DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
The report on patentability of the IPEA and/or ISA has been considered by the examiner.
Drawings
The drawings are objected to because the view numbers of Figures 1 and 2 are preceded by the word “Figure” instead of the abbreviation “FIG”. See 37 CFR 1.84(u)(1) states “View numbers must be preceded by the abbreviation “FIG.” Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. See Pages 31-34.
The abstract of the disclosure is objected to because the abstract appears to be over 200 words in length. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
Applicant is reminded of the proper language and format for an abstract of the disclosure.
The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details.
The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided.
Claim Objections
Claim 1 is objected to because of the following informalities: the term “miR-200b-3” should be “mir-200b-3p”, see page 28 of the as-filed specification. Appropriate correction is required. Claims 2-4 are also objected to because they depend on claim 1.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-4, 9, and 11-13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claimed method broadly reads on determining the prognosis of the survival time of a patient suffering from a cancer and treating the patient if the patient has an expression level of miR-200b-3p m6A that is inferior to 10% of the miR-200b-3p m6A predetermine reference value and/or expression of level of miR-200b-3 that is higher than the miR-200b-3 predetermined reference value with a therapeutically effective amount of N6-adenosine methylated miRNA-200b-3p.
With respect to claims 1-4, other than glioblastoma multiforme (GBM) patients, neither the specification nor the prior art disclose what is considered a predetermined reference value of either miR-200-3p m6A or miR-200-3b in a genus of cancers. The skilled artisan would have to further experiment with each species of cancer in a subject and determine if miR-200-3p is expressed and at what expression level compared to a control sample. Then, determine if the expression results in cancer and if administering miR-200-3p m6A to the subject would treat the cancer.
The art teaches that one of skill in the art has to empirically determine which cancers are embraced by the method. See page 15 of Wang et al. (Mol Cancer 2020 May 12, 19:88, pages 1-18) and Klicka et al. (Front. Oncol. 12:965231, pages 1-28, 2022). In view of Wang and Klicka, there could be a variation among species of cancer for what is considered a predetermined reference value. The reference value for miR-200b-3p or miR-200-3p m6A in GMB patients does not appear to be a representative species of the genus of cancers.
With respect to genus of samples recited in the instant claims, the specification discloses sample from GBM patients (source of the sample is not disclosed in the specification, but appears to be from GBM tumors) and contemplates and claims other types of samples (blood, serum, plasma or cancer biopsy) for use in the method. Regarding expression level of miR-200b-3p and/or miR-200-3p m6A, the skilled artisan would possess the knowledge that there is a variation amongst species of cancer (see Klicka, Table 1 and page 5). For example, the expression level in one type of cancer or even sub-species of the same cancer can vary depending on the time point or source of the sample. Page 24 of the specification discloses expression level of miR-200b-3p m6A varied between different GMB samples. GBM samples harboring low levels of FTO and alphaKG were more m6A-methylated than other GBM samples. The specification further determined that alphaKA, FTO and METTL3 collectively influence the presence of m6A in miR-200b-3p.
See also page 5 of Wang that teaches several types of miRNAs do not different significantly in cancer tissues compared to matched normal tissues. In addition, table 3 on page 8 of Wang discloses the variation role of m6A enzymes in cancer progression. Thus, GBM tumor samples cannot be considered to be a representative sample of the genus of samples.
With respect to the treatment step in claims 1-4, 9 and 11-13, pages 14-15 of the as-filed specification indicate that the term “treatment” embraces both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subjects at risk of contracting the disease or suspected to have contracted the disease as well as subjects who are ill or have diagnosed as suffering from the disease or medical condition.
The claimed method broadly embraces reducing, curing or preventing any type of cancer, other than contemplate the method, there are no method steps to complete the functional limitations of the claimed method for preventing or curing any type of cancer. There is no therapeutically effective amount disclosed in the prior art or the instant disclosure for preventing or curing cancer.
