Prosecution Insights
Last updated: July 17, 2026
Application No. 18/000,173

METHODS FOR CONTROLLING MERISTEM SIZE FOR CROP IMPROVEMENT

Final Rejection §103
Filed
Nov 29, 2022
Priority
Apr 16, 2020 — provisional 63/010,887 +1 more
Examiner
STOCKDALE, JESSICA NICOLE
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Pairwise Plants Services Inc.
OA Round
3 (Final)
43%
Grant Probability
Moderate
4-5
OA Rounds
0m
Est. Remaining
87%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allowance Rate
13 granted / 30 resolved
-16.7% vs TC avg
Strong +44% interview lift
Without
With
+44.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
27 currently pending
Career history
69
Total Applications
across all art units

Statute-Specific Performance

§101
0.6%
-39.4% vs TC avg
§103
69.8%
+29.8% vs TC avg
§102
8.9%
-31.1% vs TC avg
§112
11.7%
-28.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 30 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of the Claims Claims 1-8, 11, 13, 15-22, 24-25, 28-32, 34-46, 48, 50-55, and 57-78 are canceled. Claims 9-10, 12, 14, 23, 26-27, 33, 47, 49, 56 and 79-82 are pending. Claims 9-10, 12, 14, 23, 26-27, 33, 47, 49, 56 and 79-82 are examined herein. Claims 9-10, 12, 14, 23, 26-27, 33, 47, 49, 56 and 79-82 are rejected. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 9, 10, 12, 14, 23, 27, 47, 49, and 81 are rejected under 35 U.S.C. 103 as being unpatentable over Gao (WO-2020023258-A1) and Spencer (Spencer, D. H., Zhang, B., & Pfeifer, J. (2015). Single nucleotide variant detection using next generation sequencing. In Clinical genomics (pp. 109-127). Academic Press). This is a maintained rejection from the Office Action dated 11/04/2025. Claim 9 is drawn to a plant or plant part thereof comprising at least one non- natural mutation in an endogenous CLAVATA3/EMBRYO SURROUNDING REGION-RELATED (CLV3 ESR-RELATED) (CLE) gene that encodes a wild-type precursor CLE polypeptide, wherein the endogenous CLE gene encodes a FON2-LIKE CLE PROTEINI (FCP1) protein, a CLE7 protein, or a CLE14 protein, wherein the at least one non-natural mutation is introduced using a guide nucleic acid that binds to a portion of a target site in the endogenous CLE gene, the target site comprising a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83 or encoding a sequence having at least 95% sequence identity to any one of the amino acid sequences of SEQ ID NOs:75-77, and of wherein the at least one non-natural mutation is introduced using a guide nucleic acid that binds to a portion of a target site in the endogenous CLE gene, and wherein the at least one non-natural mutation results in an amino acid substitution of: (i) a valine (V) to methionine (M) at position 3,a glycine (G) to a threonine (T) at position 6, an aspartic acid (D) to an alanine (A) or glycine (G) at position 8, and/or a proline (P) to a leucine (L) at position 9 with reference to amino acid position numbering of SEQ ID NO:75, or SEQ ID NO:77; or (ii) valine (V) to a methionine (M) at position 3, glutamic acid (E) to a lysine (K) at position 5, a glycine (G) to a threonine (T) at position 6, and/or a proline (P) to a leucine (L) at position 9 with reference to amino acid position numbering of SEQ ID NO:76. Claim 10 is drawn to the plant or plant part thereof of claim 9, wherein the endogenous CLE gene comprises a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NO:78, SEQ ID NO:79 or SEQ ID NO:80, comprises a region having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NO:81, SEQ ID NO:82 or SEQ ID NO:82; encodes a sequence having at least 95% sequence identity to SEQ ID NO:72, SEQ ID NO:73, or SEQ ID NO:74, or encodes a domain having a sequence with least 95% sequence identity to SEQ ID NO:75, SEQ ID NO:76, or SEQ ID NO:77. Claim 12 is drawn to a plant or plant part thereof comprising at least one non- natural mutation in an endogenous CLAVATA3EMBRYO SURROUNDING REGION-RELATED (CLV3/ESR-RELATED) (CLE) gene that encodes a wild-type precursor CLE polypeptide, wherein the endogenous CLE gene encodes a FON2-LIKE CLE PROTEINI (FCP1)protein, a CLE7 protein, or a CLE14 protein of wherein the endogenous CLE gene encodes a FON2-LIKE CLE PROTEINI (FCP1)protein, a CLE7 protein, or a CLE14 protein of wherein the at least one non-natural mutation is introduced using a guide nucleic acid that binds to a portion of a target site in the endogenous CLE gene, the target site comprising a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83 or encoding a sequence having at least 95% sequence identity to any one of the amino acid sequences