Prosecution Insights
Last updated: October 04, 2026
Application No. 17/998,128

SYSTEMS AND METHODS FOR TREATING LEVODOPA DYSKINESIA, ENHANCING MOTOR BENEFIT, AND DELAYING DISEASE PROGRESSION

Final Rejection §102§103
Filed
Nov 07, 2022
Priority
May 06, 2020 — provisional 63/020,849 +1 more
Examiner
ANGELL, JON E
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Board of Trustees of Michigan State University
OA Round
2 (Final)
71%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
92%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allowance Rate
587 granted / 827 resolved
+11.0% vs TC avg
Strong +21% interview lift
Without
With
+21.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 3m
Avg Prosecution
30 currently pending
Career history
862
Total Applications
across all art units

Statute-Specific Performance

§101
6.7%
-33.3% vs TC avg
§103
27.6%
-12.4% vs TC avg
§102
23.2%
-16.8% vs TC avg
§112
26.6%
-13.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 827 resolved cases

Office Action

§102 §103
DETAILED ACTION This Action is in response to the communication filed on 05/26/2026. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of the Claims Claims 24-26, 32-36, 38, 44, 46, 48-52 are pending. Claims 32-36, 38, are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/03/2025. Claims 24-26, 44, 46, 48-52 are under consideration. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 24-26, 44, 46, 48-50, 52 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by WO 2005/001092 A2 (hereafter, “Be”). Regarding claim 24, Be teaches an interfering nucleic acid molecule having a nucleotide sequence complementary to a target sequence within a gene encoding the CaV1.3 protein to reduce the expression of the CaV1.3 protein. For instance, see paragraph [0154] and Table 3 on page 29, wherein Table 3 explicitly teaches RNAi target sequences and double stranded siRNA sequences to the CACNA1D gene including SEQ ID NO: 2676 identified as CACNA1D siRNA antisense sequence which is 21 nucleotides fully (100%) complementary to nucleotides 1376-1396 of instant SEQ ID NO: 12 (see sequence alignment information below). It is noted that since the siRNA taught by Be has an antisense strand fully complementary to 21 contiguous nucleotides of instant SEQ ID NO: 12, it is necessarily complementary to a target sequence within a gene encoding the Cav1.3 protein encoded by the human CONCA1D gene of instant SEQ ID NO: 12. Be also teaches gene delivery vehicles for delivery of polynucleotides to cells for expression and explicitly teaches adeno-associated viral (AAV) vector (see [0228]), which would be a recombinant AAV (rAAV) vector encapsidating (comprising) an expression construct encoding an interfering nucleic acid molecule for delivery of the expression construct to a target cell. It is also noted that “for reducing expression of a calcium channel… in a cell in the substantia nigra and/or putamen of a primate…” is present in the preamble and only sets forth an intended use for the claimed system, specifically, for “reducing expression of a calcium channel in a cell in the substantia nigra and/or putamen of a primate.” It is noted that MPEP 2111.02 (II) states: If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention’s limitations, then the preamble is not considered a limitation and is of no significance to claim construction. Pitney Bowes, Inc. v. Hewlett-Packard Co., 182 F.3d 1298, 1305, 51 USPQ2d 1161, 1165 (Fed. Cir. 1999). See also Rowe v. Dror, 112 F.3d 473, 478, 42 USPQ2d 1550, 1553 (Fed. Cir. 1997) ("where a patentee defines a structurally complete invention in the claim body and uses the preamble only to state a purpose or intended use for the invention, the preamble is not a claim limitation"). Such is the case here, where the preamble merely states the purpose or intended use of the claimed system. Regarding claim 25, Be teaches that the expression construct expresses an shRNA operable linked to a promoter (e.g., see [0144]). Claim 26 is drawn to “The vector-mediated system of claim 24, wherein the vector provides continuous, high-potency, and target-selective mRNA-level silencing of striatal CaV1.3 channels.” It is noted that claim 26 only adds a “wherein” clause that only adds functional requirements and does not impart any specific further structural limitations. Therefore, since Be teaches a vector system which meets the structural requirements of claim 24, it must necessarily have the same functional characteristics as well, including providing continuous, high-potency, and target-selective mRNA-level silencing of striatal CaV1.3 channels, as required by claim 26. Regarding claim 44, since Be teaches a vector system of claim 24, including a nucleic acid expression construct and rAAV vector, as indicated above, Be teaches a nucleic acid construct that meets the structural limitations of claim 44, including the intended use requirement “for reducing expression of a CaV1.3 protein in a target cell.” Regarding claim 46, Be also teaches a kit comprising the vector system of claim 24 (e.g., see [0277]). Regarding claim 48, the recitation “wherein the cell in the primate substantia nigra and/or putamen is a medium spiny neuron” only further limits part of the purpose/intended use of the claimed system Similarly, regarding claims 49-50, the recitation “wherein the cell in the primate substantia nigra and/or putamen is a substantia nigra neuron” (claim 49) and “wherein the substantia nigra neuron is a substantia nigra dopamine