DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 4/29/2026 has been entered.
Withdrawn Rejections/Objections
The amendments to the claims, specification, and drawings overcome the rejections of record.
Specification
(1) The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code on page 26, last line. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The disclosure is objected to because of the following informalities: Page 35, line 12 recites, “The system was mixe well…”, which comprises a typographical error to change “mixe” to “mixed”.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 15-17 and 21 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 15 recites, “the vector”. Claim 15 depends upon claim 1, which recites “at least one vector”. Since the base claim specifies that more than one vector can be present, it is not apparent which vector is the vector. This can be clarified by amending the recitation in 15 to recite “the at least one vector”.
Claims 16-17 depend upon claim 15. As such, these dependent claims also comprise the indefinite recitation.
Claim 21 recites “East Asian”. This is relative language and reference to a geographical region, not to actual characteristics of a people. As such, the scope of the claimed group is not apparent because it is not apparent which peoples would be considered within metes and bounds of the claims group of people.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 4, 10, 15-21, 23-24, 44, 46, and 48-53 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for the following:
A method of disrupting a mutated RHO gene in a subject with retinitis pigmentosa (RP), comprising administering at least one vector encoding (i) a sequence encoding a gRNA and a PAM region and (ii) a CRISPR/Cas9 to the subretinal space of the subject, wherein the sequence encoding the gRNA comprises a nucleotide sequence set forth in any of SEQ ID NOS:1, 2, or 4 and the sequence encoding the PAM region comprises a nucleotide sequence se forth in any of SEQ ID NOS:39, 40, and 42, wherein the gRNA and express CRISPR/Cas9 cause a double stranded break in a mutant site of a RHO gene, wherein the mutant site is selected from the group consisting of c.C50T and c.C403T, and wherein the double stranded break disrupt the RHO gene in retinal cells of the subject; and
The composition with the recited structural elements of the gRNA and PAM region as claimed without the recitation of a therapeutic use.
The specification does not reasonably provide enablement for the following:
1) a method of treating RP; and
2) a method administers the claimed vector by any other route of administration than subretinal administration.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
While determining whether a specification is enabling, one considers whether the claimed invention provides sufficient guidance to make and use the claimed invention, if not, whether an artisan would require undue experimentation to make and use the claimed invention and whether working examples have been provided. When determining whether a specification meets the enablement requirements, some of the factors that need to be analyzed are: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and whether the quantity of any necessary experimentation to make and use the invention based on the content of the disclosure is “undue”.
Nature of Invention: The claimed invention is a gene therapy to treat RP associated with c.C50T and c.C403T mutations in the human RHO gene.
Breadth of the claims: The method claims recites “a method for treating RP”. The breath of this recitation encompasses alleviating, reducing, or ameliorating at least one of any pathological symptoms of RP. The claims further recites, “administering to the subject in need there of at least one vectors capable of removing the mutation site, the vector comprises a sequence encoding a gRNA and a PAM region”. The breadth of this recitation encompass administering the vector by any route of administration. The breadth of the administering also encompasses administering a gRNA only, without any administration of an accompanying CRISPR/Cas9 sequence.
The composition claim recites the intended use of “for treating RP in a subject”. This recitation expressly states that the composition must be able to alleviate or reduce at least one symptom of RP.
Specification Guidance (citations from the pre-grant publication):
[0095] The method described herein may include imparting a functional RHO gene to a subject in need thereof.
[0096] In certain instances, the RP described herein may be caused by the mutation(s) in the RHO gene. There are many RHO gene mutations associated with RP, and these gene mutations can cause the RHO gene to encode abnormally functional rhodopsin. The mutations may include but not limited to the missense, nonsense, insertion, deletion, and other mutations of the gene. For example, the mutation site may comprise a mutation site selected from the group consisting of c.C50T and c.C403T. Again, for example, the mutation site may result in an amino acid change, and the amino acid mutation may comprise the following changes: p.Thr17Met and/or p.Arg135Trp. In the present application, the method may include depriving a subject in need thereof of the RHO gene with a heterozygous mutation site, wherein the mutation site may be selected from the group consisting of c.C50T and c.C403T.
[0097] Any one or more mutations may be repaired to impart a functional RHO gene to a subject in need thereof. For example, c.C50T and/or c.C403T as pathological variants can be removed, restored, or corrected.