of SEQ ID NOs:75-77, and wherein the endogenous CLE gene comprising the at least one non-natural mutation comprises the sequence of any one of SEQ ID NOs:105-109 and/or encodes a mature CLE peptide comprising any one of the amino acid sequences of SEQ ID NOs:84-86, 88, 89, 92, or 94-100. Claim 14 is drawn to The plant or plant part thereof of claim 12, wherein the plant is corn and the corn plant comprising the at least one non-natural mutation in the endogenous CLE gene has an increase in kernel row number compared to a wild-type corn plant not comprising the at least one non-natural mutation in the endogenous CLE gene. Claim 23 is drawn to a corn plant cell comprising at least one non-natural mutation within a CLAVATA3/EMBRYO SURROUNDING REGION-RELATED (CLV3/ESR-RELATED)(CLE) gene that encodes a precursor CLE polypeptide, wherein the at least one non- natural mutation is a base substitution, a base insertion, or a base deletion that is introduced using an editing system that comprises a guide nucleic acid and a nucleic acid binding domain that binds to a target site in the CLE gene, wherein the guide nucleic acid binds to a portion of a target site in the CLE gene, the target site comprising a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83 or encoding a sequence having at least 95% sequence identity to any one of the amino acid sequences of SEQ ID NOs:75-77, wherein the CLE gene encodes a FCP1 protein, a CLE7 protein, or a CLE14 protein, and wherein the at least one non-natural mutation results in an amino acid substitution of:(i) a valine (V) to a methionine (M) at position 3, a glycine (G) to a threonine (T) at position 6, an aspartic acid (D) to an alanine (A) or glycine (G) at position 8, and/or a proline (P) to a leucine (L) at position 9 with reference to amino acid position numbering of SEQ ID NO:75 or SEQ ID NO:77; or (ii) valine (V) to a methionine (M) at position 3, glutamic acid (E) to a lysine (K) at position 5, a glycine (G) to a threonine (T) at position 6, and/or a proline (P) to a leucine (L) at position 9 with reference to amino acid position numbering of SEQ ID NO:76. Claim 27 is drawn to the corn plant cell of claim 23, wherein the target site encodes a sequence having at least 95% sequence identity to any one of the amino acid sequences of SEQ ID NOs:75-77. Claim 47 is drawn to a method for producing the plant or plant part thereof of claim 9, the method comprising: contacting the target site in the endogenous CLE gene in the corn plant or plant part thereof with [[a]]the guide nucleic acid and a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the plant or plant part is a corn plant or plant part thereof, wherein the endogenous CLE gene: (a) comprises a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:78-80; (b) comprises a region having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83; (c) encodes a sequence having at least 95% sequence identity to any one of the amino acid sequences of SEQ ID NOs:72-74; and/or (d) encodes a domain having a sequence with least 95% sequence identity to any one of the amino acid sequences of SEQ ID NOs:75-77, thereby producing the corn plant or plant part thereof comprising the at least one non-natural mutation in the endogenous CLE gene, wherein the corn plant exhibits increased kernel row number compared to a wild- type corn plant not comprising the at least one non-natural mutation in the endogenous CLE gene. Claim 49 is drawn to the method of claim 47, wherein the endogenous CLE gene encodes a FCP1 protein, a CLE7 protein or a CLE14 protein. Claim 81 is drawn to the plant or plant part thereof of claim 12, wherein the endogenous CLE gene encodes a mature CLE peptide comprising any one of the amino acid sequences of SEQ ID NOs:84-86, 88, 89, 92, or 94-100. Regarding claim 9, 12, 23, Gao teaches a method of producing a modified plant by introducing genomic modification into an endogenous ZmFCP1 gene, wherein the genomic modification is introduced by a guide RNA associated Cas9 (claims 20-21). Gao teaches the endogenous ZmFCP1 encodes the mature amino acid sequence described by SEQ ID NO: 34 of Gao, which has 100% identity to instant SEQ ID NO:75 (p. 9, see Table 1; and p. 42, line 10-11; and see alignment below). Gao teaches at least one site-specific mutation introduced into ZmFCP1 genomic locus such that one or more amino acid positions corresponding to SEQ ID NO: 34 is modified, including a modifications of V to S, I, or A, modifications of G to C or S, modifications of D to N, and modifications of P to H (claim 13 of Gao), and