With respect to the limitation ‘therapeutically effective amount of N6-adenosine methylated miRNA-200b-3p (miR-200b-3p- m6A)’, the specification does not appear to provide written support for the limitation. The specification contemplates the limitation (paragraph 74 and instant claims), but does not describe any actual amount that would correlate to treating, curing or preventing cancer in a subject. The limitation lacks written description because there is no nexus between the amount and preventing or curing cancer.
Pages 27-28 of the specification disclose experiments where several cancer cell lines (glioblastoma, lung, breast, esophagus, and ovaries) and one murine model of GBM were transfected with an unspecified amount of m6A-miR-200b-3p. One experiment in GBM cells in xenograft mice model showed that the nucleic acid has similar efficiency to TMZ 25/mg/kg treatment (Figure 2B). The specification appears to provide written description for increasing apoptosis of GBM, lung, breast, esophagus and ovary cancer. However, the written description requirement for the claimed genus of therapeutically effective amounts in a genus of cancers is not satisfied through sufficient description of a representative number of species. An unspecific amount of m6A-miR-200b-3p in xenograft mice model and several sub-species of in vitro examples for four types of cancers does not adequately describe and considered to be representative of the entire genus of amounts that can treat, prevent or cure cancer in a subject. As show in the specification (e.g., Figure 3) and the art of record, there is a substantial variation within the genus of cancer cells having the ability to adenosine demethylate a miRNA (miR-200-3b). The specification does not describe a sufficient variety of cancers cells having the ability to adenosine demethylate miR-200-3b to reflect the variation within the genus of cancers. See Enzo Biochem., 323 F.3d at 966, 63 USPQ2d at 1615; Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004)(“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). See also MPEP §2163.
In view of the foregoing, it is clear that the instant specification fails to convey to the skilled artisan that the applicant had possession of the method in claims 1-4, 9 and 11-13 as of the effective filing date.
Claims 1-4 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for determining the prognosis of the survival time of a GBM patient and increasing apoptosis of GBM tumors in the patient comprising determining the expression level of miR-200b-3p and/or N6-adenosine methylates miR-200b-3p (miR-200b-3p m6A) in a tumor sample from said patient and treating that patient having an expression level of miR-200b-3p higher than the predetermined reference value and/or having an miR-200b-3p m6A expression level that is inferior to 10% of the miR-200b-m6a in a predetermined reference sample with miR-200b-3p m6A, does not reasonably provide enablement for an in vitro method for determining the prognosis of the survival time of a patient suffering from cancer comprising determining the level of miR-200b-3p and/or miR-200-3p- m6A in a genus of samples and administering a therapeutically effective amount of miR-200b-3p m6A to the subject. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
Claims 9 and 11-13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of increasing apoptosis of cancer in a patient comprising administering N6-adenosine methylated miRNA-200b-3p (mir-200b-3p m6A) to the patient, wherein the patient has GBM, lung, breast, esophagus or ovary cancer, does not reasonably provide enablement for treating cancer comprising administering miR-200b-3p m6A to a subject in need thereof using a therapeutically effective amount of the nucleic acid. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
Pages 14-15 of the as-filed specification indicate that the term “treatment” embraces both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subjects at risk of contracting the disease or suspected to have contracted the disease as well as subjects who are ill or have diagnosed as suffering from the disease or medical condition.
At the time of filing, there was no teaching in the prior art for preventing or curing cancer using a therapeutically effective amount of miR-200b-3p m6A to a subject.
Page 28 of the specification discloses that it is well known that one miRNA has multiple targets.
The prior art discloses that miR-200b was in involved in several types of cancers. Mir-200b could be inhibited or expressed to treat cancer depending on the type of cancer. See Klicka (supra).
Page 23 of the specification discloses that the prior art reports that miR-200b-3p play a role in GBM. The prior art identified the presence of m6A in certain miRNA such as miR-200b-3p (page 23 of the specification).