[0105] The method described herein may comprise knocking out the mutation site and/or reducing the expression level of the mutation site. The methods for knocking out a gene or reducing the expression level of a gene may include gene knockout, conditional gene knockout (e.g., using the Cre/LoxP and/or FLP-frt system), inducible gene knockout (e.g., knockout based on the Cre/loxp system, including tetracycline-induced, interferon-induced, hormone-induced, and adenovirus-induced gene knockout, etc.), gene knockout by random insertion mutation (e.g., gene trapping method), gene knockout by RNAi, gene editing technology mediated by zinc finger nucleases (ZNF), gene editing technology mediated by transcription activator-like effector nucleases (TALEN), gene editing technology mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated proteins (Cas) (CRISPR/Cas) system, and/or NgAgo-gDNA gene editing technology. For any genome editing strategy, the gene editing may be confirmed by sequencing or PCR analysis.
[0106] In certain instances, the method described herein may be a method based on in vivo cells. In certain instances, the method comprises editing the genomic DNA of the subject's cells. For example, the method may include editing the mutation in the RHO gene in the subject's cells (e.g., photoreceptor cells and/or retinal progenitor cells). For example, the gene mutation may be a mutation selected from the group consisting of c.C50T and c.C403T. Although certain cells may be ideal targets for ex vivo methods or therapies, the use of effective delivery method may also allow for the direct delivery in vivo of desired agents to such cells. In certain instances, the method may include targeting and editing relevant cells. The lysis of other cells can also be prevented by using the promoters that are active only in certain cells and/or developmental stages.
Working Examples:
Example 8. Validation of Gene Editing Efficiency in a Humanized Mouse Model
[0378] (1) Construction of Humanized Mice
[0379] The construction of humanized mice was completed by Beijing Biocytogen Co., Ltd.
[0380] 1) Preparation of humanized mice
[0381] For the human mutation site, the Beijing Biocytogen Gene Biotechnology Co., Ltd. was commissioned to construct the humanized mouse models for RHO. There were two kinds of humanized mouse models, one was a humanized mouse model carrying the RHO gene mutation site (p.Arg135Trp or p.Thr17Met), and the other was a humanized mouse model with the knock-in humanized fragment but without the mutation site.
[0382] 2) The protocols were as follows:
[0383] a) Development of humanized RHO gene point mutant mice carrying mutations (p.Thr17Met or p.Arg135Trp):
[0384] {circle around (1)} Design and construction of the gRNA that recognizes the target sequence in accordance with Scheme 1 codetermined by both sides, namely, Targeting strategy-1-EGE-System;
[0385] {circle around (2)} Construction of the CRISPR/Cas9 vector for the cleavage of target gene;
[0386] {circle around (3)} Activity detection of sgRNA/Cas9;
[0387] {circle around (4)} Design and construction of the targeting vector for gene knock-in in accordance with the protocols of Scheme 1 codetermined by both sides, to make a coding region replacement at the genomic level (4.7 kb replaced with 4.9 kb) and simultaneously introduce the mutation site, that is, c.50C>T, p.Thr17Met, or c.403C>T, p.Arg135Trp;
[0388] {circle around (5)} In vitro transcription of sgRNA/Cas9 mRNA;
[0389] {circle around (6)} Injection of sgRNA/Cas9 mRNA and targeting vector into mouse fertilized eggs;
[0390] {circle around (7)} Detection and propagation of F0 generation mice with RHO gene knock-in;
[0391] {circle around (8)} Acquisition and genotype identification of F1 generation heterozygous mice with RHO gene knock-in.
[0392] b) Development of humanized RHO gene knock-in mice:
[0393] {circle around (1)} Design and construction of the sgRNA that recognizes the target sequence in accordance with Scheme 1 codetermined by both sides, namely, Targeting strategy-1-EGE-System in the experimental scheme;
[0394] {circle around (2)} Construction of the CRISPR/Cas9 vector for the cleavage of target gene;
[0395] {circle around (3)} Activity detection of sgRNA/Cas9;
[0396] {circle around (4)} Design and construction of the targeting vector for gene knock-in in accordance with the protocols of Scheme 1, to make a coding region replacement at the genomic level (4.7 kb replaced with 4.9 kb);
[0397] {circle around (5)} In vitro transcription of sgRNA/Cas9 mRNA;
[0398] {circle around (6)} Injection of sgRNA/Cas9 mRNA and targeting vector into mouse fertilized eggs;
[0399] {circle around (7)} Detection and propagation of F0 generation mice with RHO gene knock-in;
[0400] {circle around (8)} Acquisition and genotype identification of F1 generation heterozygous mice with RHO gene knock-in.