because instant SEQ ID NO: 75 is identical to SEQ ID NO: 34 taught by Gao, the positions that are modified are identical. Gao teaches the plant is maize and the modification is a point mutation (i.e. a substitution) (claims 8, 13, 14, 35, and 36 of Gao). PNG media_image1.png 102 582 media_image1.png Greyscale Regarding claims 10 and 27, Gao teaches the endogenous ZmFCP1 encodes the mature amino acid sequence described by SEQ ID NO: 34 of Gao, which has 100% identity to instant SEQ ID NO:75 (p. 9, see table). Regarding claim 14, Gao discloses the plant is maize, and the maize plant comprising the mutated FCP1 gene has an increase in a yield related agronomic trait (claim 8), and discloses improved agronomic characteristics include kernel number (abstract) and kernel rows (p. 20, lines 20-22). This is relative to control plants not comprising the mutation (claim 1 and 8 of Gao). Regarding claim 47, Gao teaches a method of producing a modified plant by introducing genomic modification into an endogenous ZmFCP1 gene, wherein the genomic modification is introduced by a guide RNA associated Cas9 (claims 20-21), and the endogenous ZmFCP1 encodes the mature ZmFCP1 amino acid sequence shown as SEQ ID NO: 34 of Gao, which has 100% identity to instant SEQ ID NO:75 (p. 9, see table). Gao also teaches the plant is maize and the modification is a point mutation (i.e. a substitution) (claims 8, 13, 14, 35, and 36 of Gao). Gao further teaches the maize plant comprising the mutated FCP1 gene has an increase in a yield related agronomic trait (claim 8), and teaches improved agronomic characteristics include kernel number (abstract) and kernel rows (p. 20, lines 20-22). Regarding claim 49, Gao teaches the CLE gene encodes a FCP1 polypeptide/ protein (claims 8, 13, 14, 35-36 of Gao). However, Gao does not explicitly teach: the modifications/substitutions are V to M at position 3, a G to T at position 6, a D to A or G at position 8, and/or a P to L at position 9 with reference to amino acid position numbering of SEQ ID NO:75 (as recited in claims 9 and 23); or the endogenous CLE gene encodes a mature CLE peptide comprising any one of the amino acid sequences of SEQ ID NOs:84-86, 88, and 89 (as recited in claims 12 and 81). Regarding the remaining limitations of claims 9, 12, 23, and 81, in analogous art, Spencer teaches nonconservative substitution results in replacement of one amino acid by another that is chemically dissimilar (typically in charge or hydrophobicity) which often has a deleterious effect on protein function (p. 113, section titled Missense SNVs). It would therefore have been obvious to a person of ordinary skill in the art to modify the invention taught by Gao to include the limitations of Spencer to arrive at the instantly claimed mutant plants with a reasonable expectation of success because Gao teaches an invention drawn to methods for modulating fea3 and/or Fcp1 genomic locus in a host plant or plant cell to improve agronomic characteristics such as kernel number, and one method includes reducing expression and/or activity of the Fcp1 polypeptide by introducing various nonconservative point mutations at specific locations of the 12 bp SEQ ID NO: 34 that is 100% identical to instant SEQ ID NO: 75 (abstract, p. 5, lines 6-27- p. 6, lines 1-4, claims 1, 8, 13 of Gao). Therefore, one having ordinary skill in the art could have incorporated substitution of the amino acids at the claimed positions with other nonconservative amino acids than those taught by Gao, such as those instantly claimed, to arrive at the instantly claimed plants without encountering any special technical difficulties. One having ordinary skill in the art would have been motivated to do so because Gao teaches various nonconservative amino acid substitutions at the same positions of the same amino acid sequence that is instantly claimed that reduce ZmFCP1-Fea3 interaction to improve agronomic characteristics such as kernel number (abstract, p. 5, lines 6-27- p. 6, lines 1-4, p. 42, example 5, and claims 1, 8, 13 of Gao). It would therefore be prima facie obvious to use the method of Gao, but select different nonconservative amino acid substitutions than those taught by Gao, for the same purpose. By doing so, it would be obvious for one having ordinary skill in the art to arrive at the instantly claimed methods including the modifications/substitutions of V to M at position 3, a G to T at position 6, a D to A or G at position 8, and/or a P to L at position 9 with reference to amino acid position numbering of SEQ ID NO:75. These obvious mutations would