DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1, 14, 22-28, 136, 148, and 220) and species (SEQ ID NOs: 648 and 649) in the reply filed on 10/21/25 is acknowledged.
Claims 225, 230, 233-237, and 244 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/21/25.
Upon further consideration, SEQ ID NOs: 616/617, 618/619, 634/635, 642/643, 646/647, 656/657, 660/661, 672/673, 690/691, and 692/693 in claims 14 and 148 are rejoined with the elected species and examined.
However, the remaining non-elected sequences in Claims 14 and 148 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/21/25.
Information Disclosure Statement
The listing of references in the PCT international search report is not considered to be an information disclosure statement (IDS) complying with 37 CFR 1.98. 37 CFR 1.98(a)(2) requires a legible copy of: (1) each foreign patent; (2) each publication or that portion which caused it to be listed; (3) for each cited pending U.S. application, the application specification including claims, and any drawing of the application, or that portion of the application which caused it to be listed including any claims directed to that portion, unless the cited pending U.S. application is stored in the Image File Wrapper (IFW) system; and (4) all other information, or that portion which caused it to be listed. In addition, each IDS must include a list of all patents, publications, applications, or other information submitted for consideration by the Office (see 37 CFR 1.98(a)(1) and (b)), and MPEP § 609.04(a), subsection I. states, “the list ... must be submitted on a separate paper.” Therefore, the references cited in the international search report have not been considered. NOTE: US 2019/0309289 cited in the ISR was cited by the examiner on an 892. Applicant is advised that the date of submission of any item of information in the international search report will be the date of submission of the IDS for purposes of determining compliance with the requirements for the IDS with 37 CFR 1.97, including all timing statement requirements of 37 CFR 1.97(e). See MPEP § 609.05(a).
The report on patentability of the IPEA and/or ISA has been considered by the examiner.
Claim Objections
Claim 148 is objected to because of the following informalities: the limitation ‘wherein the 5’ nucleotide represented by U can be any nucleotides (e.g. U, A, C, G)’ is improper since U stands for uridine and not for any nucleotide. See MPEP 2412.03(a) and 2412.05(a). Suggest using X or n to refer the 5’ nucleotide, which can be any four ribonucleosides known in the art. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 148 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 148, the phrase "(e.g., U, A, C, G)" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Improper Markush rejection
Claims 14 and 148 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of the SEQ ID NOs: for the sense and antisense strand of the instant dsRNA is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons:
They do not share a common single structural similarity because each dsRNA targets a different region of a MSH3 nucleotide and does not share a common nucleotide sequence. A sequence search for SEQ ID NOs: 648 and 649, indicates that SEQ ID NOs: 616/617, 618/619, 634/635, 642/643, 646/647, 648/649, 656/657, 660/661, 672/673, 690/691, and 692/693 in claims 14 and 148 target nucleotides 1109-1197 of a cynomolgus monkey (cyno) MSH3 nucleotide sequence, even though they do not share a common nucleotide sequence they appear to be dsRNAs, which target a region of a cyno MSH3 sequence. In addition, the sequence search indicates that other sequences listed in the claims are not homologous to the elected sequences or target the same region of MSH3 sequence from the same species (See table 3). Moreover, since the nucleic acid sequences are not homologous to each other, they fail to share a common structure i.e., a significant structural element. The sugar-phosphate backbone for the sequences cannot be considered a significant structural element, since it is shared by all nucleic acid molecules. Therefore, the nucleic acid molecules do not share any significant structural element.
In addition, the mere fact that dsRNA are derived from the same source (a MSH3 sequence) is not sufficient to meet the criteria for a proper markush group. The dsRNA might share a common property or activity, but fail to share a common structure. It acknowledged that sense and antisense strands target a region of a MSH3 nucleotide sequence and have a common use (inhibiting MSH3 expression in a cell). However, even though they all target a MSH3 nucleotide sequence (and cross-species compatibility with human and Cyno MSH3), a sequence search of the publicly available databases indicates that the dsRNA could also target other nucleotide sequences, which are not MSH3 nucleotide sequences. For example, a dsRNA comprising SEQ ID NOs: 692 (Qy)/693 can also target a nucleotide sequence encoding apoptosis inducing factor 1 (SEQ ID NO: 2617, Db), caspase 6, granulysin, septin-4, siam E3 ubitquitin protein ligase 1:
US20140107189 MODIFIED POLYNUCLEOTIDES ENCODING APOPTOSIS INDUCING FACTOR 1
Qy 1 GAAAAUAAGGAAAAUGUUA 19
Db 1197 GAAAATAAGGAAAATGTTA 1215
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 1 is rejected under 35 U.S.C. 103 as being unpatentable over ENEVOLV, Inc. (WO2015017866).
