and Corman using a similar PCR method as claimed to detect the SARS-COV-2 by amplifying the ORF1ab region successfully which comprises the comparable composition as claimed, which are all designed from a natural SRAS-COV-2 non-structural gene. It would be obvious for one of ordinary skill in the art to design a primer pair and probe as claimed through routine experimental optimization unless there is evidence showing that they produce unexpected results. (iv). Applicant argued that Corman, on which the Examiner relies for the teaching of PCR probes for SARS-CoV-2 detection that have a fluorescent reporter and a quencher, does not cure these deficiencies (See Remarks, page 14). The argument is not persuasive. Corman here is as an evidence art to show the details how the primer/probe Jung taught in the CFX96 system. It is applicable for Jung as evidenced by Corman to teach a specific claim requirement. (v). The applicant argued that Claim 4 as amended is not obvious over Jung and Corman in view of NC_004718 (See Remarks, page 14). The argument is not persuasive. Jung in view of NC_004718 is to show the mutation as claimed in claim 4. It is applicable to be used here for a combined teaching with Jung. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUIXUE WANG whose telephone number is (571)272-7960. The examiner can normally be reached Monday-Friday 8:00 am-5:00 pm, EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone can be reached on (571) 270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RUIXUE WANG/ Examiner, Art Unit 1672 /NICOLE KINSEY WHITE/ Primary Examiner, Art Unit 1672
Read full office action

Prosecution Timeline

Oct 14, 2022
Application Filed
Nov 17, 2025
Non-Final Rejection mailed — §103, §112
Mar 17, 2026
Response Filed
Jun 02, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735754
MULTIPLEX NUCLEIC ACID DETECTION SYSTEM
4y 8m to grant Granted Sep 15, 2026
Patent 12685765
POLYPEPTIDES MIMICKING MPER AND V3-LOOP HIV-1 ENV GLYCOPROTEIN EPITOPES
2y 11m to grant Granted Jul 21, 2026
Patent 12668783
Preparation method and application of vesicle formed by erythrocyte membrane encapsulating Newcastle disease virus
3y 4m to grant Granted Jun 30, 2026
Patent 12662512
CHIMERIC POLYPEPTIDES AND USES THEREOF
4y 2m to grant Granted Jun 23, 2026
Patent 12637704
COMPOSITION AND METHOD FOR IMPROVING DETECTION OF BIOMOLECULES IN BIOFLUID SAMPLES
4y 2m to grant Granted May 26, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
57%
Grant Probability
75%
With Interview (+17.8%)
3y 4m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 115 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month