also result in the obvious mutant sequences of SEQ ID NOs:84-86, 88, and 89. Claims 26, 33, 80, and 82 are rejected under 35 U.S.C. 103 as being unpatentable over Gao and Spencer as applied to claims 23, 9, and 12, above, and further in view of Bruce (US-20030226178-A1). This is a maintained rejection from the Office Action dated 11/04/2025. Claim 26 is drawn to the corn plant cell of claim 23, wherein the target site is within a region of the CLE gene, said region comprising a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83. Claim 33 is drawn to corn plant regenerated from the corn plant cell of claim 23, wherein the corn plant comprises the at least one non-natural mutation and the at least one non- natural mutation results in a dominant negative allele and the corn plant exhibits a phenotype of increased kernel row number, when compared to a wild-type corn plant not comprising the dominant negative allele. Claim 80 is drawn to the plant or plant part thereof of claim 9, wherein the target site is within a region of the CLE gene, said region comprising a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83. Claim 82 is drawn to the plant or plant part thereof of claim 12, wherein the target site is within a region of the CLE gene, said region comprising a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83. Regarding claims 26, 33, 80, and 82, Gao and Spencer teach the limitations of claims 23, 9, and 12, as set forth in the previous obviousness rejection. The teachings of Gao and Spencer as they are applied to claims 23, 9, and 12 are set forth previously herein and are incorporated by reference. Gao further teaches the term “dominant negative mutation” as used herein refers to a mutation that has an altered gene product that acts antagonistically to the wild-type allele, and these mutations usually result in an altered molecular function (often inactive) and are characterized by a “dominant negative” phenotype (p. 20, lines 6-11). Gao further teaches a gene variant, a mutated gene or an allele that confers “dominant negative phenotype” would confer a “null” or a “mutated” phenotype on the host cell even in the presence of a wild-type allele (p. 20, lines 6-11). However, Gao and Spencer do not explicitly teach: wherein the target site is within a region of the CLE gene, said region comprising a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83 (claims 26, 80, and 82). wherein the corn plant comprises the at least one non-natural mutation and the at least one non- natural mutation results in a dominant negative allele and the corn plant exhibits a phenotype of increased kernel row number, when compared to a wild-type corn plant not comprising the dominant negative allele (claim 33). In analogous art, Bruce teaches an invention related to maize CLAVATA3-like nucleotides and polypeptides, and methods of using them to modulate cell division, differentiation, and development, especially of the meristem (title, abstract). Specifically regarding claim 26, 80, and 82, Bruce teaches a CLE gene (SEQ ID NO: 4 of Bruce) comprising a sequence with 100% identity to instant SEQ ID NO: 81 (see below). Specifically regarding claim 33, Bruce sequences of the invention encoding the CLV3-like polypeptides may be modified such that expression of the polypeptide results in meristem enlargement, and consequently, sequences encoding dominant-negative CLV3-like polypeptide are encompassed by the present invention (¶0063-0064), and teaches methods of obtaining dominant negative mutations are known in the art (¶0065). RESULT 9 US-10-430-523-4 Sequence 4, US/10430523 Publication No. US20030226178A1 GENERAL INFORMATION APPLICANT: Bruce, Wesley APPLICANT: Sakai, Hajime APPLICANT: Newman, Lisa TITLE OF INVENTION: Maize CLAVATA3-like Polynucleotides and TITLE OF INVENTION: Methods of Use FILE REFERENCE: 1488 CURRENT APPLICATION NUMBER: US/10/430,523 CURRENT FILING DATE: 2003-05-06 PRIOR APPLICATION NUMBER: 60/380,170 PRIOR FILING DATE: 2002-05-06 PRIOR APPLICATION NUMBER: 60/392,918 PRIOR FILING DATE: 2002-07-01 NUMBER OF SEQ ID NOS: 16 SEQ ID NO 4 LENGTH: 826 TYPE: DNA ORGANISM: Zea mays Query Match 100.0%; Score 36; Length 826; Best Local Similarity 100.0%; Matches 36; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGGGAGGTGCCGACGGGACCGGACCCCATCCACCAC 36 |||||||||||||||||||||||||||||||||||| Db 574 AGGGAGGTGCCGACGGGACCGGACCCCATCCACCAC 609 It would therefore have been obvious to a person of ordinary skill in the art to modify the invention of as taught by Gao and Spencer to include the CLE nucleotide sequence taught