DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-3, 18-18, 23-24, 30-31, 33, 38-40, 42, 45-46 and 52) in the reply filed on 9/26/2025 is acknowledged.
Claims 4-17, 20-22, 25-29, 32, 34-37, 41, 43-44, 47-51, 53-60, 62-63, 66-68 have been canceled, claims 61 and 64-65 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 1-3, 18-18, 23-24, 30-31, 33, 38-40, 42, 45-46 and 52 have been considered on the merits.
Information Disclosure Statement
The listing of references in the specification (e.g. paras. [0055]-[0056], [00120]-[00122], [00128], [00228]-[00229], [00271], [00280]-[00282], [00285], etc.) is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Specification
The use of several trade names or marks used in commerce have been noted in this application (para. [00263]-[00264]. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claim 1 is objected to because of the following informalities: the term “programmed cell death-1 receptor ligand (PD-L1)+-expressing hematopoietic stem cells (HSCs)” would be more appropriate as “programmed cell death-1 receptor ligand (PD-L1)-expressing hematopoietic stem cells (HSCs)” or “programmed cell death-1 receptor ligand-expressing hematopoietic stem cells (PD-L1+ HSCs)” instead as “+” and “expressing” are redundant. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 18-19, 23-24, 30-31, 33, 38-40, 42, 45-46 and 52 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The instant claims are directed to a method of treating a CNS disease or disorder involving inflammation of the CNS by administering a population of genetically engineered PD-L1 expressing HSCs.
The term “treating” is interpreted based on the definition given in the instant specification and the term does not indicate complete eradication or cure of the disease or condition (para. [0075]). The term would necessarily exclude “preventing” as the method requires a subject diagnosed with the disease or disorder.
The CNS disease or disorder involving inflammation is broad to encompass those listed in claim 2. Claim 2 discloses “inflammatory brain disease” or “inflammation of the CNS”, and these would encompass any known or unknown CNS inflammation related diseases or disorders. For example, Alzheimer’s disease and Parkinson’s disease would be included in the CNS diseases or disorders involving inflammation as neuroinflammation is a crucial factor for these diseases (Kinney et al. 2018, Alzheimer’s & Dementia; Qian et al. 2010, J. Neural Transm.).
The instant specification fails to provide sufficient written description for the entire genus of CNS disease or disorder involving inflammation as the specification only discloses an animal model of MS (myelin oligodendrocyte glycoprotein (MOG) experimental autoimmune encephalitis (EAE) animal model (MOG-EAE)). The example utilizing MOG-EAE resulted in reduction of severity of the disease and decreased neuroinflammation in the MOG-EAE (Example 2). However, there is no additional disclosure if the PD-L1 expressing HSCs would be able to produce therapeutically effective outcome in treating any other CNS diseases or disorder involving inflammation.
There is no other example or working embodiment to disclose that the claimed method would produce the comparable outcome in any other CNS disease or disorder involving inflammation not only those listed in claim 2 but others including Alzheimer’s disease and/or Parkinson’s disease. Thus, the instant specification fails to provide sufficient written description to show that the inventors had possession on the entire scope of the genus as claimed.
M.P.E.P. §2163 states “To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. See, e.g., Moba, B.V. v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116.”
M.P.E.P. § 2163 also recites, “An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations using such descriptive means as words, structures, figures, diagrams, and formulas that fully set forth the claimed invention… one must define a compound by ‘whatever characteristics sufficiently distinguish it’. A lack of adequate written description issue also arises if the knowledge and level of skill in the art would not permit one skilled in the art to immediately envisage the product claimed from the disclosed process.” and further, “The description needed to satisfy the requirements of 35 U.S.C. 112 "varies with the nature and scope of the invention at issue, and with the scientific and technologic knowledge already in existence." Capon v. Eshhar, 418 F.3d at 1357, 76 USPQ2d at 1084.< Patents and printed publications in the art should be relied upon to determine whether an art is mature and what the level of knowledge and skill is in the art. In most technologies which are mature, and wherein the knowledge and level of skill in the art is high, a written description question should not be raised for claims >present in the application when originally filed,< even if the specification discloses only a method of making the invention and the function of the invention. See, e.g., In re Hayes Microcomputer Products, Inc. Patent Litigation, 982 F.2d 1527, 1534-35, 25 USPQ2d 1241, 1246 (Fed. Cir. 1992) ("One skilled in the art would know how to program a microprocessor to perform the necessary steps described in the specification. Thus, an inventor is not required to describe every detail of his invention. An applicant's disclosure obligation varies according to the art to which the invention pertains. Disclosing a microprocessor capable of performing certain functions is sufficient to satisfy the requirement of section 112, first paragraph, when one skilled in the relevant art would understand what is intended and know how to carry it out."). In contrast, for inventions in emerging and unpredictable technologies, or for inventions characterized by factors not reasonably predictable which are known to one of ordinary skill in the art, more evidence is required to show possession.”