‘866 teaches one or a plurality of inhibitory nucleic acids, which target one or more Msh2, Msh3, Msh6, Mih2, and/or Pms2 (paragraphs 46-52). The inhibitory nucleic acid can be a siRNA that comprises an antisense strand and a sense strand, wherein the antisense strand has a sequence of 15-23 contiguous nucleobases in length (paragraphs 49-52). The siRNA can be a shRNA having an antisense and sense region of about 15 to about 23 nucleotides in length.
‘866 does not specifically teach Msh3 siRNA comprising an antisense strand that is complementary to at least 15 contiguous nucleobases of a MSH3 gene and has a duplex between 15 to 30 linked nucleosides.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to make the siRNA comprising an antisense strand, which is complementary to at least 15 contiguous nucleotides to an MSH3 gene and a duplex between 15-23 nucleosides, namely to arrive at the claimed invention. ‘866 makes obvious siRNA having a duplex of 15-23 nucleosides and an antisense strand that is complementary to at least 15 nucleobases of a Msh3 nucleotide sequence as the inhibitory nucleic acid (paragraphs 49-52).
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 22-28 and 220 are rejected under 35 U.S.C. 103 as being unpatentable over ENEVOLV, Inc. (WO2015017866) as applied to claim 1 above, and further in view of Avkin-Nachum et al. (US 20150259676).
‘866 teaches one or a plurality of inhibitory nucleic acids, which target one or more Msh2, Msh3, Msh6, Mih2, and/or Pms2 (paragraphs 46-52). The inhibitory nucleic acid can be a siRNA that comprises an antisense strand and a sense strand, wherein the antisense strand has a sequence of 15-23 contiguous nucleobases in length (paragraphs 49-52). The siRNA can be a shRNA having an antisense and sense region of about 15 to about 23 nucleotides in length.
‘866 does not specifically teach Msh3 siRNA comprising a modified sugar and/or phosphorothioate internucleoside linkage.
However, a pharmaceutical composition comprising a double stranded ribonucleic acid (dsRNA) and a pharmaceutically acceptable carrier (pages 1-17 and 30-31). The dsRNA can have a linker selected from the group consisting of carbon-based linker, a peptide linker, a nucleotide linker, an amido alkyl linker, a phosphodiester linker and a phosphorothioate linkage. A nucleobase of the dsRNA can be 5’-methylcytosine or pseudouridine for nuclease resistance. At least one sugar moiety of the dsRNA, including 2’-alkoxy, 2’-OMe.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘866 taken with ‘676 to make the Msh3 siRNA comprise at least one chemical modification. One of ordinary skill in the art would have been motivated to combine the teaching to chemically modify the siRNA with at least one alternative internucleoside linkage or at least one sugar moiety or a combination there of to increase the bioavailability of the siRNA in a cell. ‘676 teaches making siRNA having at least one 2’-OMe sugar moiety and at least one phosphorothioate internucleoside linkage. ‘676 teaches using 2’-alkoxy and alkyl phosphate in a siRNA. ‘676 teaches substituting a 5’ methylcytosine for a C or a pseudouridine for the U in a dsRNA to increase nuclease resistance. It would have been obvious to one of ordinary skill in the art to make a composition comprising the dsRNA and a pharmaceutically acceptable carrier to store the dsRNA or assist in delivery of the dsRNA to a cell.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Allowable Subject Matter
The elected species, SEQ ID NO: 648 in claim 14 and SEQ ID NO: 649 in claim 148 appear to be free of the prior art of record.
In addition, SEQ ID NOs: 616/617, 618/619, 634/635, 642/643, 646/647, 656/657, 660/661, 672/673, 690/691, and 692/693 in these two claims appear to be free of the prior art of record.
The specification discloses production of 18mer sequences of MSH3 sequences and adding an a nucleotide to the 3’ end of the sense strand and a complementary U at the 5’ end of the antisense strand (Page 104). The as-filed specification discloses several species of MSH3 transcripts were known in the prior art. See the GenBank Nos. on page 104. Several species of MSH3 sequence were known in the prior art. The specification further shows that that dsRNA can reduce MSH3 knockdown in vitro.