by Bruce to arrive at the instantly claimed method with a reasonable expectation of success because SEQ ID NO: 4 (i.e. instant SEQ ID NO:81) taught by Bruce was a known and readily obtainable sequence. One having ordinary skill in the art would have been motivated to combine the teachings because it would have been prima facie obvious to substitute the CLE nucleotide sequence taught by Gao with another CLE nucleotide sequence known in the art, the CLE nucleotide sequence taught by Bruce, for the same purpose. It would also be prima facie obvious to incorporate a mutation resulting in the dominant negative allele taught by Bruce for the purpose achieving the desired mutant phenotype by blocking the action of the endogenous CVL3-like polypeptide without inactivating the structural CVL3-like gene sequence or its RNA (¶0063-0065). One would have a reasonable expectation of success because Gao teaches the CLV3-like sequences and clearly states, as early as 2003 when Bruce published the patent application, that methods of obtaining dominant negative mutations are known in the art and provides various references (¶0065). Claims 56 and 79 are rejected under 35 U.S.C. 103 as being unpatentable over Gao (WO-2020023258 A1) and Bruce (US-20030226178-A1). This is a maintained rejection from the Office Action dated 11/04/2025. Claim 56 is drawn to a guide nucleic acid that binds to a portion of a target site in a CLAVATA3/EMBRYO SURROUNDING REGION-RELATED (CLV3/ESR-RELATED) (CLE) gene that encodes a precursor CLE peptide, the target site comprising a sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83 or encoding a sequence having at least 95% sequence identity to any one of the amino acid sequences of SEQ ID NOs:75-77, wherein the guide nucleic acid comprises a spacer consisting of any one of the nucleotide sequences of SEQ ID NOs:102-104, 110-113, and 115-117. Claim 79 is drawn to the guide nucleic acid of claim 56, wherein the guide nucleic acid comprises the sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83 and encodes the sequence having at least 95% sequence identity to any one of the amino acid sequences of SEQ ID NOs:75-77. Regarding claim 56 and 79, Gao teaches a method of producing a modified plant by introducing genomic modification into an endogenous ZmFCP1 gene, wherein the genomic modification is introduced by a guide RNA associated Cas9 (claims 20-21). Gao teaches the endogenous ZmFCP1 encodes the mature amino acid sequence described by SEQ ID NO: 34 of Gao, which has 100% identity to instant SEQ ID NO:75 (p. 9, see Table 1; and p. 42, line 10-11; and see alignment below) (i.e. a guide nucleic acid that binds a target site in a CLE gene encoding an FCP1 polypeptide comprising a sequence encoding a sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 75). PNG media_image1.png 102 582 media_image1.png Greyscale However, Gao does not explicitly teach: wherein the guide nucleic acid comprises a Spacer comprising any one of the nucleotide sequences of SEQ ID NOs:102-104, 110-113, and 115-117 (claim 56). wherein the guide nucleic acid comprises the sequence having at least 90% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:81-83 and encodes the sequence having at least 95% sequence identity to any one of the amino acid sequences of SEQ ID NOs:75-77 (claim 79). In analogous art, Bruce teaches an invention related to maize CLAVATAS-like nucleotides and polypeptides, and methods of using them to modulate cell division, differentiation, and development, especially of the meristem (title, abstract). Specifically regarding claim 57, Bruce teaches a CLE gene (SEQ ID NO: 4 of Bruce) comprising a sequence with 100% identity to instant SEQ ID NO: 112 (see below). RESULT 3 US-10-430-523-4 Sequence 4, US/10430523 Publication No. US20030226178A1 GENERAL INFORMATION APPLICANT: Bruce, Wesley APPLICANT: Sakai, Hajime APPLICANT: Newman, Lisa TITLE OF INVENTION: Maize CLAVATA3-like Polynucleotides and TITLE OF INVENTION: Methods of Use FILE REFERENCE: 1488 CURRENT APPLICATION NUMBER: US/10/430,523 CURRENT FILING DATE: 2003-05-06 PRIOR APPLICATION NUMBER: 60/380,170 PRIOR FILING DATE: 2002-05-06 PRIOR APPLICATION NUMBER: 60/392,918 PRIOR FILING DATE: 2002-07-01 NUMBER OF SEQ ID NOS: 16 SEQ ID NO 4 LENGTH: 826 TYPE: DNA ORGANISM: Zea mays Query Match 100.0%; Score 23; Length 826; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGCGTGCAGGGCGCGGAGGAGGA 23 ||||||||||||||||||||||| Db517GGCGTGCAGGGCGCGGAGGAGGA 539 Specifically regarding claim 79, Bruce teaches a CLE gene (SEQ ID NO: 4 of Bruce) comprising a sequence