DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of SEQ ID NO: 2023, which is the 22nd marker in table 5 and the 2nd marker in table 9 in the reply filed on 10/8/2025 as well as species a in claim 17 in the reply filed 2/24/2026 is acknowledged (it is noted that the species election requirements made in the office action dated 7/10/2025 are withdrawn and the species have been rejoined). The traversal is on the ground(s) that the claims are unified by the specific technical feature of chromosome interactions associated with fibrosis. This is not found persuasive because each interaction is structurally different and results in a structurally different nucleic acid. While these interaction markers were identified using applicants technique, the claims are not generic to this technique. Each SEQ ID NO: comprises different chromosomal interactions each involving different genes and loci and different nucleotide sequences. Accordingly, each chromosomal interaction has a different chemical structure. Each of the genes, loci, and probes occur at different locations in the genome and have different biological activities and effects. Accordingly, there is no special technical feature linking the recited groups of chromosomal interactions as is required to establish unity of invention.
The requirement is still deemed proper and is therefore made FINAL.
Status of Claims
Claims 1-18 are pending. Claims 3, 4, 6, 7, and 10-12 are directed to different unelected combinations and sub-combinations of chromosomal interactions and are withdrawn from consideration. An action on the merits of claims 1-2, 5, 8-9, and 13-18 is set forth herein.
Specification
The title of the invention requires amendment because it contains spelling and format errors. Specifically, the term “confirmation” appears to be misspelled, while “e.g.” is not clear. The following title is suggested:
CHROMOSOME CONFORMATION MARKERS FOR FIBROSIS AND SCLERODERMA
A substitute specification excluding the claims is required pursuant to 37 CFR 1.125(a) because the specification contains over 40 pages of nucleotide sequences which are not identified by SEQ ID NO:. All recitations of nucleotide sequences larger than 10 nucleotides must be accompanied by the proper sequence identifier (SEQ ID NO) in each instance.
A substitute specification must not contain new matter.
The substitute specification must be submitted with markings showing all the changes relative to the immediate prior version of the specification of record.
The text of any added subject matter must be shown by underlining the added text.
The text of any deleted matter must be shown by strike-through except that double brackets placed before and after the deleted characters may be used to show deletion of five or fewer consecutive characters. The text of any deleted subject matter must be shown by being placed within double brackets if strike-through cannot be easily perceived.
An accompanying clean version (without markings) and a statement that the substitute specification contains no new matter must also be supplied. Numbering the paragraphs of the specification of record is not considered a change that must be shown.
The substitute specification MUST contain ALL of the changes that were made in any previous amendment to the specification.
Note on claim interpretation
Applicants have elected, and the response dated 10/8/2025 recites “ORF1 _12_117309542_11731 0883_117405729_117409691 _FF, which is the 22nd marker in table 5 and corresponds to the probe sequence ATGTAGCCCAGGCTGGTTGTCTTTTTTTTCGATCCACCCATCCACCCATCCTCCCATCCA with traverse. This marker corresponds to the 2nd marker of table 9. The election reads on claims 1 to 4 and 7 to 18”. However, neither table 5 nor table 9 are recited in most of the claims. In the interest of compact prosecution the claims are being examined as they relate to this election, however amendment of the claims to reflect the election is required.
Improper Markush Grouping
Claims 1-2, 5, 8-9, and 13-18 are rejected on the basis that they contain an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 706.03(y).
The Markush groupings of the chromosome interactions represented by the markers, probes, and primers in tables 1-6 [as well as all the tables in the specification ] used to detect the chromosome interactions, and combinations thereof are improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons:
MPEP 706.03(y) states that “A Markush claim may be rejected under judicially approved “improper Markush grouping” principles when the claim contains an improper grouping of alternatively useable members. A Markush claim contains an “improper Markush grouping” if either: (1) the members of the Markush group do not share a “single structural similarity” or (2) the members do not share a common use. Supplementary Guidelines at 7166 (citing In re Harnisch, 631 F.2d 716, 721-22, 206 USPQ 300, 305 (CCPA 1980)). “ Members of a Markush group share a “single structural similarity” when they belong to the same recognized physical or chemical class or to the same art-recognized class (prong 1) and the members of a Markush group share a common function or use when they are disclosed in the specification or known in the art to be functionally equivalent (prong 2).
