Office Action Predictor
Application No. 18/001,342

METHODS AND COMPOSITIONS FOR EXPRESSING PHENYLALANINE HYDROXYLASE

Non-Final OA §101§102§103§112
Filed
Dec 09, 2022
Examiner
HASAN, KHALEDA B
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Sangamo Therapeutics, INC.
OA Round
1 (Non-Final)
58%
Grant Probability
Moderate
1-2
OA Rounds
2y 11m
To Grant
99%
With Interview

Examiner Intelligence

58%
Career Allow Rate
72 granted / 125 resolved
Without
With
+51.3%
Interview Lift
avg trend
2y 11m
Avg Prosecution
27 pending
152
Total Applications
career history

Statute-Specific Performance

§101
6.9%
-33.1% vs TC avg
§103
31.1%
-8.9% vs TC avg
§102
16.1%
-23.9% vs TC avg
§112
27.8%
-12.2% vs TC avg
Black line = Tech Center average estimate • Based on career data

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Applicant’s amendment filed 10/03/2023 has been entered. Claims 1-43 are cancelled. Claims 44-63 are pending and examined herein. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 45-48 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 45 recites the limitation “the construct further comprises an enhancer, wherein the enhancer comprises SEQ ID NO: 2. It is unclear whether this additional enhancer comprising SEQ ID NO: 2 can be the same as the “a first RNA transcript enhancing element” of claim 44, the “a second RNA transcript enhancer element” of claim 44, both, or neither, i.e., whether the enhancer comprising SEQ ID NO: 2 is a third enhancer. For the purposes of compact prosecution, the Office is interpreting the enhancer of claim 45 to be a third enhancer, in addition to the “a first RNA transcript enhancing element” and “a second RNA transcript enhancer element” of claim 44. Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claim 62 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). Claim 62 recites “A human cell engineered by the method of claim 61.” The specification states “In some embodiments, the mammalian cell is a human cell (e.g., in or from a human in need of reduction of plasma phenylalanine level).” (para 0019) and “The present disclosure also provides a method of treating PKU in a human patient, the method comprising administering to the patient a therapeutically effective amount of a construct as described herein, an rAAV as described herein, a composition as described herein, or a cell as described herein.” (para 0020). The broadest reasonable interpretation of the term “A cell” embraces a human cell and wherein the cell resides or is intended to reside in a human organism and therefore is otherwise inseparable the human. In view of the BRI, a human comprising the cell would be encompassed by the claimed product. Claim 53 is objected to under 37 CFR 1.75 as being a substantial duplicate of claim 52. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m). Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 44-45 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wilson et al. (US20190336550A1; published 11/7/2019; cited in attached PTO-892). Regarding claim 44, Wilson teaches methods and compositions of treating phenylketonuria (PKU) with recombinant AAV (rAAV) vectors with a regulatory elements driving the expression of codon-optimized human phenylalanine hydroxylase (PAH) (entire document). Wilson teaches an rAAV nucleic acid construct (Figure 1) comprising an expression cassette with a promoter operably linked for human phenylalanine hydroxylase (PAH) (claim 1) comprising an intron as a first RNA transcript enhancing element (claims 12-13) and WPRE as a second