The prior art further discloses that RNA N6-methyladenosine could play a role in cancer. See Figure 3 of Wang et al. (Mol Cancer 2020 May 12, 19:88, pages 1-18). (page 14). Wang et al. teach, “A full understanding of the mechanism underlying m6A modification is distant (page 15).” Mir-17-5p, mir-21-5p and miR-200c-3p and miR-let7a-5p contain m6A methylation sites in pancreatic cancer. The presence of these miRNAs does not different significantly in cancer tissues compared to matched normal tissues (Wang, page 5). See also Ma (Hepatology 65: pages 529-543, 2017) and Cui et al (Cell Rep 18:2622-2634, 2017), which support the unpredictability of practicing the claimed method. Ma and Cui both teach that m6A role in cancer has not been well studied.
The specification does not provide a sufficient amount of working examples to enable the full scope of claimed methods. The specification contemplates the methods; provides working examples of cell death using m6A-miR-200b-3p in several cancer cell lines (Figure 3), including brain cell lines; and U87-induced GBM an xenograft mice. Figure 3 shows a variation amongst the cancer cell lines. Significant cell death was noted in U251, A549, T47D, and SKOV3.
The disclosure showed that GBM samples harboring low levels of FTO and alphaKG were more m6A-methylated than other GBM samples. The specification further determined that alphaKA, FTO and METTL3 collectively influence the presence of m6A in miR-200b-3p. Additional data from the working examples show that expression of XIPA, an apoptotic player, suggest that expression level and the N6-adenosine methylation level of miR-200-3p could affect the intrinsic apoptosis level of tumors. Figure 1B shows that GMB tumors that harbor the miR-200b-3p-low signature or the miR-200b-3pm6A>10% signature have a lower survival outcome than the other GBM patients. Adenosine methylation of miR-200b-3p abrogates its translational repressor function towards putative targets such as XIAP, Bcl-2, and PD-L1.
With respect to claims 1-4, the specification provides enablement for determining the prognosis of the survival time of a GBM patient and treating the patient comprising determining the expression level of miR-200b-3p and/or N6-adenosine methylates miR-200b-3p (miR-200b-3p m6A) in a tumor sample from said patient and treating that patient having an expression level of miR-200b-3p higher than the predetermined reference value and/or having an miR-200b-3p m6A expression level that is inferior to 10% of the miR-200b-m6a in a predetermined reference sample and treating the patient with miR-200b-3p m6A.
The specification provides enablement for determining expression level of miR-200b-3p and/or miR-200b-30 m6A in GBM samples compared to a predetermined reference value(s), but does not provide enablement for a genus of samples and/or expression level of these nucleic acids compared to a predetermined value. While one of skill in the art can determine expression level of miR-200b-3p or miR-200-3p 6A in a sample and compare it to a control (non-cancerous cell), it was unpredictable if one of skill in the art could reasonably extrapolate from GBM samples to determining the level of the nucleic acid(s) in other species of cancer, then determining a level of a control. The specification does not teach expression level of miR-200b-3p and/or miR-200-3p m6A in different types of cancer. The art of record teaches that it was unpredictable if the expression of these nucleic acids are involved in other types of cancer or if a sample would have an expression level of miR-200b-3p m6A that is inferior to 10% of miR-200-3p m6A predetermined value and/or expression level of miR-200b-3p that is higher than the miR-200b-3p predetermined value could be used to treat cancer in a subject comprising administering miR-200b-3p m6A to the subject.
With respect to the treatment step in the pending claims, the specification appears to provide enablement for using miR-200b-3p m6A to increase apoptosis in several cancer cell lines and a GBM patient. However, this does not extrapolate to using the microRNA in a subject for treating a genus of cancers because of the unpredictability of correlating from the results in the specification to the genus of cancers without an undue amount of experimentation. Pages 8-10 of Wang show the unpredictability of m6A in cancer progression. While the working examples show that miR-200b-3p targets XIAP, Bcl-2 and PD-L1, there could be other genes targeted by miR-200b-3p in vivo that could counteract or supplement the loss of expression of these three genes in the same cell (See Figure 3 of Wang and pages 541-542 of Ma).
