Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of group IV (claims 12-13) and species (mir 96-5p, SEQ ID NO: 3) in the reply filed on 10/6/25 is acknowledged.
Claims 1-11 and 14-18 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/6/25.
SEQ ID NOs: 1, 2, and 4-16 in claim 12 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/6/25.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.821 - 1.825. This application contains a “Sequence Listing” as a PDF file (37 CFR 1.821(c)(2)) or as physical sheets of paper (37 CFR 1.821(c)(3)). A copy of the "Sequence Listing" in computer readable form (CRF) has been submitted; however, the content of the CRF does not comply with one or more of the requirements of 37 CFR 1.822 through 1.824, as indicated in the "Error Report" that indicates the "Sequence Listing" could not be accepted. Refer to attachment or document "Computer Readable Form (CRF) for Sequence Listing – Defective" dated 10/7/25.
Specific deficiency - Sequences appearing in the specification are not identified by sequence identifiers (i.e., “SEQ ID NO:X” or the like) in accordance with 37 CFR 1.831(c). Two amino acid sequences having at least 4 amino acids on page 55.
Required response – Applicant must provide:
A replacement "Sequence Listing" part of the disclosure, as described above in item 1); together with
An amendment specifically directing its entry into the application in accordance with 37 CFR 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter as required by 37 CFR 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the replacement "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter and
An amendment to the specification to remove the “Sequence Listing previously submitted as a PDF file (37 CFR 1.821(c)(2)) or as physical sheets of paper (37 CFR 1.821(c)(3))
If the replacement "Sequence Listing" part of the disclosure is submitted according to item 1) c) or d) above, Applicant must also provide:
A CRF in accordance with 1.821(e)(1) or 1.821(e)(2) as required by 37 CFR 1.825(b)(6)(ii); and
Statement according to item 2) a) or b) above.
Specification
The amendment to the specification filed on 10/6/25 has been entered. However, the claims and abstract at the end of the specification have not been entered because they are they duplicates of the original claims and abstract.
Drawings
The petition to file color drawings has been granted on 11/13/23.
The drawings are objected to because Figures S1-S8 are improper labels for several drawings for one figure (Figures should be labelled 1A, 1B, 1C, etc.). 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG."” In the current case, the view numbers for Figures S1-S8 are preceded by the word "Figure" instead of the abbreviation "FIG.".
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 12-13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Even though the pre-amble of the claim recites a method of treatment of cancer, in view of the method steps, the claimed invention is directed treating colon cancer in a subject in need thereof comprising administering a miRNA inhibitor against SEQ ID NOs: 1-16. SEQ ID NOs: 1-16 are nucleotide sequences for several different microRNAs. The microRNAs and their respective sequences are known in the prior art (see pages 32-33 of the as-filed specification). In addition, antagomirs (miR-96-5p antagomir) against these sequences were known in the prior art. See CA2648132.
In addition, the prior art does not disclose non-nucleotide sequences (proteins, antibodies, peptide mimics) or inhibitors (small molecules) that are considered miRNA inhibitors against SEQ ID NOs: 1-16 having the desired biological activity (treating colon cancer). The specification of the instant disclosure does not appear to provide a definition for the term ‘miRNA inhibitors’. The broadest reasonable interpretation of the term “miRNA inhibitors” embraces nucleotides, aptamers, ribozymes, DNAzymes, proteins, antibodies, and small molecules. Antagomirs are not considered to be represent of the entire genus of miRNA inhibitors because they are nucleic acids that are complementary to a region of a miRNA sequence. Neither the specification nor the art of record describe a relationship between a sequence that is complementary to a miRNA sequence and other species of miRNA inhibitors that are not complementary to a region of a miRNA sequence. Other than antagomirs for these instant SEQ ID NOs:, the specification does not provide written description for any other species of inhibitors to provide written description for the genus of miRNA inhibitors.
In view of the foregoing, it is clear that the specification of the instant disclosure fails to convey to the skilled artisan that the applicant had possession of the claimed genus of miRNA inhibitors in claims 12 and 13.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim 12 is rejected under 35 U.S.C. 102(a)(1) or 102(a)(2) as being anticipated by Rottman (WO2019200316, published 10/17/19 and priority to 4/13/18) as evident by Esau (US 20050261218). ‘316 discloses using miRNA tumor suppressor target sequence(s) for treating colon cancer (pages 45-59). A tumor suppressor miRNA target sequence is a sequence which is complementary to a microRNA (pages 45-46), which would read on a miRNA inhibitor use in the claimed method. ‘316 teaches a recombinant oncolytic virus for treating colon or colorectal cancer encodes a target antigen and comprises one or more copies of one or more tumor suppressive miR target sequences, including hsa-miR-96-5p (pages 51-52).
‘316 does not teach the sequence for hsa-miR-96-5p, however, the sequence for the human microRNA taught in the prior art would read on instant SEQ ID NO: 3 because ‘218 (page 156, table 60, SEQ ID NO: 1183, Db) teaches that the sequence for hsa-miR-96-5p is instant SEQ ID NO: 3 (Qy).
Qy 1 UUUGGCACUAGCACAUUUUUGCU 23
Db 1 UUUGGCACUAGCACAUUUUUGCU 23
Thus, ‘316 as evident by ‘218 teaches the claimed method.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim 13 is rejected under 35 U.S.C. 103 as being unpatentable over Rottman (WO2019200316, published 10/17/19 and priority to 4/13/18) and Esau (US 20050261218) as applied to claim 12 above.
‘316 teaches a recombinant oncolytic virus for treating colon or colorectal cancer encodes a target antigen and comprises one or more copies of one or more tumor suppressive miR target sequences, including hsa-miR-96-5p (pages 51-52). The oncolytic virus can be an adenovirus (page 35).
‘316 and ‘218 do not specially teach using a nanoparticle or hydrogel or adenoviral delivery system to deliver the miRNA inhibitor to the subject.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to use adenovirus as the oncolytic virus, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to try the adenovirus as suggested by ‘316 as the oncolytic virus to deliver the miRNA inhibitor to the cancer patient. See MPEP 2143(I)E.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Conclusion
See attached PTO-326 for disposition of claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636