RNA transcript enhancing element (claim 11). Wilson further teaches that expression control elements include one or more of the following: an enhancer; a promoter; an intron; a WPRE; and a polyA signal (paras 0007, 0028, and 0054-0064). Wilson teaches that the promoter can be any one of mammalian promoters TBG promoter, TBG-S 1 promoter, A1AT promoter, LSP promoter, and TTR promoter (paras 0007 and 0060; claims 1 and 4-8). Regarding claim 45, Wilson teaches the construct further comprising an ApoE enhancer (paras 0059 and 0106; claim 1, 14, and 15) and further teaches SEQ ID NO: 7 encoding an ApoE enhancer sequence comprising 100% sequence identity to Applicant’s claimed SEQ ID NO: 2. (See alignment below. Qy is SEQ ID NO: 2 and DB is SEQ ID NO: 7). (Applicant SEQ ID NO: 2) Qy 1 AGGCTCAGAGGCACACAGGAGTTTCTGGGCTCACCCTGCCCCCTTCCAACCCCTCAGTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2 AGGCTCAGAGGCACACAGGAGTTTCTGGGCTCACCCTGCCCCCTTCCAACCCCTCAGTTC 61 Qy 61 CCATCCTCCAGCAGCTGTTTGTGTGCTGCCTCTGAAGTCCACACTGAACAAACTTCAGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 62 CCATCCTCCAGCAGCTGTTTGTGTGCTGCCTCTGAAGTCCACACTGAACAAACTTCAGCC 121 Qy 121 TACTCATGTCCCTAAAATGGGCAAACATTGCAAGCAGCAAACAGCAAACACACAGCCCTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 122 TACTCATGTCCCTAAAATGGGCAAACATTGCAAGCAGCAAACAGCAAACACACAGCCCTC 181 Qy 181 CCTGCCTGCTGACCTTGGAGCTGGGGCAGAGGTCAGAGACCTCTCTGGGCCCATGCCACC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 182 CCTGCCTGCTGACCTTGGAGCTGGGGCAGAGGTCAGAGACCTCTCTGGGCCCATGCCACC 241 Qy 241 TCCAACATCCACTCGACCCCTTGGAATTTCGGTGGAGAGGAGCAGAGGTTGTCCTGGCGT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 242 TCCAACATCCACTCGACCCCTTGGAATTTCGGTGGAGAGGAGCAGAGGTTGTCCTGGCGT 301 Qy 301 GGTTTAGGTAGTGTGAGAGGG 321 ||||||||||||||||||||| Db 302 GGTTTAGGTAGTGTGAGAGGG 322 (Wilson SEQ ID NO: 7) Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim 46 is rejected under 35 U.S.C. 103 as being unpatentable over Wilson et al. (US20190336550A1; published 11/7/2019; cited in the attached PTO-892) as applied to claims 44 and 45 above, and further in view of Kerr et al. (WO2020186150A2; published 9/17/2020, with priority to 3/13/2019 for 62/817,771). The teachings of Wilson are applied to claim 46 as they have been applied to claims 44 and 45 in the U.S.C. 102 discussion above. However, while Wilson teaches that the hPAH transgene should be controlled by liver-specific expression control elements (paras 0007 and 0060; Example 2) and that the liver cells are hepatocytes (para 0005), it does not specifically teach an AAT promoter sequence comprising SEQ ID NO: 3 (claim 46). Kerr’s disclosure is directed to expression vectors to treat PKU with expression cassettes comprising codon-optimized PAH with transcriptional regulatory elements including flanking AAV2 ITR sequences, an alpha-1 antitrypsin (AAT) promoter, and WPRE, and a BGH poly A signal (entire document, particularly paras 00270-00278). Kerr further teaches construct of SEQ ID NO: 73 comprising 100% sequence identity to the claimed SEQ ID NO: 2 encoding 321 bp ApoE enhancer with other regulatory elements. (See alignment below. Qy is SEQ ID NO: 2 and DB is SEQ ID NO: 7). (Applicant SEQ ID NO: 2) Qy 1 AGGCTCAGAGGCACACAGGAGTTTCTGGGCTCACCCTGCCCCCTTCCAACCCCTCAGTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AGGCTCAGAGGCACACAGGAGTTTCTGGGCTCACCCTGCCCCCTTCCAACCCCTCAGTTC 60 Qy 61 CCATCCTCCAGCAGCTGTTTGTGTGCTGCCTCTGAAGTCCACACTGAACAAACTTCAGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCATCCTCCAGCAGCTGTTTGTGTGCTGCCTCTGAAGTCCACACTGAACAAACTTCAGCC 120 