The phrase “significant structural element is shared by all of the alternatives” refers to cases where the compounds share a common chemical structure which occupies a large portion of their structures, or in case the compounds have in common only a small portion of their structures, the commonly shared structure constitutes a structurally distinctive portion in view of existing prior art, and the common structure is essential to the common property or activity.
A recognized physical class, a recognized chemical class, or an art-recognized class is a class wherein “there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention. In other words, each member could be substituted one for the other, with the expectation that the same intended result would be achieved” (see MPEP 706.03(y)IIA).
In the instant situation, the recited alternative species do not share a single structural similarity, as each chromosome interaction occurs at a different location in the genome and involves different nucleotide sequences. Thus, each chromosome interaction has a different chemical structure in that it consists of a different nucleotide sequence. The probes and primers used to detect the chromosome interactions also have a different chemical structure in that they consist of different nucleotide sequences. The only structural similarity present is that all of the chromosome interactions (and probes and primers) comprise nucleotides. The fact that the chromosome interactions comprise nucleotides per se does not support a conclusion that they have a common single structural similarity because the structure of comprising nucleotides alone is not essential to the asserted common activity of being correlated with fibrosis, or scleroderma. Accordingly, while the different chromosome interactions are asserted to have the property of being related to fibrosis or scleroderma, they do not share a substantial structural similarity essential to this activity.
Further, the recited chromosome interactions do not belong to a chemical or art-recognized class because there is no expectation from the knowledge in the prior art that the chromosome interactions behave in the same manner and can be substituted for one another with the same intended result achieved. There is no evidence of record to establish that it is clear from their very nature that the recited chromosome interactions possess the common property of being indicative of fibrosis or scleroderma. Additionally, there isn’t any evidence of record to establish that it is clear from their very nature that the recited probes and primers possess the common property of being useful to detecting a chromosome interaction indicative of fibrosis or scleroderma.
Following this analysis, the claims are rejected as containing an improper Markush grouping.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-2, 5, 8-9, and 13-18 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural correlation/law of nature and an abstract idea without significantly more. This judicial exception is not integrated into a practical application and the claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception for the reasons set forth below.
35 U.S.C. § 101 requires that to be patent-eligible, an invention (1) must be directed to one of the four statutory categories, and (2) must not be wholly directed to subject matter encompassing a judicially recognized exception. M.P.E.P. § 2106. Regarding judicial exceptions, “[p]henomena of nature, though just discovered, mental processes, and abstract intellectual concepts are not patentable, as they are the basic tools of scientific and technological work.” Gottschalk v. Benson, 409 U.S. 63, 67 (1972); see also M.P.E.P. § 2106. The unpatentability of abstract ideas was confirmed by the U.S. Supreme court in Bilski v. Kappos, 561 U.S. 593, 601 (June 28, 2010) and Alice Corp. Pty. Ltd. v. CLS Bank Int’l, 134 S. Ct. 2347, 2354 (2014). See also Myriad v Ambry, CAFC 2014-1361, -1366, December 17, 2014. The unpatentability of laws of nature was confirmed by the U.S. Supreme Court in Mayo Collaborative Services v. Prometheus Laboratories, Inc., 566 U.S. 66, 71 (2012). “[L]aws of nature, natural phenomena, and abstract ideas” are not patentable. Dia-mond v. Diehr, 450 U. S. 175, 185 (1981); see also Bilski v. Kappos, 561 U. S. at 601 (2010).
Claims Analysis:
As set forth in MPEP 2106, the claims have been analyzed to determine whether they are directed to one of the four statutory categories (STEP 1).
The instant claims are directed to processes and therefore are directed to one of the four statutory categories of invention.
The claims are then analyzed to determine if they recite a judicial exception (JE) (STEP 2A, prong 1) [Mayo Collaborative Services v. Prometheus Labs., Inc., 132 S. Ct. 1289, 1293 (2012), Alice Corp. Pry. Ltd. v. CLS Bank Int'l, 134 S. Ct. 2347 (2014)].