with 100% identity to instant SEQ ID NO: 81 (see below) which encodes the polypeptide sequence of instant SEQ ID NO: 75/ SEQ ID NO: 34 of Gao. RESULT 9 US-10-430-523-4 Sequence 4, US/10430523 Publication No. US20030226178A1 GENERAL INFORMATION APPLICANT: Bruce, Wesley APPLICANT: Sakai, Hajime APPLICANT: Newman, Lisa TITLE OF INVENTION: Maize CLAVATA3-like Polynucleotides and TITLE OF INVENTION: Methods of Use FILE REFERENCE: 1488 CURRENT APPLICATION NUMBER: US/10/430,523 CURRENT FILING DATE: 2003-05-06 PRIOR APPLICATION NUMBER: 60/380,170 PRIOR FILING DATE: 2002-05-06 PRIOR APPLICATION NUMBER: 60/392,918 PRIOR FILING DATE: 2002-07-01 NUMBER OF SEQ ID NOS: 16 SEQ ID NO 4 LENGTH: 826 TYPE: DNA ORGANISM: Zea mays Query Match 100.0%; Score 36; Length 826; Best Local Similarity 100.0%; Matches 36; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGGGAGGTGCCGACGGGACCGGACCCCATCCACCAC 36 |||||||||||||||||||||||||||||||||||| Db 574 AGGGAGGTGCCGACGGGACCGGACCCCATCCACCAC 609 It would therefore have been obvious to a person of ordinary skill in the art to modify the invention of as taught by Gao to include the sequence taught by Bruce in the guide RNA, including as a spacer sequence, to arrive at the instantly claimed method with a reasonable expectation of success because Gao teaches using a guide nucleic acid to bind a CLE gene encoding the claimed amino acid sequence, and Bruce teaches a CLE gene comprising the nucleotide sequences. Therefore, one of ordinary skill would have a reasonable expectation of success because the sequence was known and readily obtainable. One having ordinary skill in the art would have been motivated to combine the teachings because it would have been prima facie obvious to design the guide nucleic acid of Gao to comprise the nucleotide sequence, including the spacer, to bind the CLE nucleotide taught by Bruce because it was sequence known in the art. Response to Arguments Applicant argues beginning on p. 8 of remarks dated 02/02/2026 the following arguments: A. Claims 9, 10, 12, 14, 23, 27, 47, 49 and 81 Claims 9, 10, 12, 14, 23, 27, 47, 49 and 81 are rejected under 35 U.S.C. § 103 as being unpatentable over WO 2020/023258 to Gao et al. ("Gao") and Spencer et al. In Clinical Genomics pp. 109-127. Academic Press (2015) ("Spencer"). See Action, pages 3-10. Applicant respectfully traverses this rejection. Applicant respectfully submits that Gao does not teach or suggest a plant or plant part thereof comprising at least one non-natural mutation in an endogenous CLE gene as claimed in independent Claim 9 and independent Claim 12. Nor does Gao teach or suggest a corn plant cell as recited in independent Claim 23. As conceded in the Action, Gao does not teach that the modifications are V to M at position 3, a G to T at position 6, a D to A or G at position 8, and/or a P to L at position 9 with reference to amino acid position numbering of SEQ ID NO:75 (as recited in independent Claims 9 and 23), nor does it teach the endogenous CLE gene encodes a mature CLE peptide comprising any one of the amino acid substitutions of SEQ ID NOs: 84-86, 88, and 89 (as recited in independent Claim 12). See Action, pages 8-9. Spencer is cited as describing nonconservative substitutions often having a deleterious effect on protein function. The Action alleges that because Gao teaches nonconservative point mutations at the claimed locations in SEQ ID NO:34 of Gao, which is 100% identical to the instant SEQ ID NO:75, it would have been obvious to select different nonconservative amino acid substitutions for the same purpose as in Gao. See Action, pages 9-10. Applicant respectfully disagrees. Gao does not teach or suggest selecting its modifications based on whether or not they are nonconservative amino acid substitutions. Indeed, the mutations proposed in Gao include both conservative and nonconservative substitutions. Furthermore, the mutations of Gao are based on an alignment of SEQ ID NO:34 with known CLE-like peptides. See Gao, page 42, line 25, to page 43, line 2. Thus, there is no direction in Gao to select different mutations than those proposed in Gao, let alone to specifically select nonconservative amino acid substitutions. Spencer fails to correct these deficiencies. Spencer merely describes what nonconservative amino acid substitutions are and states that they often have a deleterious effect on protein function. There is no mention of a CLE gene nor the sequence of SEQ ID NO:34 in Spencer. Further, the combination of Gao and Spencer fails to provide a person of ordinary skill in the art at the time of the