Qy 121 TACTCATGTCCCTAAAATGGGCAAACATTGCAAGCAGCAAACAGCAAACACACAGCCCTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TACTCATGTCCCTAAAATGGGCAAACATTGCAAGCAGCAAACAGCAAACACACAGCCCTC 180 Qy 181 CCTGCCTGCTGACCTTGGAGCTGGGGCAGAGGTCAGAGACCTCTCTGGGCCCATGCCACC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CCTGCCTGCTGACCTTGGAGCTGGGGCAGAGGTCAGAGACCTCTCTGGGCCCATGCCACC 240 Qy 241 TCCAACATCCACTCGACCCCTTGGAATTTCGGTGGAGAGGAGCAGAGGTTGTCCTGGCGT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TCCAACATCCACTCGACCCCTTGGAATTTCGGTGGAGAGGAGCAGAGGTTGTCCTGGCGT 300 Qy 301 GGTTTAGGTAGTGTGAGAGGG 321 ||||||||||||||||||||| Db 301 GGTTTAGGTAGTGTGAGAGGG 321 (Kerr SEQ ID NO: 73) Regarding claim 46, Kerr teaches construct SEQ ID NO: 73 (1272bp in length) further comprising 393 bp the alpha-1 antitrypsin (AAT) promoter sequence having 100% sequence identity to Applicant’s claimed SEQ ID NO: 3. (See alignment below. Qy is SEQ ID NO: 2 and DB is SEQ ID NO: 7). (Applicant SEQ ID NO: 2) Qy 778 GATCTTGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGTGAGAGCAGAGGGCCAGCTA 837 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GATCTTGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGTGAGAGCAGAGGGCCAGCTA 60 Qy 838 AGTGGTACTCTCCCAGAGACTGTCTGACTCACGCCACCCCCTCCACCTTGGACACAGGAC 897 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 AGTGGTACTCTCCCAGAGACTGTCTGACTCACGCCACCCCCTCCACCTTGGACACAGGAC 120 Qy 898 GCTGTGGTTTCTGAGCCAGGTACAATGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTACA 957 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GCTGTGGTTTCTGAGCCAGGTACAATGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTACA 180 Qy 958 CTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGGACT 1017 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGGACT 240 Qy 1018 TAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCT 1077 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCT 300 Qy 1078 CCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCT 1137 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCT 360 Qy 1138 CAGCTTCAGGCACCACCACTGACCTGGGACAGT 1170 ||||||||||||||||||||||||||||||||| Db 361 CAGCTTCAGGCACCACCACTGACCTGGGACAGT 393 (Kerr SEQ ID NO: 73) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified Wilson’s rAAV construct comprising expression control elements of ApoE liver-specific enhancer, liver-specific AAT promoter; a beta-globin intron, WPRE element, and a bGH polyA signal with Kerr’s regulatory element sequences of SEQ ID NOs: 3 (AAT promoter) because it would have amounted to a simple substitution of a known liver-specific mammalian AAT promoter sequence for another to obtain predictable results. Wilson teaches the overall composition of the PAH-expressing construct comprising SEQ ID NO: 2 for liver-specific delivery and Kerr teaches a liver-specific PAH-expressing construct comprising Applicant’s claimed SEQ ID NOs: 2 and 3 together. One would have had a reasonable expectation of success because Wilson and Kerr teach nucleic acid constructs comprising a codon-optimized PAH sequence for liver-specific regulatory elements to treat PKU. Thus, the claimed invention as a whole is prima facie obvious. Claims 47-48 are rejected under 35 U.S.C. 103 as being unpatentable over Wilson et al. (US20190336550A1; published 11/7/2019; cited in the attached PTO-892) as applied to claims 44 and 45 above, and further in view of Kerr et al. (WO2020186150A2; published 9/17/2020, with priority to 3/13/2019 for 62/817,771) and Foo et al. (WO2020033525A1; published 2/13/2020; cited in the IDS filed 4/5/2024). The teachings of