[0401] (2) Feeding and Breeding
[0402] 1) After obtaining two kinds of humanized mice, the F1 generation heterozygous mice were inbred to obtain a sufficient number of F2 or F3 generation humanized homozygous mice as soon as possible for AAV virus injection, in order to assess the editing efficiency of AAV8-pX601-RHO-SgRNA obtained above.
[0403] (3) Genotype Identification of Humanized Mice
[0404] The primer pair WT-F/WT-R was designed for the wild gene sequence. When this pair of primers was used for PCR, only the product of the wild type allele could be amplified, while the product of mutant allele could not be amplified. The primer/Mut-R was designed for the humanized RHO gene sequence in mice. When the WT-F/Mut-R primer pair was used for PCR, only the product of mutant allele could be amplified, while the product of the wild type allele could not be amplified.
[0405] The primer sequences were shown in Table 27 below:
TABLE-US-00029 TABLE 27 Primer sequences Primer Sequence (5′-3′) Product WT-F GGCAGCAGTGGGATTAGCGTTAGTA WT: 494 (SEQ ID NO: 55) WT-R TGTGTAGAGGGTGGTGGTGAATCCT (SEQ ID NO: 56) WT-F GGCAGCAGTGGGATTAGCGTTAGTA Mut: 349 (SEQ ID NO: 55) Mut-R ACGATCAGCAGAAACATGTAGGCGG (SEQ ID NO: 57)
[0406] The WT-F/WT-R primer pair was mainly used to identify the presence of the wild-type allele, and to determine the specific genotype of the animal in combination with the PCR results of the WT-F/Mut-R primer pair: homozygous/heterozygous/wild-type.
[0407] The criteria for genotype determination were shown in Table 28:
TABLE-US-00030 TABLE 28 Genotype determination criteria WT-F/Mut-R WT-F/WT-R Mutant Wild-type Mutant Genotype Y N N H/H Y Y N H/+ N Y N +/+ Notes: Y: PCR product with the desired length as detected by gel electrophoresis; N: PCR product without the desired length as detected by gel electrophoresis; H/H: Homozygous genotype; H/+: Heterozygous genotype; +/+: Wild-type.
[0408] The PCR reaction system and program were shown in “Example 3.” The PCR product was sent for sequencing to detect whether the RHO gene of humanized mice contained the desired knock-in mutation site.
[0409] (4) Subretinal Injection of AAV8 Virus in Mice:
[0410] The AAV virus injected into the mice was the virus used to infect the 3D retinal tissue.
[0411] 1) The pupils were dilated with 1% atropine at 30 min before injection, and dilated again before anesthetization.
[0412] 2) The mice were anesthetized by intraperitoneal injection of 80 mg/kg ketamine+8 mg/kg xylazine. Then the mice were placed in front of the animal experiment platform of the ophthalmic surgery microscope, and a drop of 0.5% proparacaine was dropped on the eyes of mice for local anesthesia. The fluorescein sodium stock solution was added to the AAV virus at a concentration of 100:1, and mixed by low-speed centrifugation.
[0413] 3) A minipore was pricked by insulin needle in advance in the ciliary pars plana of the mouse eyeball, through which a microsyringe needle passed to enter the vitreous chamber of the mouse eyeball. At this time, an appropriate amount of 2% hydroxymethyl cellulose was dropped on the mouse eyeball such that the mouse fundus could be seen under the microscope. Then the needle was inserted into the contralateral periphery subretinal space while keeping off the lens. The AAV virus with fluorescein sodium was slowly pushed-in, with an injection volume of 1 μl in each eye. The fluorescein sodium served as the indicator for judging whether it was injected into the subretinal space.
[0414] 4) Whether the mouse was normal or not was observed after injection, and the neomycin eye ointment was applied to prevent infection.
