DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 12/05/25 has been entered. Claim 11 is under examination in this Office action and claims 1-10 have been cancelled.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed but are not persuasive to place the claims in condition for allowance for reasons that follow.
Priority
This application claims priority to CN 202010356498.0 (04/29/2020). Receipt is not acknowledged of certified copies of papers required by 37 CFR 1.55, since neither a certified copy, nor an English translation of the complete application, are provided. This application is a 371 of PCT/CN2019/086188 (04/09/2021), for which English translation has been provided.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). The examiner has noted that the Specification includes Table 1, which recites SEQ ID NO: 1 and the associated sequence: TCAGCCCTATCACCGTTGTC. However, SEQ ID NO: 1 in the sequence listing is: ucagcccuau caccguuguc. Therefore, a “T” in Table 1 sequence is a “U” in the Sequence Listing, which holds true for all of the sequences recited in Table 1.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Drawings
The drawings are objected to for the following reasons:
37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG."”
In these drawings, the view numbers for Figures 1-7 are preceded by the abbreviation "Fig.", inclusive of small letters, instead of the abbreviation "FIG.".
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim(s) 11 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant, regards as the invention.
Claim 11 is indefinite in the recitation of each of the SEQ ID NO’s recited in the claims, including SEQID NO: 1,5,9,13,2,6,10,14,3,7,11 and 15. Clarity and consistency is required regarding whether the SEQ ID NO’s being claimed are inclusive of U’s or Ts. SEQID NO: 1 in the Table of the Specification is disclosed as: TCAGCCCTATCACCGTTGTC, but in the Sequence listing, the disclosure is: UGAGCCCUAUCACCGUUGUC. The same T vs U issue arises for all of the other SEQ ID Nos, as well.
Claim 11 is indefinite in the recitation of “a probe of hsa-miR-30c-3p”, in that there are no primers for hsa-miR-30c-3p recited in the claim. However, a forward primer for hsa-miR-30c-5p is claimed, as is a reverse primer for has-miR-30c-5p, but no probe. As different arms, 3p and 5p would be anticipated to have different sequences and a repository for microRNA sequences know to those of ordinary skill, miRbase (www.miRbase.org) depicts mature hsa-miR-30c-5p as: UGUAAACAUCCUACACUCUCAGC and (two sequences for 3p), including hsa-miR-30c-2-3p as: CUGGGAGAAGGCUGUUUACUCU and hsa-miR-30c-3p as: CUGGGAGAAGGCUGUUUACUCU, with the point being that it is predictable that 3p and 5p arms differ. The specification Table on Page 4 recites that the probe is for miR30c, without articulating which arm. Further clarification is required.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, the claims will be given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification, as it would be understood by one of ordinary skill in the art, and as set forth at MPEP§ 2111. The use of T or U will be considered for art in the SEQ IDs recited.
The claims are free of the art. Notable art includes Hao (US20140308674 A1; published 10/16/2014), who was interested in miRNAs, particularly as melanoma biomarkers, and in quantification of relevant miRNAs with selectively binding probes and real-time PCR (Abstract [0015]). Hao addressed the value of miRNAs as clinical diagnostic tools relevant to cancer, including endocrine pancreatic tumors [0050], and disclosed kits for determining biomarker miRNAs, the kits inclusive of probes and primer pairs [0020]. Hao addressed characterizing a cancer (melanoma) using miR-30c-5p (but not -3p), and mir132-3p, but not 23a-3p or 24p-3p, and did not disclose the sequences recited in the instant application. Hao does not disclose probe sequences.
Xiao (CN109423519 A; published 3/5/2019) addressed miRNAs as pancreatic cancer markers, including hsa-miR-30c (which indicates 5p, with identical probe sequence to the instant application, as considered below), miR24-3p, miR-23a-3p, miRNA-132 (disclosed as 5p*).
Xiao disclosed early pancreatic cancer markers characterized by hsa-miRNAs including miR-30c-5p, miR24-3p, miR23a-3p, miR-132-5p*and, wherein the methods used comprised use of the same probe and primers as the instant application, and a kit provided by the invention that could be used for screening for pancreatic cancer and as probes (Summary, Claims 1 and 8) and use of the one or more markers in a kit (claim 9).
The instant probe for miR-30c-“3”p (SEQ ID NO:1): ucagcccuau caccguuguc
The Xiao probe for hsa-miR-30c-5p (SEQ ID NO19): TCAGCCCTAT CACCGTTGTC, (claim 8), which are equivalent sequences.
The instant probe for miR-24-3p (SEQ ID NO: 5): ucaacagcuc cuauggacga cc
The Xiao probe for hsa-miR-24-3p (SEQ ID NO9): TCAACAGCTC CTATGG ACGACC, (claim 8), which are equivalent.
The instant probe for miR-23a-3p (SEQ ID NO: 10), uccccagcau aacccucg
The Xiao probe for hsa-mi-R 23a-3p (Seq ID NO: 6), TCCCCAGCAT AACCCTCG, (claim 8), which are equivalent.
The instant probe for miR-132-3p (SEQ ID NO: 13), uuc cgc cugc uugacuguag ccgacg
The Xiao probe for hsa-miR-132-5p* (Seq ID NO 21), TAC TCC TAT CACCGTTGTCCAC,
(claim 8), which differs from the instant sequence. Xiao also does not disclose primers.
Conclusion
Claim 11 is rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Lisa Horth whose telephone number is (703)756-4557. The examiner can normally be reached Monday-Friday 8-4 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/LISA HORTH/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Prosecution Insights