DETAILED ACTION
This Action is in response to the communication filed on 11/03/2025.
Claims 24-28, 30-36, 38, 41-44, 46 are pending.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I in the reply filed on 11/03/2025 is acknowledged.
Claims 27-28, 30-36,, 38, 41-43 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/03/2025.
Claims 24-26, 44, 46 are under consideration.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 24-26, 44, 46 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by WO 2005/001092 A2 (hereafter, “Be”).
Regarding claim 24, Be teaches an interfering nucleic acid molecule having a nucleotide sequence complementary to a target sequence within a gene encoding the CaV1.3 protein to reduce the expression of the CaV1.3 protein. For instance, see paragraph [0154] and Table 3 on page 29, wherein Table 3 explicitly teaches RNAi target sequences and double stranded siRNA sequences to the CACNA1D gene including SEQ ID NO: 2676 identified as CACNA1D siRNA antisense sequence which is 21 nucleotides fully (100%) complementary to nucleotides 1376-1396 of instant SEQ ID NO: 12 (see sequence alignment information below). It is noted that since the siRNA taught by Be has an antisense strand fully complementary to 21 contiguous nucleotides of instant SEQ ID NO: 12, it is necessarily complementary to a target sequence within a gene encoding the Cav1.3 protein encoded by the human CONCA1D gene of instant SEQ ID NO: 12. Be also teaches gene delivery vehicles for deliver of polynucleotides to cells for expression and explicitly teaches adeno-associated viral (AAV) vector (see [0228]), which would be a recombinant AAV (rAAV) vector encapsidating (comprising) an expression construct encoding an interfering nucleic acid molecule for delivery of the expression construct to a target cell.
Regarding claim 25, Be teaches that the expression construct expresses an shRNA operable linked to a promoter (e.g., see [0144]).
Claim 26 is drawn to “The vector-mediated system of claim 24, wherein the vector provides continuous, high-potency, and target-selective mRNA-level silencing of striatal CaV1.3 channels.” It is noted that claim 26 only adds a “wherein” clause that only adds functional requirements and does not impart any specific further structural limitations. Therefore since Be teaches a vector system which meets the structural requirements of claim 24, it must necessarily have the same functional characteristics as well, including providing continuous, high-potency, and target-selective mRNA-level silencing of striatal CaV1.3 channels, as required by claim 26.
Regarding claim 44, since Be teaches a vector system of claim 24, including a nucleic acid expression construct and rAAV vector, as indicated above, Be teaches a nucleic acid construct that meets the structural limitations of claim 44, including the intended use requirement “for reducing expression of a CaV1.3 protein in a target cell.”
Regarding claim 46, Be also teaches a kit comprising the vector system of claim 24 (e.g., see [0277]).
Therefore, Be anticipates the instant claims.
SEQUENCE ALIGNMENT INFORMATION
DE CACNA1D siRNA antisense sequence, SEQ ID 2676.
XX
KW Cytostatic; Gene therapy; Vaccine; RNA Interference; cancer; ss;
KW short interfering RNA; gene silencing.
XX
OS Synthetic.
XX
CC PN WO2005001092-A2.
XX
CC PD 06-JAN-2005.
XX
CC PF 19-MAY-2004; 2004WO-US015645.
XX
PR 20-MAY-2003; 2003US-0471729P.
XX
CC PA (AMHP ) WYETH.
XX
CC PI Be X, Wei L, Slonim DK, Howes SH;
CC PS Claim 3; SEQ ID NO 2676; 113pp; English.
XX
CC The pharmaceutical composition may also comprise a
CC polynucleotide capable of inhibiting or decreasing the expression of the
CC CRTP by RNA interference or an antisense mechanism. The CRTPs of the
CC invention are selected from ABCC4, C20orf103, CACNA1D, CDH6, CST, ENPP3,
CC FLJ11856, GPR54, HAVCR1, SLC6A3, SLC30A4, TRG, and TRPM4. The
CC pharmaceutical composition is useful for treating cancer, e.g. colon
CC cancer, lung cancer, breast cancer, prostate cancer, liver cancer, kidney
CC cancer, stomach cancer, and esophageal cancer. The present sequence is a
CC CRTP short interfering RNAs (siRNA) oligonucleotide.
Score over Length 100.0%;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1376 AAGGCAAACGAAATACTAGCA 1396
|||||||||||||||||||||
Db 21 AAGGCAAACGAAATACTAGCA 1
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to J. E. Angell whose telephone number is (571)272-0756. The examiner can normally be reached Monday-Friday (8:30-5:00).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
J. E. Angell
Primary Examiner
Art Unit 1637
/J. E. ANGELL/Primary Examiner, Art Unit 1637