The claimed invention recites a method of detecting and a chromosome state which represents a subgroup in a population which relates to the state [presence] of fibrosis by determining whether a chromosome interaction relating to the chromosome state is present or absent, wherein the chromosome interaction corresponds to the the chromosome interaction represented by the probe: ORF1 _12_117309542_11731 0883_117405729_117409691 _FF: ATGTAGCCCAGGCTGGTTGTCTTTTTTTTCGATCCACCCATCCACCCATCCTCCCATCCA (SEQ ID NO: 2023). This recitation is a Judicial exception (JE) because it is a natural correlation between the presence of the chromosome interaction represented by SEQ ID NO: 2023 and the state of presence of fibrosis. However, as in Mayo, the relationship is itself a natural process that exists apart from any human action. The claims also recite “detecting” the stage of fibrosis as early or late, “detecting” the presence of fibrosis, using the process to select a treatment schedule, specific therapy, and/or selecting an individual for medical treatment. However, these are directed to a JE because they are abstract ideas due to the fact that they encompasses making conclusions and determinations which can occur entirely within the mind. It is therefore determined that the claims are directed to judicial exceptions.
The claims are then analyzed to determine whether they recite an element or step that integrates the JE into a practical application (STEP 2A, prong 2) [Vanda Pharmaceuticals Inc., v. West-Ward Pharmaceuticals, 887 F.3d 1117 (Fed. Cir. 2018)].
The claims recite steps of determining whether a chromosome interaction takes place, however this does not integrate the JE into a practical application because it is a mere data gathering step to use the correlation and does not add a meaningful limitation to the method. While claim 18 recites a method of “treating” fibrosis by administering an agent, this is a generic recitation. This generally recited element (“agent”) is considered nothing more than instructions to apply the law of nature because no particular conditions or therapies are required. As such, the “administering” step is merely a generalized “treat” limitation with no particularity that integrates the judicial exception into a practical application. The Supreme Court does acknowledge that it is possible to transform an unpatentable law of nature, but one must do more than simply state the law of nature while adding the words "apply it.” CLS BankInt’l, 134 S.Ct. at 2358; Prometheus, 132 S. Cl, at 1294.
In the absence of steps or elements that integrate the JE into a practical application, the additional elements/steps are considered to determine whether they add significantly more to the JE either individually or as an ordered combination, to “’transform the nature of the claim’ into a patent eligible application” [Mayo Collaborative Services v. Prometheus Labs., Inc., 132 S. Ct. 1289, 1293 (2012), Alice Corp. Pry. Ltd. v. CLS Bank Int'l, 134 S. Ct. 2347 (2014)] (STEP 2B).
In the instant situation, the claims recite steps of “determining” whether the chromosome interaction takes place using generically recited “probes” and/or “primers”, as well as the generic recitation of “PCR”. However, these are generally recited and do not provide any particular reagents that might be considered elements that transform the nature of the claims into a patent eligible application because no specific elements/steps are recited. These steps are not only mere data gathering step, but the general recitation of detection of nucleic acids is well understood, routine, and conventional activity (See MPEP 2106.05(d)(II)). Furthermore, claim 9, which recites general steps of crosslinking DNA is well understood, routine, and conventional in the field (see eg: US 2010/0075861). EpiSwitchTM technology was also well understood, routine, and conventional in the art as evidenced by the references in applicant’s IDS’s (see eg: Ramadass et al; Oxford Biodynamics “EpiSwitch Methodology A robust and reliable methodology for personalized medicine” 2018). In Mayo, the Court found that “[i]f a law of nature is not patentable, then neither is a process reciting a law of nature, unless that process has additional features that provide practical assurance that the process is more than a drafting effort designed to monopolize the law of nature itself." Further "conventional or obvious" "[pre]solution activity" is normally not sufficient to transform an unpatentable law of nature into a patent-eligible application of such a law”. Flook, 437 U. S., at 590; see also Bilski, 561 U. S., at ___ (slip op., at 14) (“[T]he prohibition against patenting abstract ideas ‘cannot be circumvented by’ . . . adding ‘insignificant post-solution activity’” (quoting Diehr, supra, at 191–192)). The Court also summarized their holding by stating “[t]o put the matter more succinctly, the claims inform a relevant audience about certain laws of nature; any additional steps consist of well understood, routine, conventional activity already engaged in by the scientific community; and those steps, when viewed as a whole, add nothing significant beyond the sum of their parts taken separately.” Therefore these limitations/steps do not “‘transform the nature of the claim’ into a patent-eligible application.’” Alice, 134 S. Ct. at 2355 (quoting Mayo, 132 S. Ct. at 1297).