Furthermore, the claimed method broadly embraces reducing or preventing any type of cancer, other than contemplate the method, there are no method steps to enable the claimed method for preventing or curing any type of cancer. There is no therapeutically effective amount disclose in the prior art or the instant disclosure for preventing or curing cancer.
Furthermore, other than the specification contemplating the method; providing limited working examples; the unpredictability of miR-200b and N6-methyladenosine in a genus of cancers, the specification of the instant application does not disclose how to use the full scope of the claimed invention without an undue amount of experimentation. See Genentech Inc. v. Novo Nordisk A/S (CAFC) 42 USPQ2d 1001 clearly states: "Patent protection is granted in return for an enabling disclosure of an invention, not for vague intimations of general ideas that may or may not be workable. See Brenner v. Manson, 383 U.S. 519, 536, 148 USPQ 689, 696 (1966) (stating, in context of the utility requirement, that "a patent is not a hunting license. It is not a reward for the search, but compensation for its successful conclusion.") Tossing out the mere germ of an idea does not constitute enabling disclosure. While every aspect of a generic claim certainly need not have been carried out by an inventor, or exemplified in the specification, reasonable detail must be provided in order to enable members of the public to understand and carry out the invention." Applicant cannot rely on the knowledge of one skilled in the art to supply information on the novel aspects of the claimed invention. Thus, in view of the reasons set forth above, it would take an undue amount of experimentation for one of skill in the art to practice the full scope of the claimed invention.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-4, 9 and 11-13 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The term “therapeutically effective amount” in claims 1-4, 9 and 11-13 is a relative term which renders the claim indefinite. Pages 14-15 of the as-filed specification discloses that the term “treatment” embraces both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subjects at risk of contracting the disease or suspected to have contracted the disease as well as subjects who are ill or have diagnosed as suffering from the disease or medical condition. The term “therapeutically effective amount” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The term merely states a result to be obtained without providing boundaries on the claim scope. One of ordinary skill in the art cannot determine what amount in the claims perform this step of treatment (curing or preventing) cancer using a therapeutically effective amount.
Conclusion
See attached PTO-326 for disposition of claims.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. The closest prior art appears to be Ishii (WO 2019163900, English equivalent in US 20230175066). Ishii teaches analyzing m6a in microRNA (miR-200c-5p) in cancer samples, but does not teach or suggest studying miR-200b-3p m6A and using the nucleic acid to treat cancer. In addition, the nucleotide sequence for each microRNA is different.
hsa-miR-200c-5p: CGUCUUACCCAGCAGUGUUUGG
hsa-miR-200b-5p: CAUCUUACUGGGCAGCAUUGGA
The claims recite determining the survival time of a patient having cancer comprising determining expression level of miR-200b-3p and/or N6-methylated miRNA-200-3p in sample from a patient and if the expression level is inferior to 10% of the miR-200b-3p m6A predetermined reference value and/or an expression level of miR-200b-3 is higher than the miR-200b-3 predetermined reference value and treating the patient with miR-200b-3p m6A, if they have a certain expression level. The claimed invention is directed to a statutory subject matter. The correlation and critical thinking steps (steps i) and ii)) are a law of nature and/or an abstract idea, however, the treatment step is required in the claims. The claims are considered patent eligible because administering miR-200b-3p m6A to the cancer patient integrates the judicial exception into a practical application. The claims are eligible because they recite additional limitations that when considered as a combination are unconventional steps that are more than a mere instruction to “apply” the exception using well-understood, routine or conventional techniques in the field. The microRNAs are found in nature in a human (see page 23 of the specification) and read on a product of nature, but the claims are directed to a method so product of nature does not have to be examined under the 101 guidelines. Thus, claims 1-4 are patent eligible.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636