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 40 and 45 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 40 discloses “the method” in the wherein clause. It is not clear what “method” this term intends to point out. Claim 40 is dependent on claim 39 which is dependent on claim 1. Claims 1 and 39 are directed to the method of treating the CNS disease or disorder, however, claim 39 also discloses a method comprising steps (a)-(c) to produce the PD-L1-expressing HSCs. It is unclear which method the wherein clause intends to claim. Clarification is required.
Claim 45 discloses “the progression of MS”, and claim 45 is dependent on claim 1. Claim 1 does not disclose any “progression of MS”, and thus, there is no antecedent basis for the term. Clarification is required.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1-3, 18-19, 23-24, 30-31, 33, 38-40, 45-46 and 52 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Fiorina (US20180214487; IDS ref.)
Fiorina teaches a method of treating autoimmune disease or disorder by administering hematopoietic stem cells (HSCs) engineered to express programmed cell death-1 ligand (PD-L1) (Abstract; para. 10). Fiorina teaches the HSCs are isolated from a host subject, transfected with a vector, cultured, and transplanted back into the same host, i.e. autologous cell transplant, or from a donor who is an HLA-type match with a host (recipient) who is diagnosed with an autoimmune disease or disorder (para. 327). The autoimmune disease or disorder taught by Fiorina includes multiple sclerosis, systemic lupus erythematosus, CNS vasculitis (para. 328).
Regarding claim 18, Fiorina teaches that HSCs are transfected or transduced ex vivo with viral vectors carrying an exogenous copy of a nucleic acid encoding a PD-L1 (para. 372).
Regarding claim 19 directed to the nucleic acid encoding PD-L1 having a sequence of SEQ ID NO:1, Fiorina teaches the sequence of human PD-L1 isoform b precursor (variant 2) (SEQ ID NO:1) (para. 236). The SEQ ID NO:1 of Fiorina (15/745,553) is 100% identical to the claimed SEQ ID NO:1 (see alignment below).
Title: US-18-002-633-1
Perfect score: 531
Sequence: 1 atgaggatatttgctgtctt..........cacatttggaggagacgtaa 531
Scoring table: IDENTITY_NUC
Gapop 10.0 , Gapext 1.0
Searched: 1 seqs, 531 residues
Total number of hits satisfying chosen parameters: 2
Minimum DB seq length: 0
Maximum DB seq length: inf
Post-processing: Minimum Match 0%
Maximum Match 100%
Listing first 2 summaries
Database : US-15-745-553-1.seq:*
SUMMARIES
%
Result Query
No. Score Match Length DB ID Description
----------------------------------------------------------------------------
1 531 100.0 531 1 US-15-745-553-1 PD-L1 EXPRESSING H
c 2 24.6 4.6 531 1 US-15-745-553-1 PD-L1 EXPRESSING H
ALIGNMENTS
RESULT 1
US-15-745-553-1
Query Match 100.0%; Score 531; DB 1; Length 531;
Best Local Similarity 100.0%;
Matches 531; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCCCCATAC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCCCCATAC 60
Qy 61 AACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 AACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACA 120
Qy 121 TGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 TGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTC 180
Qy 181 CTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 CTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACC 240
Qy 241 AGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 AGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTA 300
Qy 301 GATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 GATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCT 360
Qy 361 CCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 CCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCA 420
Qy 421 CTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 CTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATC 480
Qy 481 CAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA 531
|||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 CAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA 531
Regarding claims 23-24, Fiorina teaches that the nucleic acid encoding PD-L1 is integrated into the genome of the HSC cells (para. 243), and lentiviral vectors are used for expressing PD-L1 in HSCs (para. 246-247).