For the reasons set forth above, when the claims are considered as a whole, the claims are not considered to recite something significantly more than a judicial exception. Accordingly, it is determined that the instant claims are not directed to patent eligible subject matter.
Claim Rejections - 35 USC § 112
112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
Claims 1-2, 5, 8-9, and 13-18 rejected under 35 U.S.C. 112(a), as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, at the time the application was filed, had possession of the claimed invention.
Relevant to the lack of particular structural limitations in the rejected claims drawn to ---, MPEP 2163 states:
The claimed invention as a whole may not be adequately described if the claims require an essential or critical feature which is not adequately described in the specification and which is not conventional in the art or known to one of ordinary skill in the art.
Additionally, at 2163IIA3(a), the MPEP states:
“…describing a composition by its function alone typically will not suffice to sufficiently describe the composition. See Eli Lilly, 119 F.3 at 1568, 43 USPQ2d at 1406 (Holding that description of a gene’s function will not enable claims to the gene “because it is only an indication of what the gene does, rather than what it is.”); see also Fiers, 984 F.2d at 1169-71, 25 USPQ2d at 1605-06 (discussing Amgen Inc. v. Chugai Pharm. Co., 927 F.2d 1200, 18 USPQ2d 1016 (Fed. Cir. 1991)). An adequate written description of a chemical invention also requires a precise definition, such as by structure, formula, chemical name, or physical properties, and not merely a wish or plan for obtaining the chemical invention claimed. See, e.g., Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 927, 69 USPQ2d 1886, 1894-95 (Fed. Cir. 2004) (The patent at issue claimed a method of selectively inhibiting PGHS-2 activity by administering a non-steroidal compound that selectively inhibits activity of the PGHS-2 gene product, however the patent did not disclose any compounds that can be used in the claimed methods. While there was a description of assays for screening compounds to identify those that inhibit the expression or activity of the PGHS-2 gene product, there was no disclosure of which peptides, polynucleotides, and small organic molecules selectively inhibit PGHS-2. The court held that “[w]ithout such disclosure, the claimed methods cannot be said to have been described.”).
The claims are broadly drawn to method of detecting and a chromosome state which represents a subgroup in a population which relates to the state [presence] of fibrosis by determining whether a chromosome interaction relating to the chromosome state is present or absent. The response of 10/8/2025 recites “ORF1 _12_117309542_11731 0883_117405729_117409691 _FF, which is the 22nd marker in table 5 and corresponds to the probe sequence ATGTAGCCCAGGCTGGTTGTCTTTTTTTTCGATCCACCCATCCACCCATCCTCCCATCCA [SEQ ID NO: 2023]. This marker corresponds to the 2nd marker of table 9”. However neither table 5 nor table 9 are set forth in the claim. Additionally, the designation of ORF1 _12_117309542_11731 0883_117405729_117409691 _FF is not clear because the specification provides no context for these numbers. It is not clear if they refer to a gene, multiple genes, a locus, a chromosome, etc. Additionally, without any context for the number system, the designation of 12_117309542_11731 0883_117405729_117409691 is completely unclear as this number system is not defined by the claim, the specification, nor does it appear to be an art accepted number system. Dependent claims also encompasses methods that detect a chromosome interaction with a probe having at least 70% identity to a probe “shown in” a table which thereby includes, with respect to the elected invention, methods using probes having 70% identity to the full length sequence of SEQ ID NO: 2023 and probes comprising a sequence having 70% identity to a fragment of SEQ ID NO: 2023. The claims also encompasses methods that detect a chromosome interaction with a primer having at least 70% identity to a primer pair “shown in” one of the tables, which thereby includes, with respect to the elected invention, methods using primer pairs having 70% identity to the full length sequence of SEQ ID NO: 2023 and primer pairs comprising a sequence having 70% identity to a fragment of SEQ ID NO: 2023. The claims also recite that the method is one carried out to select an individual for receiving therapy or treatment, select a treatment schedule, select a specific therapy, or select an agent for therapy. In view of the broad language recited in the claims, including the language that the chromosome interaction is “represented by” the probe of SEQ ID NO: 2023, the claims do not define the chromosomal interaction in terms of specific structural attributes or any other relevant identifying characteristics. The claims include interactions that may be hybridization interactions, translocation interactions, methylation interactions, and interactions that are, or which occur as a result of a mutation or polymorphism, and/or interactions in which one region of a chromosome affects another region of a chromosome, e.g., by affecting transcription or methylation events.