Wilson and Kerr are applied to claims 47-48 as they have been applied to claims 44 and 45 in the 35 U.S.C. 102 discussion above and to claim 46 in the 35 U.S.C. 103 discussion above. However, neither Wilson nor Kerr teach the first RNA transcript enhancing element intron comprising SEQ ID NO: 4 (claim 47) or the codon-optimized human PAH-coding sequence SEQ ID NO: 5 (claim 48). Foo teaches methods and compositions to treat mucopolysaccharidosis Type II (MPSII) by administering rAAV vectors comprising liver-specific ApoE enhancer, human AAT promoter, a chimeric HGG-IGG intron, a liver-specific promoter sequences encoding a therapeutic protein, 5’ and 3’ ITRs, and a poly A signal (entire document and Example 1). Regarding claim 47, Foo teaches SEQ ID NO: 3 encoding the HGG-IGG intron comprising 100% sequence identity to Applicant’s claimed SEQ ID NO: 4. (See paras 0012, Example 1, and alignment below. Qy is SEQ ID NO: 4 and DB is SEQ ID NO: 3). (Applicant SEQ ID NO: 4) Qy 1 GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGA 60 Qy 61 CAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCC 120 Qy 121 TTTCTCTCCACAG 133 ||||||||||||| Db 121 TTTCTCTCCACAG 133 (Foo SEQ ID NO: 3) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have arrived at the claimed invention by modifying Wilson’s rAAV construct comprising expression control elements of ApoE liver-specific enhancer, liver-specific AAT promoter; a beta-globin intron, WPRE element, and a bGH polyA signal with Kerr’s regulatory element sequences of SEQ ID NOs: 3 (AAT promoter) and with Foo’s HGG-IGG intron of SEQ ID NO: 4 because it would have amounted to a simple substitution of a known AAT promoter sequence for another and a known b-globin intron for another to obtain predictable results. Wilson teaches the overall composition of the PAH-expressing construct for liver-specific delivery, Kerr teaches a liver-specific PAH-expressing construct comprising Applicant’s claimed SEQ ID NOs: 2 and 3 together, and Foo teaches the specific SEQ ID NO: 4 used in a similar construct for liver-specific expression. The combined teachings of Wilson, Kerr, and Foo teach the tunability and flexibility of the construct for robust and tissue-specific expression. One would have had a reasonable expectation of success because Wilson, Kerr, and Foo teach vectors comprising liver-specific regulatory elements for gene therapy applications. Thus, the claimed invention as a whole is prima facie obvious. Regarding claim 48, Kerr teaches SEQ ID NO: 383 encoding codon-optimized PAH comprising 100% sequence identity to Applicant’s claimed SEQ ID NO: 5. (See alignment below. Qy is SEQ ID NO: 5 and DB is SEQ ID NO: 383). (Applicant SEQ ID NO: 5) Qy 1 ATGTCCACTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGTCCACTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG 60 Qy 61 GAAACAAGCTATATTGAAGACAACTGCAATCAAAATGGTGCCATATCACTGATCTTCTCA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GAAACAAGCTATATTGAAGACAACTGCAATCAAAATGGTGCCATATCACTGATCTTCTCA 120 Qy 121 CTCAAAGAAGAAGTTGGTGCATTGGCCAAAGTATTGCGCTTATTTGAGGAGAATGATGTA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTCAAAGAAGAAGTTGGTGCATTGGCCAAAGTATTGCGCTTATTTGAGGAGAATGATGTA 180 Qy 181 AACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTC 240 Qy 241 ACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCAT 300 Qy 301 GACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGTGCCCTGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGTGCCCTGG 360 Qy 361 