Prosecution Insights
Last updated: April 19, 2026
Application No. 17/999,122

VIRAL VECTORS AND NUCLEIC ACIDS FOR REGULATED GENE THERAPY

Non-Final OA §101§102§103§112
Filed
Nov 17, 2022
Examiner
SHIN, DANA H
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
BOEHRINGER INGELHEIM INTERNATIONAL GMBH
OA Round
1 (Non-Final)
27%
Grant Probability
At Risk
1-2
OA Rounds
3y 6m
To Grant
55%
With Interview

Examiner Intelligence

Grants only 27% of cases
27%
Career Allow Rate
311 granted / 1149 resolved
-32.9% vs TC avg
Strong +28% interview lift
Without
With
+27.5%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
86 currently pending
Career history
1235
Total Applications
across all art units

Statute-Specific Performance

§101
3.8%
-36.2% vs TC avg
§103
29.3%
-10.7% vs TC avg
§102
15.2%
-24.8% vs TC avg
§112
31.4%
-8.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1149 resolved cases

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of claims 2-5, 7, 9, 12, 14, 16, 23-28, 30, 32, 35, 37-41, and 54-55 with species election of LP-1 and IL-10 in the reply filed on December 1, 2025 is acknowledged. Status of Claims Claims 1-5, 7, 9, 12, 14-16, 19, 22-28, 30-32, 35-44, and 54-61 are pending in the instant application. Claims 19, 22, 31, 36, 42-44, and 56-61 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected inventions, there being no allowable generic or linking claim. Accordingly, claims 1-5, 7, 9, 12, 14, 16, 23-28, 30, 32, 35, 37-41, and 54-55 are under examination on the merits in the instant application. Priority Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Information Disclosure Statement The listing of references in the specification, see pages 55-62, is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. The information disclosure statement (IDS) submitted on February 16, 2023 has been considered by the examiner. Note that NPL Citation number 2 is not considered because applicant did not submit a legible copy of the reference comprising “pages 526-534” as written in the IDS, thereby omitting essential teachings of the NPL. Note that the Beilstein reference is cited in the attached PTO-892 with a legible copy of the entire reference. Drawings The drawings are objected to because they are numbered with “Figure”, not the abbreviated term “FIG.” See 37 CFR 1.84 for the following: “View numbers must be preceded by the abbreviation “FIG.””. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. The drawings are further objected to because Figure 23 contains sequence rule non-compliant subject matter. Appropriate correction is required as instructed below. Specification 1. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. See page 21. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. 2. “Table 2” beginning at page 63 is not in a table format. Hence, it is unclear why the listing of sequences that are not in a table should be considered “Table 2”. 3. The disclosure is objected to for containing sequence rule non-compliant subject matter. See page 19, lines 7-8, disclosing specifically enumerated amino acid sequences that are not accompanied by appropriate SEQ ID NOs. Appropriate correction is required as instructed below. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide sequences appearing in the drawings, see Figure 23, are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Specific deficiency – Amino acid sequences appearing in the specification, see page 19, are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Objections Claims 1-5, 7, 9, 12, 14, 16, 23-28, 30, 32, 35, 37-41, and 54-55 are objected to because of the following informalities: 1. “Nucleic acid construct” in claim 1 should be “A nucleic acid construct”. 2. “Nucleic acid construct” in claims 2-5, 7, 9, 12, 14, 16, and 23 should be “The nucleic acid construct”. 3. “the group of” in line 2 of claim 3 should be “the group consisting of”. 4. “Transgene expression cassette” in claim 24 should be “A transgene expression cassette”. 5. “Transgene expression cassette” in claims 25-28, 30, 32, and 35 should be “The transgene expression cassette”. 6. “Viral vector” in claim 37 should be “A viral vector”. 