DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s amendment and response filed on 4/7/2026 has been received and entered into the case.
Claims 2-17, 20-22, 25-29, 32, 34-37, 41-44, 47-51, 53-60, 62-63 and 66-68 have been canceled, claims 61 and 64-65 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 1, 18-19, 23-24, 30-31, 33, 38-40, 45-46 and 52 have been considered on the merits. All arguments have been considered.
The claim rejection under 35 USC 35 U.S.C. 112(a) has been withdrawn due to the instant amendment.
The claim rejection under 35 USC 102 based on Fiona has been withdrawn due to the instant amendment. However, the new limitation in claim 1 directed to “intrathecal administration” has been addressed in claim 42, now canceled, and the 103 rejection would be modified and maintained.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-3, 18-19, 23-24, 30-31, 33, 38-40, 45-46 and 52 is/are rejected under 35 U.S.C. 103 as being unpatentable over Fiorina (US20180214487; IDS ref.) in view of Fiorina (WO2019/060708; Fiorina2019 herein after; IDS ref.).
Fiorina teaches a method of treating autoimmune disease or disorder by administering hematopoietic stem cells (HSCs) engineered to express programmed cell death-1 ligand (PD-L1) (Abstract; para. 10). Fiorina teaches the HSCs are isolated from a host subject, transfected with a vector, cultured, and transplanted back into the same host, i.e. autologous cell transplant, or from a donor who is an HLA-type match with a host (recipient) who is diagnosed with an autoimmune disease or disorder (para. 327). The autoimmune disease or disorder taught by Fiorina includes multiple sclerosis, systemic lupus erythematosus, CNS vasculitis (para. 328).
Regarding claim 1 directed to the intrathecal administration, Fiorina does not particularly teach the intrathecal administration of the modified HSCs.
Fiorina2019 teach a method of treating autoimmune diseases or disorders by administering hematopoietic stem cells that have been modulated for the expression microRNA that controls the expression of PD-L1 (Abstract), and the autoimmune diseases or disorders include multiple sclerosis (MS) (para. 146). Fiorina2019 teach that the HSCs modulated for expression of microRNA that controls the expression of PD-L1, modified HSCs, are administered intrathecally (para. 167).
It would have been obvious to a person skilled in the art to use the intrathecal delivery of the modified HSCs expressing PD-L1 taught by Fiorina2019 for the method of Fiorina with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because Fiorina2019 teaches the HSCs expressing PD-L1 for treating autoimmune diseases including multiple sclerosis by administering the modified HSCs intrathecally, and the method of Fiorina is substantially similar in terms of administering HSCs modified to express PD-L1 to treat MS. Thus, one skilled in the art would recognize that intrathecal administration of HSCs expressing PD-L1 would be one of suitable delivery routes for the method of Fiorina.
Regarding claim 18, Fiorina teaches that HSCs are transfected or transduced ex vivo with viral vectors carrying an exogenous copy of a nucleic acid encoding a PD-L1 (para. 372).
Regarding claim 19 directed to the nucleic acid encoding PD-L1 having a sequence of SEQ ID NO:1, Fiorina teaches the sequence of human PD-L1 isoform b precursor (variant 2) (SEQ ID NO:1) (para. 236). The SEQ ID NO:1 of Fiorina (15/745,553) is 100% identical to the claimed SEQ ID NO:1 (see alignment below).
Title: US-18-002-633-1
Perfect score: 531
Sequence: 1 atgaggatatttgctgtctt..........cacatttggaggagacgtaa 531
Scoring table: IDENTITY_NUC
Gapop 10.0 , Gapext 1.0
Searched: 1 seqs, 531 residues
Total number of hits satisfying chosen parameters: 2
Minimum DB seq length: 0
Maximum DB seq length: inf
Post-processing: Minimum Match 0%
Maximum Match 100%
Listing first 2 summaries
Database : US-15-745-553-1.seq:*
SUMMARIES
%
Result Query
No. Score Match Length DB ID Description
----------------------------------------------------------------------------
1 531 100.0 531 1 US-15-745-553-1 PD-L1 EXPRESSING H
c 2 24.6 4.6 531 1 US-15-745-553-1 PD-L1 EXPRESSING H
ALIGNMENTS
RESULT 1
US-15-745-553-1
Query Match 100.0%; Score 531; DB 1; Length 531;
Best Local Similarity 100.0%;
Matches 531; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCCCCATAC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCCCCATAC 60
Qy 61 AACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 AACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACA 120
Qy 121 TGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 TGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTC 180
Qy 181 CTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 CTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACC 240
Qy 241 AGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 AGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTA 300
Qy 301 GATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 GATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCT 360
Qy 361 CCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 CCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCA 420
Qy 421 CTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 CTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATC 480
Qy 481 CAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA 531
|||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 CAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA 531
Regarding claims 23-24, Fiorina teaches that the nucleic acid encoding PD-L1 is integrated into the genome of the HSC cells (para. 243), and lentiviral vectors are used for expressing PD-L1 in HSCs (para. 246-247).