[0415] (5) Editing Efficiency Assessment of AAV8-pX601-RHO-SgRNA in Humanized Mice
[0416] 1) 3 months after injection, the GFP expression in the mouse eyeball was observed using an in vivo imaging system for mouse. The GFP+ mouse eyeball was collected, and the 3D tissue was digested with papain system to prepare a single-cell suspension. The GFP+ positive retinal cells were screened by flow cytometry to extract the gDNA in accordance with the same protocols as above.
[0417] 2) PCR reaction
[0418] The primers used were shown in Table 29 below in accordance with the same protocols as above.
TABLE-US-00031 TABLE 29 Primer sequences SEQ PCR ID product Primer Primer sequence NO length RHO17-forward GAGTGTGGGGACTGGATGAC 58 950 bp primer RHO17-reverse GGGACTCTCCCAGACCCCTC 59 primer RHO135-forward TGTCCGGGTTATTTCATTTC 60 860 bp primer CC RHO135-reverse GAGATGGGACCAGCCCTTGT 61 primer
[0419] 3) T7E1 digestion experiment
[0420] The protocols were the same as above.
[0421] FIG. 16A showed the results of gel electrophoresis for RHO humanized mouse genotype identification. The mouse No. 20 was a humanized mouse carrying the heterozygous mutation, and the mice Nos. 21 and 22 were humanized mice carrying WT. FIG. 16B showed a humanized mouse carrying the homozygous mutation of RHO c.50C>T, and FIG. 16C showed a humanized mouse carrying the homozygous mutation of RHO c.403C>T.
[0422] FIG. 17A showed the gene editing efficiency of RHO17-SgRNA2 in humanized mice. M-17sgRNA2 indicated that the humanized mouse carrying the homozygous mutation of c.50C>T was injected with AAV-R17-sg2-SaCas9 virus, while C-17sgRNA2 indicated that the humanized mouse carrying WT was injected with AAV-R17-sg2-SaCas9 virus. The T7E1 results showed that RHO-17SgRNA2 only had the editing effect on the humanized mouse carrying the mutation, but had no editing effect at the corresponding site in the humanized mouse carrying WT. FIG. 17B showed the gene editing efficiency of RHO135-SgRNA1 in humanized mice. M-135sgRNA1 indicated that the humanized mouse carrying the homozygous mutation of c.403C>T was injected with AAV-R135-sg1-SaCas9 virus, while C-135sgRNA1 indicated that the humanized mouse carrying WT was injected with AAV-R135-sg1-SaCas9 virus. The T7E1 results showed that RHO-135SgRNA1 only had the editing effect on the humanized mouse carrying the mutation, but had no editing effect at the corresponding site in the humanized mouse carrying WT. The results of the in vivo experiments were consistent with those of the in vitro experiments as above.
Thus while the specification provide generic contemplation to a method of treating RP by administering the claimed vector encoding a gRNA and a PAM only, the specification solely provides specific enabling guidance to a method that administers two species of AAV vectors encoding the claimed gRNA and PAM sequence and a Cas9 sequence by subretinal injection, with the sole result of introducing a double stranded break into the target within the specific human RHO genes having the C50T or C403T mutation. The specification fails to provide any guidance to any symptoms of RP that are treated, removal and/or correction of the mutated site in RHO gene. The specification fails to provide specific guidance to the claimed method functional by only administering the gRNA and PAM sequences and no additional Cas sequence. The specification fails to provide specific guidance to the use of any other route of administration only that subretinal administration. Regarding the composition, the specification does provide enabling guidance to the make of the composition. However, it fails short of enabling the intended use of “treating RP” as claimed.
State of the Art: Nguyen (Nguyen et al. Int. J. Mol. Sci. 2023, 24, 7481.pp. 1-40) states, “In CRISPR-Cas9 gene therapy, Cas9 endonuclease is delivered to the target region via gRNA, which causes double-stranded breaks in the predefined region of the genome.” Page 21, section 12.3.
As such, Nguyen teaches that the gRNA delivers the Cas9 endonuclease to the target region to exact cleavage by the Cas9. This is consistent with the teachings in the art at the time of filing and presently. Thus, a gene editing therapy as claimed that solely administers gRNA and PAM as claimed will fail to predictably result in any type of editing or therapeutic effect because the state of the art teaches that both the gRNA and the Cas9 sequences must be administered and provided to the target site.