7. “Viral vector” in claims 38-41 should be “The viral vector”. 8. “Cell” in claim should be “A cell”. 9. “Pharmaceutical composition” in claim 55 should be “A pharmaceutical composition”. Appropriate correction is required. Claim Rejections - Improper Markush Grouping Claims 12, 14, 28, and 30 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination of process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP §706.03(y). The Markush grouping of the transgene encoding an interleukin, an interferon, an antibody and a fragment thereof, and a TNF/TNFR member in claims 12 and 28 is improper because the transgene alternatives defined by the Markush grouping do not share a nucleotide sequence similarity, nor do they share a common use flowing from a nucleotide sequence similarity shared among the recited species. The Markush grouping of IL-4, IL-6, IL-10, IL-11, IL-12, IL-13, IL-23, IL-27, and IL-33 protein species encoded by the transgene as recited in claims 14 and 30 is improper because each IL protein species has a unique, distinct amino acid sequence, thereby requiring a distinct transgene sequence encoding each of the protein species. Hence, the transgenes encoding the recited IL proteins do not share a nucleotide sequence similarity, nor do they share a common use flowing from a nucleotide sequence similarity shared among the recited species. To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternatives within a single claim in fact share a single structural similarity as well as a common use. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 2, 4, 23, 26, and 40 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 2, 4, 26, and 40 each recite the phrase "such as", which renders each of claims 2, 4, 26, and 40 indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention or merely exemplary. See MPEP § 2173.05(d). Claim 23 recites “wherein the nucleic acid construct of the invention” in lines 2-3. It is unclear what is referred to by “the invention”. There is insufficient antecedent basis for this limitation in the claim, and furthermore. Claim 23 recites “at least 4-fold, preferably at least 6-fold, at least 8-fold, or at least 9-fold” in lines 2-3. As such, the claim recites the broad range of “at least 4-fold” and exemplifies “preferably at least 6-fold, at least 8-fold, or at least 9-fold”, which is a narrower statement of the “at least 4-fold”. The claim is deemed indefinite because there is a question or doubt as to whether the feature introduced by such narrower language (e.g., “preferably at least 6-fold”) is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claim. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). Claim 23 recites “wherein said test subject is preferably a mouse.” It is unclear whether this recitation pertaining to “preferably a mouse” is a part of the claimed invention or merely exemplary. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1-5, 9, 12, 14, 23-28, 30, 35, 37-38, and 54-55 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Jolly et al. (WO 2004/033653 A2). Jolly discloses an expression vector comprising two ITRs flanking a transgene encoding a therapeutic protein and “aptazymes” that are “regulated as a result of binding ligand/modulator” including “antibiotics such as tetracy[c]lin[e]”, wherein the vector can be “a double stranded DNA” viral vector or an “AAV” vector, wherein the transgene is “IL-10” and “is operably linked to a control sequence that is capable of providing for expression of the coding sequence by the host cell”, wherein the control sequence is “a promoter or a promoter and enhancer” that is “preferentially active” in “hepatocytes” or a “a constitutive promoter such as CMV”, wherein the expression vector further comprises a polyA signal sequence and is formulated as a pharmaceutical composition with a pharmaceutically acceptable excipient. See pages 4-7, 14-17, 21, 31-33, 36, 43-44, 46, and 48-49; Figure 3. Since all structural limitations recited in claim 1 are fully met by Jolly’s vector, it necessarily follows that Jolly’s vector inherently possesses the functionality of