TTCCCAAGAACCATTCAAGAGCTGGACAGATTTGCCAATCAGATTCTCAGCTATGGAGCG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TTCCCAAGAACCATTCAAGAGCTGGACAGATTTGCCAATCAGATTCTCAGCTATGGAGCG 420 Qy 421 GAACTGGATGCTGACCACCCTGGTTTTAAAGATCCTGTGTACCGTGCAAGACGGAAGCAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GAACTGGATGCTGACCACCCTGGTTTTAAAGATCCTGTGTACCGTGCAAGACGGAAGCAG 480 Qy 481 TTTGCTGACATTGCCTACAACTACCGCCATGGGCAGCCCATCCCTCGAGTGGAATACATG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TTTGCTGACATTGCCTACAACTACCGCCATGGGCAGCCCATCCCTCGAGTGGAATACATG 540 Qy 541 GAGGAAGAAAAGAAAACATGGGGCACAGTGTTCAAGACTCTGAAGTCCTTGTATAAAACC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GAGGAAGAAAAGAAAACATGGGGCACAGTGTTCAAGACTCTGAAGTCCTTGTATAAAACC 600 Qy 601 CATGCTTGCTATGAGTACAATCACATTTTTCCACTTCTTGAAAAGTACTGTGGCTTCCAT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 CATGCTTGCTATGAGTACAATCACATTTTTCCACTTCTTGAAAAGTACTGTGGCTTCCAT 660 Qy 661 GAAGATAACATTCCCCAGCTGGAAGACGTTTCTCAGTTCCTGCAGACTTGCACTGGTTTC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GAAGATAACATTCCCCAGCTGGAAGACGTTTCTCAGTTCCTGCAGACTTGCACTGGTTTC 720 Qy 721 CGCCTCCGACCTGTGGCTGGCCTGCTTTCCTCTCGGGATTTCTTGGGTGGCCTGGCCTTC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CGCCTCCGACCTGTGGCTGGCCTGCTTTCCTCTCGGGATTTCTTGGGTGGCCTGGCCTTC 780 Qy 781 CGAGTCTTCCACTGCACACAGTACATCAGACATGGATCCAAGCCCATGTATACCCCCGAA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 CGAGTCTTCCACTGCACACAGTACATCAGACATGGATCCAAGCCCATGTATACCCCCGAA 840 Qy 841 CCTGACATCTGCCATGAGCTGTTGGGACATGTGCCCTTGTTTTCAGATCGCAGCTTTGCC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CCTGACATCTGCCATGAGCTGTTGGGACATGTGCCCTTGTTTTCAGATCGCAGCTTTGCC 900 Qy 901 CAGTTTTCCCAGGAAATTGGCCTTGCCTCTCTGGGTGCACCTGATGAATACATTGAAAAG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CAGTTTTCCCAGGAAATTGGCCTTGCCTCTCTGGGTGCACCTGATGAATACATTGAAAAG 960 Qy 961 CTCGCCACAATTTACTGGTTTACTGTGGAGTTTGGGCTCTGCAAACAAGGAGACTCCATA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CTCGCCACAATTTACTGGTTTACTGTGGAGTTTGGGCTCTGCAAACAAGGAGACTCCATA 1020 Qy 1021 AAGGCATATGGTGCTGGGCTCCTGTCATCCTTTGGTGAATTACAGTACTGCTTATCAGAG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 AAGGCATATGGTGCTGGGCTCCTGTCATCCTTTGGTGAATTACAGTACTGCTTATCAGAG 1080 Qy 1081 AAGCCAAAGCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCACG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 AAGCCAAAGCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCACG 1140 Qy 1141 GAGTTCCAGCCCCTCTATTACGTGGCAGAGAGTTTTAATGATGCCAAGGAGAAAGTAAGG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GAGTTCCAGCCCCTCTATTACGTGGCAGAGAGTTTTAATGATGCCAAGGAGAAAGTAAGG 1200 Qy 1201 AACTTTGCTGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGACCCATACACCCAAAGG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AACTTTGCTGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGACCCATACACCCAAAGG 1260 Qy 1261 ATTGAGGTCTTGGACAATACCCAGCAGCTTAAGATTTTGGCTGATTCCATTAACAGTGAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 ATTGAGGTCTTGGACAATACCCAGCAGCTTAAGATTTTGGCTGATTCCATTAACAGTGAA 1320 Qy 1321 ATTGGAATCCTTTGCAGTGCCCTCCAGAAAATAAAGTAA 1359 ||||||||||||||||||||||||||||||||||||||| Db 1321 ATTGGAATCCTTTGCAGTGCCCTCCAGAAAATAAAGTAA 1359 (Kerr SEQ ID NO: 383) Claims 49-63 are rejected under 35 U.S.C. 103 as being unpatentable over Wilson et al. (US20190336550A1; published 11/7/2019; cited in the attached PTO-892), in view of Kerr et al. (WO2020186150A2; published 9/17/2020, with priority to 3/13/2019 for 62/817,771) and Foo et al. (WO2020033525A1; published 2/13/2020; cited in the IDS filed 4/5/2024), as applied to claims 47-48 above, and further in view of Tareen (US20160199412A1; published 