The specification does not provide a limiting definition for “chromosome interactions”. The specification generally describes an interaction wherein distal regions of a chromosome are juxtaposed to one another along the length of the chromosome and this interaction between the juxtaposed regions is detected using the EpiSwitchTM platform. However, the claims encompass a significantly large genus of chromosome interactions represented by SEQ ID NO; 2023 as well as the unclear designation of “12_117309542_11731 0883_117405729_117409691”, or nearby or related sequences or sequences of similar identity, as well as chromosome interactions which are detectable with a probe that has 70% identity with any sequence / fragment within SEQ ID NO: 2023 or with a primer pair that has 70% identity with any sequence / fragment within SEQ ID NO: 2023. The claims require that these chromosome interactions “relate” to “stage of fibrosis or scleroderma”, or “presence of fibrosis or scleroderma”.
Yet, the disclosure has described a limited number of epigenetic chromosomal interactions that result from two distal regions of a chromosome coming together, which epigenetic chromosomal interactions can be detected using the EpiSwitchTM assay.
With respect to the elected invention, the specification teaches detecting a chromosome interaction with the single probe consisting of SEQ ID NO: 2023. However, the specification does not disclose in terms of its complete structure or other relevant identifying characteristics a representative number of chromosomal interactions that involve the identified sequences which are correlated with fibrosis or scleroderma or whose presence is indicative of an individual who is in need of a therapeutic agent for fibrosis or scleroderma.
While the specification teaches the general methodology for performing assays to detect the ligation of distal chromosomal sequences and for performing the EpiSwitchTM assay, possession may not be shown by merely describing how to obtain possession of members of the claimed genus or how to identify their common structural features. Accordingly, a showing of how to potentially identify other chromosomal interactions indicative of fibrosis or scleroderma is not sufficient to establish that Applicants were in possession of the invention as broadly claimed.
As noted in Vas-Cath Inc. v. Mahurkar (19 USPQ2d 1111, CAFC 1991), the Federal Circuit concluded that:
"...applicant must also convey, with reasonable clarity to those skilled in art, that applicant, as of filing date sought, was in possession of invention, with invention being, for purposes of "written description" inquiry, whatever is presently claimed."
Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. 112 is severable from its enablement provision.
Thus considering the breadth of the possible chromosomal interactions required by the claimed methods, their specific required functionalities, and the teachings of the instant specification, it is the conclusion that the specification does not provide an adequate written description of the broadly claimed subject matter.
112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1-2, 5, 8-9, and 13-18 rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
The claims are indefinite because they refer to tables and are therefore incomplete. MPEP 2173.05(s) states: “Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table “is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.” Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted).”
Claim 1 is confusing because the preamble recites “a chromosome state which represents a subgroup in a population”. It is not clear if the claim is directed to detecting a nucleic acid sequence or to a subgroup in a population. Additionally, the subgroup and population are not clear because it cannot be determined if they are directed to patients or to information as to presence of a particular interaction, a stage of fibrosis, etc. Additionally, the recitation of “a chromosome interaction relating to that chromosome state” is confusing because the term “relating” does not clearly set forth the relationship between the chromosome interaction and the chromosome state. Claim 1 also recites a number of wherein clauses which appear to be mutually exclusive, and which render the metes and bounds of the claim unclear. One recites “wherein the subgroup relates to fibrosis stage” while the other recites “wherein the subgroup relates to the presence of fibrosis”. The recitation of “a chromosome interaction represented by a probe in table 1, 3…” is also indefinite because this phrase is not clearly defined in the specification or the claims and there is no art recognized definition for this phrase. It is unclear as to how a chromosome interaction is “represented by” a probe. The language of “represented by” does not make clear the relationship between the chromosome interaction and the probe. It is also unclear as to what “probe” in any of the tables is being referred to. The claim recites tables 1, 3, or 4, however the election dated 10/8/2025 recites “ORF1 _12_117309542_11731 0883_117405729_117409691 _FF, which is the 22nd marker in table 5 and corresponds to the probe sequence
ATGTAGCCCAGGCTGGTTGTCTTTTTTTTCGATCCACCCATCCACCCATCCTCCCATCCA… This marker corresponds to the 2nd marker of table 9”. However neither table 5 nor table 9 are set forth in the claim. Additionally, the designation of ORF1 _12_117309542_11731 0883_117405729_117409691 _FF is not clear because the specification provides no context for these numbers. It is not clear if they refer to a gene, multiple genes, a locus, a chromosome, etc. Additionally, without any context for the number system, the designation of 12_117309542_11731 0883_117405729_117409691 is completely unclear as this number system is not defined by the claim, the specification, nor does it appear to be an art accepted number system. The entirety of claim 1 is generally narrative and fails to conform to current US practice. Appropriate amendment of the claim is required.