providing at least 4-fold higher expression of the transgene in a test subject as recited in claim 23, absent objective evidence to the contrary. “[T]he patentability of apparatus or composition claims depends on the claimed structure, not on the use or purpose of that structure.” Catalina Mkt. Int’l, Inc. v. Coolsavings.com, Inc., 289 F.3d 801, 809 (Fed. Cir. 2002). That is, “[f]rom the standpoint of patent law, a compound and all of its properties are inseparable; they are one and the same thing.” In re Papesch, 315 F.2d 381, 391 (CCPA 1963). Note that the Office does not have the facilities and resources to provide the factual evidence needed in order to determine and/or compare the specific activities of the instantly claimed nucleic acid construct versus Jolly’s construct. In the absence of evidence to the contrary, the burden is upon the applicant to prove that the claimed construct is different from the one taught by Jolly, thereby establishing patentable differences. See In re Best 562F.2d 1252, 195 USPQ 430 (CCPA 1977) and Ex parte Gray 10 USPQ2d 1922(PTO Bd.Pat. App. & Int. 1989). Accordingly, claims 1-5, 9, 12, 14, 23-28, 30, 35, 37-38, and 54-55 are described by Jolly et al. Claims 1, 4-5, 7, 9, 12, 14, 23-28, 30, 35, 37-39, 41, and 54-55 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Lewis et al. (US 2017/0218379 A1). Lewis discloses an expression vector (e.g., AAV8) comprising an expression cassette comprising two AAV2 ITRs flanking a “therapeutic transgene” whose 3’ end is operably linked to an inducible “K7” aptazyme, which is a “tetracycline dependent hammerhead ribozyme-aptamer”, wherein the therapeutic transgene “encodes a therapeutic protein” such as “IL-1 through IL-25” and the expression cassette further comprises a promoter (e.g., “CMV promoter”) and a polyA sequence, wherein the vector can be single-stranded DNA or double-stranded DNA and is formulated as a pharmaceutical composition with a pharmaceutically acceptable carrier for delivery into host cells. See paragraphs 0045, 0070, 0090, 0095, 0129-0134, 0138-0143; FIG. 12; TABLE I. Since all structural limitations recited in claim 1 are fully met by Lewis’ vector, it necessarily follows that Lewis’ vector inherently possesses the functionality of providing at least 4-fold higher expression of the transgene in a test subject as recited in claim 23, absent objective evidence to the contrary. “[T]he patentability of apparatus or composition claims depends on the claimed structure, not on the use or purpose of that structure.” Catalina Mkt. Int’l, Inc. v. Coolsavings.com, Inc., 289 F.3d 801, 809 (Fed. Cir. 2002). That is, “[f]rom the standpoint of patent law, a compound and all of its properties are inseparable; they are one and the same thing.” In re Papesch, 315 F.2d 381, 391 (CCPA 1963). Note that the Office does not have the facilities and resources to provide the factual evidence needed in order to determine and/or compare the specific activities of the instantly claimed nucleic acid construct versus Lewis’ construct. In the absence of evidence to the contrary, the burden is upon the applicant to prove that the claimed construct is different from the one taught by Lewis, thereby establishing patentable differences. See In re Best 562F.2d 1252, 195 USPQ 430 (CCPA 1977) and Ex parte Gray 10 USPQ2d 1922(PTO Bd.Pat. App. & Int. 1989). Accordingly, claims 1, 4-5, 7, 9, 12, 14, 23-28, 30, 35, 37-39, 41, and 54-55 are described by Lewis et al. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-5, 7, 9, 12, 14, 16, 23-28, 30, 32, 35, 37-41, and 54-55 are rejected under 35 U.S.C. 103 as being unpatentable over Lewis et al. (US 2017/0218379 A1) in view of Hung et al. (BBRC, 2005, 336:324-331), Lachmann et al. (US 2020/0147240 A1), and Beilstein et al. (ACS Synthetic Biology, 2015, 4:526-534). Lewis discloses an expression vector (e.g., AAV8) comprising a DNA expression cassette comprising two AAV2 ITRs flanking a “therapeutic transgene” whose 3’ end is operably linked to an inducible “K7” aptazyme DNA sequence, which is a “tetracycline dependent hammerhead ribozyme-aptamer”, wherein the therapeutic transgene “encodes a therapeutic protein” such as “IL-1 through IL-25” and the expression cassette further comprises a promoter (e.g., “CMV promoter”) and a polyA sequence, wherein the vector can be single-stranded DNA or double-stranded DNA and is formulated as a pharmaceutical composition with a pharmaceutically acceptable carrier for delivery into host cells. See paragraphs 0045, 0070, 0090, 0095, 0129-0134, 0138-0143; FIG. 12; TABLE I. Lewis does not teach LP1 promoter, SEQ ID NO:9, and AAV capsid having an amino acid sequence for selective binding to a target tissue. Hung teaches that IL-10 gene therapy that delivers IL-10 to the liver of a subject is therapeutically useful for treating liver fibrosis thus having potential clinical applications for liver cirrhosis treatment. See pages 325-330. Lachmann teaches that a capsid protein in AAV (e.g., AAV8) can include “one or more amino acid substitutions” in order “to confer enhanced tropism for a desired tissue type or cell type (such as liver, or hepatocyte tropism)”. See paragraph 0082. Lachmann teaches that “LP1” is an art-recognized liver-specific promoter and that “AAV8 can transduce up to 90-95% of hepatocytes in the mouse liver following intraportal vein injection”, wherein additional liver-specificity “can be conferred by using liver-specific promoters in conjunction with AAV8 capsid proteins.” See paragraphs 0058 and 0124. Beilstein teaches that a construct comprising a transgene (e.g., mRNA) whose 3’ end is operably linked to a tetracycline-responsive ribozyme/aptamer (aptazyme) is useful for expressing the transgene in tetracycline-dependent manner such that “mRNA translation can occur” when there is a binding interaction between the tetracycline ligand and the aptamer domain of the aptazyme. See pages 526-527. Beilstein discloses the tetracycline-responsive ribozyme/aptamer structure and nucleotide sequence in Figure 1B as shown below. PNG media_image1.png 296 572 media_image1.png Greyscale Beilstein discloses that the “P1” domain comprising “N” bases can be varied, wherein the “N” base sequence (5’-GUGGU for the five “N” at positions 17-21 in the upper stand; 5’-AC for the two “N” at positions 69-70 in the lower strand) having the motif in “K19” provides a “low level of background expression” similar to “K7”, wherein “K19” confers “a considerable enhanced dynamic range of 8.7-fold resulting in the most active candidate” and “K7” confers “an increase of dynamic range to 7.5-fold”. See pages 528-529. See also the “K19” P1 sequence disclosed in Figure 2A as reproduced below. PNG media_image2.png 72 98 media_image2.png Greyscale It is noted that the entire sequence of Beilstein’s tetracycline-responsive aptazyme whose P1 is “K19” is 5’-GGCGCGUCCUGGAUUCGUGGUAAAACAUACCAGAUUUCGAUCUGGAGAGGUGAAGAAUACGACCACCUACUACAUCCAGCUGAUGAGUCCCAAAUAGGACGAAACGCGCU, which is found 100% homologous to the DNA sequence of SEQ ID NO:9 claimed in the instant case. Beilstein teaches that all aptazymes including “K7” and “K19” “show tetracycline-dependent increase of hRluc expression” and “respond to the same concentration of tetracycline with a plateau of induction reached at around 250 mM, a concentration where cell viability is still not affected by tetracycline”. See page 529. It would have been obvious to one of ordinary skill in the art before the effective filing date to modify Lewis’ AAV8 vector comprising “K7” aptazyme by replacing the “K7” aptazyme with a DNA counterpart of Beilstein’s “K19” aptazyme RNA sequence and by further replacing the constitutive CMV promoter with a liver-specific LP1 promoter. One of ordinary skill in the art would have been motivated use “K19” tetracycline-responsive aptazyme in place of “K7” because both “K7” and “K19” were art-recognized functional equivalents known for the same use/purpose with similar properties as evidenced by Beilstein, who reported that “K19” is “the most active candidate” as it provided “a considerable enhanced dynamic range of 8.7-fold” compared to the “7.5-fold” increase provided by “K7”, which thus would have enabled one of ordinary skill in the art to reasonably predict a similar or improved