Regarding claim 30, Fiorina teaches that the HSCs are derived from bone marrow, peripheral blood, or umbilical cord blood (para. 253 and 258).
Regarding claim 31 directed to the HSCs being cultured ex vivo before, after or both before and after the introduction of the exogenous copy of the nucleic acid encoding PD-L1, Fiorina teaches that the isolated or collected HSCs are ex vivo cultured before and/or after the introduction of the exogenous copy of a nucleic acid encoding a PD-L1 (para. 283).
Regarding claim 33, Fiorina teaches that the HSCs are derived from an individual with a diagnosed disease or disorder (para. 36, 39, 327 and 408).
Regarding claim 38, Fiorina teaches that the HSCs are autologous (para. 333 and 433) or non-autologous (i.e. allogeneic) or xenogeneic (para. 334-335 and 435).
Regarding claim 39 directed to the wherein clause directed to the method steps of how to produce the HSCs, this wherein clause is considered as a product-by-process limitation and the method steps are not considered active required by the claimed method of treating a CNS disease or disorder. Therefore, the wherein clause is not limiting the method of treating of claim 1.
Regardless, Fiorina teaches the method of (a) providing a population of HSCs; (b) contacting sample of HSCs with a vector carrying an exogenous copy of a nucleic acid encoding a PD-L1 ; (c) ex vivo culturing the resultant modified cells from the contacting; (d) establishing the expression of PD-L1 on the modified HSCs, thereby producing a population of modified HSCs cells (para. 437).
Regarding claim 40 directed to the method further comprising establishing the population of modified HSCs expressing at least 1-fold, 2-fold, 3-fold, 4-fold , 5-fold or more percent increase in the number of PD-L1 expressing HSCs compared to unmodified HSCs, Fiorina teaches that the modified HSCs carrying an exogenous copy of a nucleic acid encoding PD-L1 have at least 1-fold increase in the number of PD-L1 expressing HSCs compared to non-modified cells (para. 24; p.41, claim 21).
Regarding claims 45-46 directed to the administering reducing, delaying or stopping the progression of MS or reducing or eliminating inflammation of the CNS, the wherein clause is directed to the result of the claimed method that does not require any addition active step to be carried out. Thus, the method steps taught by Fiorina would inherently carry out the same result as claimed because the method steps taught by Fiorina are identical to the claimed method.
Regarding claim 52, Fiorina teaches the steps (a)-(d) of establishing expression of PD-L1 and producing the population of PD-L1 expressing HSCs. Regarding step (d) directed to the transplanting, as discussed above, Fiorina teaches a step of administering hematopoietic stem cells (HSCs) engineered to express programmed cell death-1 ligand (PD-L1) and Fiorina also teaches that the composition of HSCs expressing PD-L1 is transplanted into a subject to treat an autoimmune disease or disorder (para. 22).
Thus, the reference anticipates the claimed invention.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-3, 18-19, 23-24, 30-31, 33, 38-40, 42, 45-46 and 52 is/are rejected under 35 U.S.C. 103 as being unpatentable over Fiorina (supra) as applied to claim 1 as above in view of Fiorina (WO2019/060708; Fiorina2019 herein after; IDS ref.).
Fiorina teaches the subject matter of claims 1-3, 18-19, 23-24, 30-31, 33, 38-40, 45-46 and 52, and thus, render them obvious (see above).
Regarding claim 42 directed to the intrathecal administration, Fiorina does not particularly teach the intrathecal administration of the modified HSCs.
Fiorina2019 teach a method of treating autoimmune diseases or disorders by administering hematopoietic stem cells that have been modulated for the expression microRNA that controls the expression of PD-L1 (Abstract), and the autoimmune diseases or disorders include multiple sclerosis (MS) (para. 146). Fiorina2019 teach that the HSCs modulated for expression of microRNA that controls the expression of PD-L1, modified HSCs, are administered intrathecally (para. 167).