Regarding claim 30, Fiorina teaches that the HSCs are derived from bone marrow, peripheral blood, or umbilical cord blood (para. 253 and 258).
Regarding claim 31 directed to the HSCs being cultured ex vivo before, after or both before and after the introduction of the exogenous copy of the nucleic acid encoding PD-L1, Fiorina teaches that the isolated or collected HSCs are ex vivo cultured before and/or after the introduction of the exogenous copy of a nucleic acid encoding a PD-L1 (para. 283).
Regarding claim 33, Fiorina teaches that the HSCs are derived from an individual with a diagnosed disease or disorder (para. 36, 39, 327 and 408).
Regarding claim 38, Fiorina teaches that the HSCs are autologous (para. 333 and 433) or non-autologous (i.e. allogeneic) or xenogeneic (para. 334-335 and 435).
Regarding claim 39 directed to the wherein clause directed to the method steps of how to produce the HSCs, this wherein clause is considered as a product-by-process limitation and the method steps are not considered active required by the claimed method of treating a CNS disease or disorder. Therefore, the wherein clause is not limiting the method of treating of claim 1.
Regardless, Fiorina teaches the method of (a) providing a population of HSCs; (b) contacting sample of HSCs with a vector carrying an exogenous copy of a nucleic acid encoding a PD-L1; (c) ex vivo culturing the resultant modified cells from the contacting; (d) establishing the expression of PD-L1 on the modified HSCs, thereby producing a population of modified HSCs cells (para. 437).
Regarding claim 40 directed to the method further comprising establishing the population of modified HSCs expressing at least 1-fold, 2-fold, 3-fold, 4-fold , 5-fold or more percent increase in the number of PD-L1 expressing HSCs compared to unmodified HSCs, Fiorina teaches that the modified HSCs carrying an exogenous copy of a nucleic acid encoding PD-L1 have at least 1-fold increase in the number of PD-L1 expressing HSCs compared to non-modified cells (para. 24; p.41, claim 21).
Regarding claims 45-46 directed to the administering reducing, delaying or stopping the progression of MS or reducing or eliminating inflammation of the CNS, the wherein clause is directed to the result of the claimed method that does not require any addition active step to be carried out. Thus, the method steps taught by Fiorina would inherently carry out the same result as claimed because the method steps taught by Fiorina are identical to the claimed method.
Regarding claim 52, Fiorina teaches the steps (a)-(d) of establishing expression of PD-L1 and producing the population of PD-L1 expressing HSCs. Regarding step (e) directed to the transplanting, as discussed above, Fiorina teaches a step of administering hematopoietic stem cells (HSCs) engineered to express programmed cell death-1 ligand (PD-L1) and Fiorina also teaches that the composition of HSCs expressing PD-L1 is transplanted into a subject to treat an autoimmune disease or disorder (para. 22). As MS is considered as one of autoimmune disease or disorder and intrathecal administration is taught by Fiona2019, the combined teachings of Fiona and Fiona2019 would meet the step (e) of transplanting PD-L1 expressing HSCs into a recipient subject via intrathecal administration.
Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-3, 18-19, 23-24, 30-31, 33, 38-40, 45-46 and 52 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13 of U.S. Patent No. 11,642,378 in view of Fiorina (supra) and Fiorina2019 (supra). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘378 patent disclose the method of producing a population of modified, PD-L1 expressing HSCs identical to the steps disclosed in the instant claims (steps (a)-(c) of claims 39 and steps (b)-(d) of claim 52). While the claims of the ‘378 patent do not particularly disclose that the method involves administering the modified HSCs expressing PD-L1, however, the claims of the ‘378 patent disclose that the HSCs are derived from the individual with a diagnosed with autoimmune disease or disorder and thus, it would have been obvious to a person skilled in the art to use the modified HSCs as an autologous HSC transplantation to treat the autoimmune disease or disorder. Furthermore, it is known in the art that PD-L1 expressing HSCs are utilized to treat autoimmune disease including MS according to Fiorina (Abstract; para. 10). Thus, it would have been obvious to utilize the modified HSCs expressing PD-L1 produced by the method of ‘378 patent in treating autoimmune disease or disorder including MS.