tetracycline-dependent expression of a therapeutic transgene encoding a therapeutic protein in a cell compared to Lewis’ vector comprising “K7”. One of ordinary skill in the art would have been further motivated to use the liver-specific promoter “LP1” in place of the CMV promoter with a reasonable expectation of success in order to improve a potential therapeutic efficacy of Lewis’ vector containing a transgene encoding IL-10 that is included in the interleukin “IL-1 through IL-25”, because it was an art-recognized goal to provide IL-10 gene therapy by delivering IL-10 to the liver of a subject for potential liver cirrhosis treatment as taught by Hung, and because the combination of the AAV8 capsid and a liver-specific promoter such as LP1 was taught to provide additional liver-specificity of the transgene included in the AAV vector as evidenced by the teachings of Lachmann. Since all structural limitations recited in claim 1 are fully met by Lewis’ vector or the vector that is rendered obvious in the instant rejection, it necessarily follows that prior art’s vector inherently possesses the functionality of providing at least 4-fold higher expression of the transgene in a test subject as recited in claim 23, absent objective evidence to the contrary. Note that the Office does not have the facilities and resources to provide the factual evidence needed in order to determine and/or compare the specific activities of the instantly claimed nucleic acid construct versus Lewis’ construct or the vector rendered obvious in the instant rejection. In the absence of evidence to the contrary, the burden is upon the applicant to prove that the claimed construct is different from the one taught by Lewis or rendered obvious in the instant rejection, thereby establishing patentable differences. See In re Best 562F.2d 1252, 195 USPQ 430 (CCPA 1977) and Ex parte Gray 10 USPQ2d 1922(PTO Bd.Pat. App. & Int. 1989). Accordingly, claims 1-5, 7, 9, 12, 14, 16, 23-28, 30, 32, 35, 37-41, and 54-55 taken as a whole would have been prima facie obvious before the effective filing date. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim 54 is rejected under 35 U.S.C. 101 because Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claim 54 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). Claim 54 recites “Cell which comprises the nucleic acid construct according to claim 1.” As broadly written, the “Cell” of claim 54 encompasses a human cell comprising the construct of claim 1, wherein the human cell comprising the construct of claim 1 is delivered to a human patient for gene therapy in view of the disclosure of the instant specification (see pages 34-35), thereby rendering the scope of the cell reading on a human organism comprising the vector-containing cell. Amending the “Cell” to “An isolated cell” would be remedial. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to DANA H SHIN whose telephone number is (571)272-8008. The examiner can normally be reached Monday-Thursday: 8am - 6:30pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, RAM SHUKLA can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DANA H SHIN/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Nov 17, 2022
Application Filed
Jan 31, 2026
Non-Final Rejection — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12582723
NOVEL POLYNUCLEOTIDES ENCODING A HUMAN FKRP PROTEIN
2y 5m to grant Granted Mar 24, 2026
Patent 12527834
POLYAMINATED POLYGLUTAMIC ACID-CONTAINING COMPOUNDS AND USES THEREOF FOR DELIVERING OLIGONUCLEOTIDES
2y 5m to grant Granted Jan 20, 2026
Patent 12527883
Retinal Promoter and Uses Thereof
2y 5m to grant Granted Jan 20, 2026
Patent 12529054
U1 snRNP Regulates Gene Expression and Modulates Oncogenicity
2y 5m to grant Granted Jan 20, 2026
Patent 12391946
USE OF A JANUS KINASE INHIBITOR AND A TELOMERASE INHIBITOR FOR THE TREATMENT OF MYELOPROLIFERATIVE NEOPLASMS
2y 5m to grant Granted Aug 19, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
27%
Grant Probability
55%
With Interview (+27.5%)
3y 6m
Median Time to Grant
Low
PTA Risk
Based on 1149 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month