The recitation of “the stage of sclerosis or the presence of sclerosis” in claim 2 lacks sufficient antecedent basis. Correction is required.
The recitation of “which is carried out to detect the whether the fibrosis…” is grammatically incorrect, rendering the metes and bounds of claim 5 further unclear. Correction is required.
The recitation of “early” and “late” in claim 5 are indefinite because they are terms of degree. It is note defined by the claim or specification.
The metes and bounds of the steps required by claim 8 are unclear. It is not clear what is required to “type” a chromosome interaction. Accordingly, it is not clear if the recitation following the colon (:) in claim 8 are steps, properties, etc. Correction is required.
In claim 8, the recitation of “two regions each corresponding to the regions of the chromosome which come together in the chromosome interaction is indefinite because in the context of the claim, it is unclear as what is encompassed by “corresponding.” For instance, it is unclear as to whether the claims require that the two regions are the regions that come together in the chromosome interaction or if they two regions may be nearby or distal regions or if the two regions may be any two regions having an unspecified level of sequence identity with regions that come together in a chromosome interaction.
The recitation of “the ligated nucleic acid” in claim 8 lacks sufficient antecedent basis.
The claims are indefinite with regard to the recitation of "preferably", which appears throughout the claims, because it is unclear whether the limitation(s) following the recitation of “preferably” are part of or required by the claimed invention. See MPEP § 2173.05(d). Correction is required.
The recitation of “wherein said determining of whether the chromosome interaction is present or absent by a process comprising the steps of” in claim 9 is grammatically incorrect. The claim does not appear to actually require any active steps. For example, it appears to be missing an action in between “absent” and “by a process”. Correction is required.
Claims 13 and 14 are indefinite as they state the process is carried out to select an individual for receiving therapy or treatment, select a treatment schedule, select a specific therapy, or select an agent for therapy. However, the claims omit any steps that are performed to accomplish the objectives of selecting an individual to receive therapy, select a treatment schedule, or select a specific therapy. The claims do not set forth how detecting the presence or absence of the chromosome interaction per se results in of these intended uses. Correction is required.
Claim 15 is indefinite because the claim does not make clear how a target is selected “based on a chromosome interaction” or what that target is. Correction is required.
The phrase “the typing or detecting” in claim 16 lacks sufficient antecedent basis. Correction is required.
Claim 16 contains the trademark/trade name HEX, TEXAS RED, and FAM. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. The claims should be amended to delete the trademarked names and to recite generic language if it has support in the specification.
The phrase “the therapeutic agent” in claim 18 lacks sufficient antecedent basis. Additionally, the claim requires treating an individual “identified as being in need” by a process according to claim 1, however claim 1 is not clearly directed to identifying an individual in need. Correction is required.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to examiner Jehanne Sitton whose telephone number is (571) 272-0752. The examiner is a hoteling examiner and can normally be reached Mondays-Fridays from 8:00 AM to 2:00 PM Eastern Time Zone.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Winston Shen, can be reached on (571) 272-3157. The fax phone number for organization where this application or proceeding is assigned is (571) 273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JEHANNE S SITTON/ Primary Examiner, Art Unit 1682
Prosecution Insights