In addition, there are various algorithms and programs for siRNA (dsRNA) design known in the prior art. For example, see Table 2 of Fakhr (Cancer Gene Therapy (2016) 23, 73-82) and Watts et al. (Journal of Pathology 226:365-379, 2012). Each with advantages and disadvantages and each program results in different siRNAs that have to be further tested to determine if they can reduce the target sequence in a cell. The prior art further teaches that siRNA are usually 19-21 nucleotides and an 18 mer could result in reduce stability or loss of RNAi activity. Unless the prior art teaches the instant dsRNA, there is no motivation for one of ordinary skill in the art to select one siRNA designer program over another program and use a known GenBank Nos. for MSH3, then select 18mer sequences instead of 19-21 nucleotide sequences reading on the instant SEQ ID NOs:; and then an add an A nucleotide to the 3’ end of the sense strand and a complementary U at the 5’ end of the antisense strand and reasonably expect to arrive at the claimed sequences See MPEP 2143(I)E. Thus, there is not a finite number of identified and predictable solutions to arrive at the instant dsRNA set forth in the instant claims 14 and 148.
WO 2021/216556 (EFD 4/20/20) discloses a target sequence (page 130, MSH3 1151, Table 6) that comprises a fragment of a sequence in claim 14 or 148, but it is missing at least one nucleotide of the instant SEQ ID NOs:. Table 6 of ‘556 lists hundreds of regions of MSH3 sequences and there is no motivation to select MSH_1151 from the hundreds of potential target sequences (and possible modifications to each sequence) and modify one nucleotide in the sequence for MSH_1151 and make a specific dsRNA to arrive at the claimed sequences. See MPEP 2143(I)E. It would not have been obvious for one of ordinary skill in the art to try and make these claimed sequences because there is not a finite number of predictable and identifiable siRNA taught by ‘556.
SEQ ID NO: 648 1 GUUGAUGAGAUAAUGACUA 19
MSH_1151 11 GTTGATGAGATAATGACTG 29
In addition, nucleotide 29 of the target sequence MSH_1151 is G and there is no teaching or suggestion to select this 19-mer from the sequence, then change G at nucleotide 29 to A and arrive at the claimed nucleotide sequence. In addition, the target sequence for this gene region does not read on the instant SEQ ID NOs:. Furthermore, at least one nucleotide modification can result in an off-target effect or reducing or abolishing the RNAi activity of the dsRNA.
Additionally, set forth below is prior art or post-filing art against the elected sequences in instant claims 14 and 148 (EFD 5/8/20):
Instant SEQ ID NO: 648 1 GUUGAUGAGAUAAUGACUA 19
US 20220072028 (co-pending application 17299186; EFD 12/3/18, same inventors)
SEQ ID NO: 605 20 CAACTACTCTATTACTGACT 1
US 20220072028
SEQ ID NO: 605 1 TCAGTCATTATCTCATCAAC 20
Instant SEQ ID NO: 649 1 UAGUCAUUAUCUCAUCAAC 19
NOTE: even though ‘028 has an earlier priority date the inventors of ‘028 are the same as the inventors in the instant application. The 102(b)(1)(A) exception applies to ‘028.
In addition, the dsRNA recited in the instant claims are not provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 4, 24, 35-38, 40, 42-43, and 51 of copending Application No. 17299186(reference application) because the claims in ‘186 are directed to single stranded oligonucleotides (gapmers) and using RNase mechanism to reduce MSH3 expression. Thus, the claims from ‘186 do not embrace or make obvious the instant claims.
Furthermore, post-filing art, US 20230235331 (Ionis Pharmaceuticals, EFD 6/11/20):
SEQ ID NO: 2920 1 TCAGTCATTATCTCATCAAC 20
Instant SEQ ID NO: 649 1 UAGUCAUUAUCUCAUCAAC 19
SEQ ID NO: 2920 is directed to a single stranded antisense oligonucleotide using an RNase mechanism to silence a nucleotide sequence. The prior art or cited art does not teach or suggest substituting (removing and/or adding) nucleotides to the sense and/or antisense strand to arrive at the instant SEQ ID NOs: 648/649. The missing nucleotides are not part of a known MSH3 nucleotide sequence or the sense strand of the dsRNA set forth in the instant claims.
Conclusion
See attached PTO-326 for disposition of claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636