Nguyen further reports, “the main challenge of CRISPR-Cas9 include the delivery of the CRISPR-Cas9 complex, and the potential risk of an immune response. In addition, a major drawback for the use of CRISPR-Cas9 therapies are potential off-target effects. When using the CRISPR-Cas9 system, the gRNA may target different regions than intended due to similarities in the genome, subsequently resulting in unwanted genomic mutations…Furthermore, HDR efficiency, which is required for correct IRD-causing variants, in retinal cells is low. HDR functions mainly in dividing cells and is not highly efficient in post-retinal cells”. Page 21, section 12.3.
Challenges to deliver of the CRISPR-Cas9 complex in part due to route of administration. The specification of the instant application solely teaches successful delivery by subretinal injection and the prior art suggests unpredictability in delivery. As such, the art does not predictably supplement the shortcomings of the specification regarding the breadth of the route of administration claimed.
Nguyen highlights the requirement for HDR to “remove a mutation site of an RHO” or to correct it and further shows that HDR in the target cells of the instantly claimed method render arriving at such removal is unpredictable. The specification solely provide specific guidance to the demonstration of a double strand cleave or disruption in the intended site of mutation by sequence analysis. As such, both the specification and art fall short of demonstrating a predictable means of removing the mutation site of RHO, or correcting the mutant RHO. Further Nguyen demonstrates that the process of arriving at a therapeutic method for treating RP is promising but still not accomplished, let alone predictable. The specification fails to supplement these shortcoming of the prior art and sole provides rudimentary, albeit important, gRNA sequences to disrupt two specific mutation in the human RHO gene. As such, the specification fails short of enabling the method as claimed. The art teaches unpredictability in the make and use of the claimed method and does not provide predictable, specific guidance to overcome such unpredictabilites.
Regarding route of administration, Berger (Berger et al. Clinical & Experimental Ophthalmology, 2025; 53:967–985) report that retinal viral gene therapy is impacted by route of administration. There are three known routes of administration, intravitreal injection, subretinal injection, and suprachoroidal injection (section 1, pp. 968-969). Subretinal injection was show to have higher efficiency than intravitreal injections but were also associated with more serious adverse side effects. All three routes were shown to have adverse effects of severe immune response, which hinders effective delivery of the vector, physical/structural issues such as retinal degeneration, retinal damage, and retinal detachment. Berger concludes, “There is a new for optimized delivery methods.” See abstract.
As such, Berger teaches that even within the known routes of administration for retinal therapy there is variability and unpredictability. Immune response elicitation and physical damage hinders the predictable deliver of an effect dose that would result in enough the vector being expressed, let alone results in amounts that arrive at a therapeutic effect. Berger states that retinal gene therapy is in its infancy and thus even post-filing is not predictable in part due route of administration and delivery issues and concerns. The specification does not provide further guidance to supplement the teachings of the art regarding route of administration. As such, the specification and art solely enable subretinal injection as done in example 8.
In conclusion, the breadth of the claim lacks enablement because the specification solely provides predictable guidance to a method of disrupting a mutated PHO gene comprising the C50T or the C403T mutation in a subject with RP comprising subretinal injection of a vector encoding the claimed gRNA, PAM, and Cas9 and fails to provide any guidance to any therapeutic effects that predictably treat RP. Further the art teaches unpredictability that lies in issues associated with CRISPR system lack of predictable specificity, delivery of an effective dose of the vector, immune response and retinal tissue damage that render retinal gene therapies unpredictabilites. As such, the art fails to supplement the shortcomings of the specification. Further, the art describes such retinal CRISPR system therapies as being in their infancies with a great deal of discovery experimentation needed. The level of discovery experimental to enable these method goes beyond routine optimization and thus would be undue.
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARCIA STEPHENS NOBLE whose telephone number is (571)272-5545. The examiner can normally be reached M-F 9-5:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at 571-272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
MARCIA S. NOBLE
Primary Examiner
Art Unit 1632
/MARCIA S NOBLE/Primary Examiner, Art Unit 1632
Prosecution Insights