invention with a reason to modify Gao in the manner claimed. Instead, the combination of Gao and Spencer directs the person of ordinary skill in the art away from the claimed invention as Spencer directs one to not select nonconservative substitutions due to deleterious effects. Accordingly, the combination of Gao and Spencer not only fails to teach or suggest the claimed invention of independent Claims 9, 12, and 23, but also fails to provide the ordinarily skilled artisan with a reason to modify Gao in the manner claimed. For at least these reasons, Applicant respectfully submits that independent Claims 9, 12, and 23, and their dependent Claims 10, 14, 27, 47, 49 and 81 are patentable over the combination of Gao and Spencer and requests that this rejection be withdrawn. This argument has been fully considered and is found not persuasive for the following reason(s): Gao teaches making substitutions at specific locations in the 12 bp sequence of instant SEQ ID NO: 75. The purpose of making the mutations is to weaken the ligand/receptor/interactor bindings to improve agronomic characteristics (p. 4, lines 12-20, p. 42, lines 22-25). Gao teaches examples of both conservative and not conservative amino acid substitutions at specified locations in SEQ ID NO: 75 can achieve this (claim 13). Gao teaches, for example, a mutation at position 6 from Glycine (G) which is nonpolar to Serine (S) which is polar, therefore teaching a replacement of one amino acid with another that is chemically dissimilar in hydrophobicity to achieve the weakened binding ability (Example 5 of Gao and claim 13 of Gao). In analogous art, Spencer teaches nonconservative substitution results in replacement of one amino acid by another that is chemically dissimilar (typically in charge or hydrophobicity) which often has a deleterious effect on protein function (p. 113, section titled Missense SNVs). Therefore, it would be obvious to mutate the Glycine (G) in SEQ ID NO: 75, which is nonpolar, to other amino acid sequences that are either dissimilar in charge or polarity to weaken (i.e. have a deleterious effect on) the protein’s binding ability. It would be especially obvious to substitute the Glycine with an amino acid having similar properties to the Serine substitute taught by Gao, such as instantly claimed Threonine (T) which is also polar and uncharged. Therefore, Applicant’s argument is not persuasive and one of ordinary skill in the art would in fact be motivated combine the teachings of Gao and Spencer to select nonconservative (i.e. change in polarity or charge) substitutions to weaken the protein’s binding ability/ cause the deleterious effects. Applicant argues beginning on p. 10 of remarks dated 02/02/2026 the following arguments: B. Claims 26, 33, 80 and 82 Claims 26, 33, 80 and 82 are rejected under 35 U.S.C. § 103 as being unpatentable over Gao and Spencer, and further in view of U.S. Patent Publication No. 2003/0226178 to Bruce et al. ("Bruce"). See Action, pages 10-13. Applicant respectfully traverses this rejection. Claims 26 and 33 each ultimately depend from Claim 23, Claim 80 ultimately depends from Claim 9, and Claim 82 ultimately depends from Claim 12. As described above, the combination of Gao and Spencer fails to teach or suggest each and every element of independent Claims 9, 12, and 23 in the manner claimed. Bruce, cited in regard to a particular sequence, fails to correct the deficiencies of Gao and Spencer. In particular, the combination of Gao, Spencer, and Bruce at least fails to teach or suggest at least one non-natural mutation in an endogenous CLE gene as claimed in independent Claims 9, 12, and 23. Nor does the combination of Gao, Spencer, and Bruce provide one of ordinary skill in the art at the time of the invention with a reason to modify Gao in the manner claimed in independent Claims 9, 12, and 23. Claims 26, 33, 80, and 82 are patentable at least for the reason that the independent claim from which each ultimately depends is patentable. For at least these reasons, Applicant respectfully submits that Claims 26, 33, 80, and 82 are patentable over the combination of Gao, Spencer, and Bruce and requests that this rejection be withdrawn. This argument has been fully considered and is found not persuasive for the following reason(s): Applicant essentially argues that because the independent claims are not obvious over Gao and Spencer, dependent 26, 33, 80 and 82 are also not obvious. This is not persuasive because, despite Applicant’s arguments, the pending independent claims are deemed obvious in view of Gao and Spencer (see 103 rejection and also response to argument above). Applicant argues beginning on p. 10 of remarks dated 02/02/2026 the following arguments: C. Claims 56 and 79 Claims 56 and 79 are rejected under 35 U.S.C. § 103 as being unpatentable over Gao, and further in view of Bruce. See Action, pages 13-17. Applicant respectfully traverses this rejection. As conceded in the Action at pages 14-15, Gao does not teach a guide nucleic acid that comprises a spacer comprising any one of the nucleotide sequences of SEQ ID NOs:102-104, 110-113, and 115-117 as recited in Claim 56. The Action cites to Bruce as teaching a CLE gene having a sequence of SEQ ID NO:4 and having 100% identity to the instant SEQ ID NO:112 as recited in Claim 56. See Action, page 15. Not only does Gao not teach a guide nucleic acid that comprises a spacer comprising any one of the nucleotide sequences of SEQ ID NOs:102-104, 110-113, and 115-117, Gao also fails to suggest a guide nucleic acid that comprises a spacer that comprises any one of the nucleotide sequences of SEQ ID NOs:102-104, 110-113, and 115-117 as claimed. Accordingly, Gao also fails to teach or suggest a spacer consisting of any one of the nucleotide sequences of SEQ ID NOs:102-104, 110-113, and 115-117. Bruce fails to correct the deficiencies of Gao. SEQ ID NO:4 of Bruce is a nucleotide sequence having a length of 826 nucleotides, whereas SEQ ID NO:112 has a length of 23 nucleotides. Thus, the sequence of Bruce is more than 35 times longer than the claimed spacer sequence of SEQ ID NO:112. At least in view of the vast difference in the length of SEQ ID NO:4 of Bruce compared to the instant SEQ ID NO:112 and the lack of any direction to SEQ ID NO:4, there is simply no teaching, suggestion, or direction in the combination of Gao and Bruce to arrive at the particular claimed guide nucleic acid that comprises a spacer that consists of any one of the nucleotide sequences of SEQ ID NOs:102-104, 110-113, and 115-117. Thus, the combination of Gao and Bruce fails to teach or suggest each and every element of the claimed guide nucleic acid in the manner claimed in Claim 56. For at least these reasons, Applicant respectfully submits that independent Claim 56 and its dependent Claim 79 are patentable over the combination of Gao and Bruce and requests that this rejection be withdrawn. This argument has been fully considered and is found not persuasive for the following reason(s): Gao teaches an invention that encompasses the claimed inventive concept. The claimed CLE gene and encoded protein sequences are also known and readily obtainable, and designing gRNAs and spacers to produce mutations in known sequences is routine. It would be obvious for the guide nucleic acid to comprise a sequence comprising or consisting of known sequence(s) that are relatively close to the target site (see alignments in 103 rejection(s) above) to achieve the same outcome. Applicant’s argument is therefore not persuasive because different the gRNAs/ spacers that mutate the same CLE gene/peptide target for the same purpose of the nearly identical invention taught by Gao are deemed obvious in view of the prior art. Conclusion and Inquiries No claims are allowed. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA N STOCKDALE whose telephone number is (703)756-5395. The examiner can normally be reached M-F 8:30-5:00 CT. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. JESSICA N. STOCKDALE Examiner Art Unit 1663 /JESSICA NICOLE STOCKDALE/Examiner, Art Unit 1663 /CHARLES LOGSDON/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Nov 29, 2022
Application Filed
May 07, 2025
Non-Final Rejection mailed — §103
Aug 05, 2025
Response Filed
Nov 04, 2025
Non-Final Rejection mailed — §103
Feb 02, 2026
Response Filed
Jun 08, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12624364
PLANT REGULATORY ELEMENTS AND USES THEREOF FOR AUTOEXCISION
3y 0m to grant Granted May 12, 2026
Patent 12612640
GENE RELATED TO BIOSYNTHESIS OF ERGOTHIONEINE, AND USE THEREOF
1y 9m to grant Granted Apr 28, 2026
Patent 12590314
Expressing Multiple Genes from a Single Transcript in Algae and Plants
3y 3m to grant Granted Mar 31, 2026
Patent 12590318
NOVEL INSECT INHIBITORY PROTEINS
2y 3m to grant Granted Mar 31, 2026
Patent 12545923
MUTANT GENE CONFERRING A COMPACT GROWTH PHENOTYPE IN WATERMELON
3y 0m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

4-5
Expected OA Rounds
43%
Grant Probability
87%
With Interview (+44.0%)
2y 5m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 30 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month