7/14/2016; cited in the attached PTO-892). The teachings of Wilson, Kerr and Foo are applied to claims 49-63 as they have been applied to claims 47-48 in the U.S.C. 103 discussion above. However, the combined teachings of Wilson, Kerr and Foo do not specifically teach SEQ ID NO: 6 (claim 49), the first and second RNA transcript enhancing elements (SEQ ID NO: 2 encoding ApoE and SEQ ID NO: 6 encoding WPRE) flank the PAH-coding sequence (claim 50), the construct of claim 50 further comprising the bGH poly A signal SEQ ID NO: 7 (claim 51), the expression cassette comprises, from 5' to 3', the enhancer, the promoter, the first RNA transcript enhancing element, the PAH- coding sequence, the second RNA transcript enhancing element, and the poly A signal (claim 52), the construct comprises, from 5' to 3', SEQ ID NOs: 2, 3, 4,5, 6, and 7 (claim 53), the construct is an adeno-associated viral construct, wherein the construct comprises AAV inverted terminal repeats (ITRs),wherein the AAV ITRs are AAV2 ITRs, or the construct comprises a 5' ITR and a 3' ITR comprising SEQ ID NOs: 1 and 8, respectively (claim 54), recombinant adeno-associated virus (rAAV) comprising the construct of claim 54 (claim 55), the rAAV of claim 55 is hepatotropic (claim 56), the rAAV is produced in Sf9 insect cells (claim 57), a cell for producing the rAAV of claim 55, wherein the cell comprises a nucleotide sequence coding for capsid proteins VP1, VP2, and VP3 of the rAAV, and the construct of claim 54 (claim 58), a method of producing the rAAV of claim 55, comprising culturing the cell of claim 58 under conditions that allow packaging of the rAAV, and isolating the packaged rAAV (claim 59), a pharmaceutical composition comprising the construct of claim 54 and a pharmaceutically acceptable excipient (claim 60), a method of expressing human phenylalanine hydroxylase (PAH) protein in a mammalian cell, the method comprising introducing to the cell the construct of claim 54 (claim 61), a human cell engineered by the method of claim 61 (claim 62), method of treating phenylketonuria (PKU) in a human patient, the method comprising administering to the patient a therapeutically effective amount of the construct of claim 54 (claim 63). Tareen’s disclosure is directed to modified hepatitis post-transcriptional regulatory elements (PRE) operably linked to a nucleic acid encoding a recombinant protein and expression cassettes, viral vectors and cells containing polynucleotides and compositions and methods of their use (entire document). Tareen teaches PREs that can enhance expression of recombinant molecules operably linked thereto (paras 0003, 0069, 0075-0076, 0090-0102, and 0128; and Examples 1 and 2). Tareen further teaches delivery of polynucleotides to liver cells (paras 0234 and 0302). Regarding claim 49, Tareen teaches SEQ ID NO: 119 encoding the WPRE element comprising 100% sequence identity to Applicant’s claimed SEQ ID NO: 6. (See alignment below. Qy is SEQ ID NO: 6 and DB is SEQ ID NO:119). (Applicant SEQ ID NO: 6) Qy 1 AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCT 60 Qy 61 CCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGT 120 Qy 121 ATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTG 180 Qy 181 TGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACT 240 Qy 241 GGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCT 300 Qy 301 ATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 ATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTG 360 Qy 361 TTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTC 420 Qy 421 GCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTC 480 Qy 481 AATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 AATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTT 540 Qy 541 CGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG 592 |||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG 592 (Smith SEQ ID NO: 119) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have arrived at the claimed invention by modifying the nucleic acid construct of claim 48, as taught in the combined teachings of Wilson, Kerr, and Foo, with Tareen’s WPRE element comprising SEQ ID NO: 6 because it would have amounted to a simple substitution of a known WPRE for another to obtain predictable results. The combined teachings of Wilson, Kerr, and Foo teach rAAV constructs comprising transcription enhancing elements for expressing PAH in liver cells to treat PKU. Tareen teaches PREs that can enhance expression of recombinant molecules operably linked thereto (paras 0003, 0069, 0075-0076, 0090-0102, and 0128; and Examples 1 and 2). One would have been motivated to use include a PRE taught by Tareen into the rAAV expression construct to enhance expression of PAH in liver cells in subjects. One would have had a reasonable expectation of success because Wilson, Kerr, Foo, and Tareen teach vectors comprising regulatory elements for delivery to liver cells for gene therapy applications. Thus, the claimed invention as a whole is prima facie obvious. Regarding claim 50, Wilson teaches the first and second RNA transcript enhancing elements flank the PAH-coding sequence (Figure 1). Regarding claim 51, Kerr teaches SEQ ID NO: 68 encoding bGH promoter comprising 100% sequence identity to Applicant’s claimed SEQ ID NO: 7. (See alignment below. Qy is SEQ ID NO: 7 and DB is SEQ ID NO: 68). (Applicant SEQ ID NO: 7) Qy 1 TGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2 TGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCT 61 Qy 61 GGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 62 GGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCT 121 Qy 121 GAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 122 GAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTG 181 Qy 181 GGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG 224 |||||||||||||||||||||||||||||||||||||||||||| Db 182 GGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG 225 (Kerr SEQ ID NO: 68) Regarding claims 52-53, Wilson teaches an expression cassette comprising, from 5' to 3', the enhancer, the promoter, the first RNA transcript enhancing element, the PAH-coding sequence, the second RNA transcript enhancing element, and the polyA signal (Figure 1; paras 0007, 0028, and 0054-0064). Therefore, the combined teachings of Wilson, Kerr, Foo, and Tareen teaches the construct of claim 44, wherein the construct comprises, from 5' to 3', SEQ ID NOs: 2, 3, 4, 5, 6, and 7, as described in the 103 discussion above. Regarding claim 54, Wilson teaches rAAV vectors comprising hPAH transgene flanked by two AAV ITRs (paras 0054-0058). Wilson teaches construct SEQ ID NO: 20 comprising a 130bp 3’ AAV2 ITR sequence with 100% sequence identity to Applicant’s claimed SEQ ID NO: 1. (See alignment below. Qy is SEQ ID NOs: 1 and DB is SEQ ID NO: 20.) (Applicant SEQ ID NO: 1) Qy 1 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 60 Qy 61 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACT 120 Qy 121 AGGGGTTCCT 130 |||||||||| Db 121 AGGGGTTCCT 130 (Wilson SEQ ID NO: 20) Additionally, regarding claim 54, Foo teaches both 5’ and 3’ AAV2 ITRs in