It would have been obvious to a person skilled in the art to use the intrathecal delivery of the modified HSCs expressing PD-L1 taught by Fiorina2019 for the method of Fiorina with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because Fiorina2019 teaches the HSCs expressing PD-L1 for treating autoimmune diseases including multiple sclerosis by administering the modified HSCs intrathecally, and the method of Fiorina is substantially similar in terms of administering HSCs modified to express PD-L1 to treat MS. Thus, one skilled in the art would recognize that intrathecal administration of HSCs expressing PD-L1 would be one of suitable delivery routes for the method of Fiorina.
Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-3, 18-19, 23-24, 30-31, 33, 38-40, 42, 45-46 and 52 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13 of U.S. Patent No. 11,642,378 in view of Fiorina (supra) and Fiorina2019 (supra). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘378 patent disclose the method of producing a population of modified, PD-L1 expressing HSCs identical to the steps disclosed in the instant claims (steps (a)-(c) of claims 39 and steps (b)-(d) of claim 52). While the claims of the ‘378 patent do not particularly disclose that the method involves administering the modified HSCs expressing PD-L1, however, the claims of the ‘378 patent disclose that the HSCs are derived from the individual with a diagnosed with autoimmune disease or disorder and thus, it would have been obvious to a person skilled in the art to use the modified HSCs as an autologous HSC transplantation to treat the autoimmune disease or disorder. Furthermore, it is known in the art that PD-L1 expressing HSCs are utilized to treat autoimmune disease including MS according to Fiorina (Abstract; para. 10). Thus, it would have been obvious to utilize the modified HSCs expressing PD-L1 produced by the method of ‘378 patent in treating autoimmune disease or disorder including MS.
The claims of the ‘378 patent disclose a vector carrying an exogenous copy of a nucleic acid encoding a PD-L1, the modified cells having at least one fold increase in the number of PD-L1 expressing cells compared to non-modified cells, the source of HSCs (bone marrow, umbilical cord, etc. and an individual with a diagnosed disease or disorder); a viral vector including a lentiviral vector, and the nucleic acid integrated into the genome of the HSCs.
Regarding the HSCs being autologous, allogeneic or xenogeneic, while the claims of the ‘378 patent do not particularly disclose the limitation, however, according to Fiorina, HSCs can be autologous, allogeneic or xenogeneic (paras. 333-335).
Regarding the PD-L1 encoding nucleic acid being cDNA and having a sequence of SEQ ID NO:1, the claims of the ‘378 patent do not teach the SEQ ID NO:1. However, Fiorina teach the SEQ ID NO:1 for human PD-L1 which is identical to the claimed SEQ ID NO:1 as discussed above (see alignment). Thus, it would have been obvious to a person skilled in the art to use the SEQ ID NO:1 of Fiorina for the nucleic acid encoding PD-L1 of the ‘378 patent with a reasonable expectation of success.
Regarding intrathecal administration, the claims of the ‘378 patent do not teach the limitation. However, Fiorina2019 teach the administration of PD-L1 expressing HSCs via intrathecal delivery (para. 167) for the purpose of treating autoimmune disease. Thus, it would have been obvious to a person skilled in the art to administer the modified HSCs of the ‘378 patent in order to treat MS as taught by Fiorina by administering intrathecally as taught by Fiorina2019 with a reasonable expectation of success.
Regarding the ex vivo culturing before and/or after the introduction of the exogenous copy of a nucleic acid encoding PD-L1, while the claims of ‘378 patent do not teach the limitation, however, Fiorina teaches that the modified HSCs are ex vivo cultured before or after or both before and after the introduction of the exogenous copy of a nucleic acid encoding a PD-L1 (para. 411).
Regarding the limitations directed to the results of the method treating MS or CNS disease or disorder involving inflammation, the combined teachings of the ‘378 patent in view of Fiorina and Fiorina2019 would meet the method steps identical to the instant application, and thus, the results would be expected identical.
Thus, the claims of the ‘378 patent in view of Fiorina and Fiorina2019 render the claims of the instant application obvious.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TAEYOON KIM/ Primary Examiner, Art Unit 1631