neuron” (claim 50) only further limits part of the purpose/intended use of the claimed system. Regarding claim 52, the recitation “wherein the system reduces CaV1.3…” also only further limits part of the purpose/intended use of the claimed system. Therefore, Be anticipates the instant claims. SEQUENCE ALIGNMENT INFORMATION DE CACNA1D siRNA antisense sequence, SEQ ID 2676. XX KW Cytostatic; Gene therapy; Vaccine; RNA Interference; cancer; ss; KW short interfering RNA; gene silencing. XX OS Synthetic. XX CC PN WO2005001092-A2. XX CC PD 06-JAN-2005. XX CC PF 19-MAY-2004; 2004WO-US015645. XX PR 20-MAY-2003; 2003US-0471729P. XX CC PA (AMHP ) WYETH. XX CC PI Be X, Wei L, Slonim DK, Howes SH; CC PS Claim 3; SEQ ID NO 2676; 113pp; English. XX CC The pharmaceutical composition may also comprise a CC polynucleotide capable of inhibiting or decreasing the expression of the CC CRTP by RNA interference or an antisense mechanism. The CRTPs of the CC invention are selected from ABCC4, C20orf103, CACNA1D, CDH6, CST, ENPP3, CC FLJ11856, GPR54, HAVCR1, SLC6A3, SLC30A4, TRG, and TRPM4. The CC pharmaceutical composition is useful for treating cancer, e.g. colon CC cancer, lung cancer, breast cancer, prostate cancer, liver cancer, kidney CC cancer, stomach cancer, and esophageal cancer. The present sequence is a CC CRTP short interfering RNAs (siRNA) oligonucleotide. Score over Length 100.0%; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1376 AAGGCAAACGAAATACTAGCA 1396 ||||||||||||||||||||| Db 21 AAGGCAAACGAAATACTAGCA 1 Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 51 is rejected under 35 U.S.C. 103 as being unpatentable over WO 2005/001092 A2 (hereafter, “Be”), as applied in the rejection above, in view of U.S. 20180021364 (hereinafter “Stewart”). Regarding claim 51, Be teaches a vector-mediated system as in claim 24 for the reasons indicated in the rejection above, but does not teach that the rAAV vector comprises an AAV2 capsid. However, Stewart teaches a viral vector which comprises AAV2 capsid proteins (e.g., see [0098]), and further teaches that the viral vector can be used to deliver/transfer a payload of interest to neuron in the Substantia Nigra (SN) region of the central nervous system (see [0089]), and teaches that the payload can be a RNAi nucleic acid expression inhibitor (e.g., see [0037). Therefore, it would have been prima facie obvious to one of ordinary skill in the art, prior to the day the claimed invention was filed, to modify the vector system taught by Be and use a viral vector which comprises AAV2 capsid proteins, as taught by Stewart, with a reasonable expectation of success. It would have been a matter of substitution of a known vector system useful for the same purpose – thus providing sufficient motivation, and there would have been a reasonable expectation of success based on the teachings of Stewart which indicate that the vector could be used to deliver/express an RNAi nucleic acid inhibitor in neurons of the central nervous system. Accordingly, the claim is not patentable over the cited prior art. Response to Arguments Applicants’ arguments filed 05/26/2026 have been fully considered but they are not persuasive. Applicant argues that the amendment to claim 24 requiring that the vector-mediated system now requires reducing expression “in a cell in the substantia nigra and/or putamen of a primate” and Be does not teach this limitation. In response, as indicated in the rejection above, “in a cell in the substantia nigra and/or putamen of a primate” is present in the preamble and only sets forth an intended use for the claimed system, specifically, for “reducing expression of a calcium channel in a cell in the substantia nigra and/or putamen of a primate.” Since Be teaches a vector system which meets the structural limitations of the claims, Be anticipates the claimed vector system. It is noted that new claims 48-50, 52 have been addressed in the 102 rejection and new claim 103 has been addressed in the 103 rejection above. Accordingly, Applicant’s arguments are not persuasive. Conclusion Applicants’ amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Conclusion Applicants’ amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to J. E. Angell whose telephone number is (571)272-0756. The examiner can normally be reached Monday-Friday (8:30-5:00). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. J. E. Angell Primary Examiner Art Unit 1637 /J. E. ANGELL/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Nov 07, 2022
Application Filed
Feb 24, 2026
Non-Final Rejection mailed — §102, §103
May 26, 2026
Response Filed
Aug 21, 2026
Final Rejection mailed — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12746253
BLOOD-BRAIN BARRIER PERMEABLE HETERODUPLEX NUCLEIC ACID
4y 2m to grant Granted Sep 29, 2026
Patent 12741996
Modulation of Wnt5a to Treat Glaucoma
2y 9m to grant Granted Sep 22, 2026
Patent 12741035
UTILIZATION OF GENE TARGETING ANTIBODY FUSION PROTEINS TO PERFORM IN VIVO THERAPEUTIC GENE EDITING
1y 5m to grant Granted Sep 22, 2026
Patent 12709742
RNA expression modulating or editing method via regulation of Cas13 protein
3y 10m to grant Granted Aug 18, 2026
Patent 12702693
TREATMENT OF CYSTIC FIBROSIS BY DELIVERY OF CODON-OPTIMIZED mRNA ENCODING CFTR
4y 10m to grant Granted Aug 11, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
71%
Grant Probability
92%
With Interview (+21.1%)
3y 3m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 827 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month