expression construct of SEQ ID NO: 30 comprising a 130bp sequence with 100% sequence identity to Applicant’s claimed SEQ ID NO: 1 and a 108bp sequence with 100% sequence identity to Applicant’s claimed SEQ ID NO: 8. (See alignment below. Qy is SEQ ID NOs: 1 and 8 and DB is SEQ ID NO: 30) (Applicant SEQ ID NO: 1) Qy 1 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 60 Qy 61 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACT 120 Qy 121 AGGGGTTCCT 130 |||||||||| Db 121 AGGGGTTCCT 130 (Foo SEQ ID NO: 30) (Applicant SEQ ID NO: 8) Qy 1 AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3088 AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG 3147 Qy 61 CCGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG 108 |||||||||||||||||||||||||||||||||||||||||||||||| Db 148 CCGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG 3195 (Foo SEQ ID NO: 30) Regarding claims 55 and 56, Wilson teaches an rAAV expression constructs and that the rAAV is hepatotropic with liver-specific expression control elements (paras 0007, 0028, and 0054-0060). Regarding claim 57, Kerr teaches producing recombinant nucleic acid constructs in Sf9 insect cells (paras 00318-00325 and 00513-00522). Regarding 58, Wilson teaches an external vector component comprising capsid proteins VP1, VP2, and VP3 of the rAAV (para 0056). Regarding claim 59, Kerr teaches comprising culturing the cells under conditions that allow packaging of the rAAV and isolating the packaged rAAV (paras 00318-00325 and 00513-00522). Regarding claim 60, Wilson teaches pharmaceutical compositions comprising the rAAV construct and a pharmaceutically acceptable excipient (para 0065-0075). Regarding claims 61-62, Wilson teaches a method of expressing human phenylalanine hydroxylase (PAH) protein in a mammalian cell, the method comprising introducing to the cell the rAAV construct, thus engineering a human cell comprising the rAAV construct (paras 0007, 00287, 0039, 0068, and 0076-0088; claims 17-21). Regarding claim 63, Wilson teaches method of treating phenylketonuria (PKU) in a human patient comprising administering to the patient a therapeutically effective amount of the rAAV construct (paras 0007, 00287, 0039, 0068, and 0076-0088; claims 17-21). Therefore the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KHALEDA B HASAN whose telephone number is (571)272-0239. The examiner can normally be reached IFP, Monday - Friday 7:30am-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KHALEDA B HASAN/Examiner, Art Unit 1636 /BRIAN WHITEMAN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Dec 09, 2022
Application Filed
Sep 29, 2025
Non-Final Rejection — §101, §102, §103
Apr 03, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology. Study what changed to get past this examiner.

Patent 12584109
ENGINEERING CELL LINES CAPABLE OF PROLIFERATION IN GROWTH FACTOR FREE MEDIA FORMULATIONS
2y 5m to grant Granted Mar 24, 2026
Patent 12540943
USE OF ACYL COENZYME A: CHOLESTEROL ACYLTRANSFERASE-1 IN DIAGNOSIS AND TREATMENT OF LIVER CANCER
2y 5m to grant Granted Feb 03, 2026
Patent 12534741
COMPOSITIONS AND METHODS FOR TREATMENT OF NEUROLOGICAL DISORDERS
2y 5m to grant Granted Jan 27, 2026
Patent 12529076
CRISPR SYSTEMS WITH ENGINEERED DUAL GUIDE NUCLEIC ACIDS
2y 5m to grant Granted Jan 20, 2026
Patent 12503710
BASE EDITING ENZYMES
2y 5m to grant Granted Dec 23, 2025

AI Strategy Recommendation

Click below to generate an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+51.3%)
2y 11m
Median Time to Grant
Low
PTA Risk
Based on 125 resolved cases by this examiner