The claims of the ‘378 patent disclose a vector carrying an exogenous copy of a nucleic acid encoding a PD-L1, the modified cells having at least one fold increase in the number of PD-L1 expressing cells compared to non-modified cells, the source of HSCs (bone marrow, umbilical cord, etc. and an individual with a diagnosed disease or disorder); a viral vector including a lentiviral vector, and the nucleic acid integrated into the genome of the HSCs.
Regarding the HSCs being autologous, allogeneic or xenogeneic, while the claims of the ‘378 patent do not particularly disclose the limitation, however, according to Fiorina, HSCs can be autologous, allogeneic or xenogeneic (paras. 333-335).
Regarding the PD-L1 encoding nucleic acid being cDNA and having a sequence of SEQ ID NO:1, the claims of the ‘378 patent do not teach the SEQ ID NO:1. However, Fiorina teach the SEQ ID NO:1 for human PD-L1 which is identical to the claimed SEQ ID NO:1 as discussed above (see alignment). Thus, it would have been obvious to a person skilled in the art to use the SEQ ID NO:1 of Fiorina for the nucleic acid encoding PD-L1 of the ‘378 patent with a reasonable expectation of success.
Regarding intrathecal administration in claim 1, the claims of the ‘378 patent do not teach the limitation. However, Fiorina2019 teach the administration of PD-L1 expressing HSCs via intrathecal delivery (para. 167) for the purpose of treating autoimmune disease. Thus, it would have been obvious to a person skilled in the art to administer the modified HSCs of the ‘378 patent in order to treat MS as taught by Fiorina by administering intrathecally as taught by Fiorina2019 with a reasonable expectation of success.
Regarding the ex vivo culturing before and/or after the introduction of the exogenous copy of a nucleic acid encoding PD-L1, while the claims of ‘378 patent do not teach the limitation, however, Fiorina teaches that the modified HSCs are ex vivo cultured before or after or both before and after the introduction of the exogenous copy of a nucleic acid encoding a PD-L1 (para. 411).
Regarding the limitations directed to the results of the method treating MS or CNS disease or disorder involving inflammation, the combined teachings of the ‘378 patent in view of Fiorina and Fiorina2019 would meet the method steps identical to the instant application, and thus, the results would be expected identical.
Thus, the claims of the ‘378 patent in view of Fiorina and Fiorina2019 render the claims of the instant application obvious.
Response to Arguments
Applicant’s arguments with respect to 35 U.S.C. 112(a) and 112(b) have been fully considered and are persuasive. The claim rejections under 112 have been withdrawn.
Regarding the 102 rejection, as indicated above, the instant amendment overcame the rejection and it has been withdrawn.
Regarding the 103 rejection, the rejection has been modified as the limitation of claim 42 has been incorporated into claim 1.
Applicant argued that ‘708 (Fiona2019) merely discloses intrathecal administration as one of many possible routes of administration for any of the uses disclosed in the application, and thus, a skilled person would not have any motivation to combined the teachings of ‘487 (Fiona) and ‘708 to arrive at the claims as amended. The Examiner respectfully disagrees with this argument. As ‘708 clearly and positively discloses the intrathecal administration as one of possible routes, this provides a motivation to use the intrathecal route for administering the PD-L1 expressing cells for treating autoimmune diseases including MS with a reasonable expectation of success.
Applicant asserted that there is no prediction or expectation in view of the art that the intrathecal administration of PD-L1-expressing HSCs results in superior efficacy in treating MS. As discussed above, the positive disclosure of intrathecal route as for treating autoimmune disease or disorder which includes MS would provide a reasonable expectation of success in treating MS. With regard to the alleged “superior” efficacy, there is no clear evidence whether the intrathecal administration indeed provides “superior” efficacy except a mere statement in the paragraph [0432] as pointed out by applicant. While the statement might indicate that there is unexpected results using the intrathecal administration, however, the statement of para [0432] and Fig. 16 does not clearly show the stated “even greater therapeutic effect” to conclude that there is any significant, e.g. statistically significant, improvement for intrathecal administration over other routes, e.g. intravenous. Applicant is advised to provide clear evidence to support that the therapeutic efficacy via an intrathecal route provides unexpected and superior results in order to overcome the pending claim rejection.
Regarding the double patenting rejection, applicant requested that the rejection be held in abeyance until allowable subject matter is identified. As there is no allowable subject matter identified, the holding of the double patenting rejection is a must.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TAEYOON KIM/Primary Examiner, Art Unit 1631