DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s amendment filed on 02/17/2026 has been entered.
Amended claims 1, 6-7, 10-12, 14, 16-21 and 24 are pending in the present application.
Applicant elected previously without traverse of Group I, which is drawn to a composition comprising, as an active ingredient, a nucleic acid molecule that inhibits expression of type II HLA protein.
Applicant also elected previously the following species: (i) a gRNA which specifically recognizes a nucleotide sequence encoding an activating protein of the type II HLA protein; (ii) SEQ ID NO: 44; (iii) further comprising a nucleic acid molecule encoding a type I HLA protein; (iv) MAD7 is the RNA-guided endonuclease; and (v) immune cells.
Claims 16-21 and 24 were withdrawn previously from further consideration because they are directed to non-elected inventions. Additionally, claim 6 was also withdrawn from further consideration because it is directed to a non-elected species.
Accordingly, amended claims 1, 10-12 and 14 are examined on the merits herein with the above elected species.
Response to Amendment
1. The rejection under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, for Lack of Written Description was withdrawn in light of currently amended independent claim 1, particularly with the new limitation “wherein the first gRNA comprises a guide sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 44”.
2. The rejection under 35 U.S.C. 102(a)(1) as being anticipated by Meissner et al (WO 2016/183041) was withdrawn in light of currently amended independent claim 1, particularly with the new limitation “wherein the first gRNA comprises a guide sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 44”.
3. The rejection under 35 U.S.C. 102(a)(2) as being anticipated by Harrington et al (WO 2021/247924) was also withdrawn for the above same reason.
4. The rejection under 35 U.S.C. 103 as being unpatentable over Meissner et al (WO 2016/183041) in view of Norville et al (US 11,826,385) and Staudt et al (US 10,607,717) was also withdrawn for the above same reason.
Priority
This application is a 371 of PCT/KR2021/008554, filed on 07/06/2021, which claims priority of the foreign application KR 10-2020-0082748, filed on 07/06/2020.
It is noted that Applicant has not provided an English translation of the above foreign priority application.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Amended claim 10 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
In amended claim 10, it is unclear what is encompassed by the limitation “Cpf1 (CRISPR from Prevotella and Francisella 1)”. It is unclear whether CRISPR from Prevotella and Francisella 1 are representative or preferred members of Cpf1; or Applicant intend to claim only CRISPR Cpf1 from Prevotella and Francisella 1. Clarification is requested because the metes and bounds of the claim are not clearly determined.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 10 and 14 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Barghetti et al (US 12,319,932). This is a new ground of rejection necessitated by Applicant’s amendment.
The instant claims are drawn to a composition comprising, as an active ingredient: (a) a first guide RNA (gRNA) which specifically recognizes a nucleotide sequence encoding a class II major histocompatibility complex transactivator (CIITA) protein, or a polynucleotide encoding the first gRNA; and (b) an RNA-guided endonuclease (e.g., Cas9, Cpf1, or MAD7), or a polynucleotide encoding the RNA-guided endonuclease, wherein the first gRNA comprises a guide sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 44 (5’-TGCCCAACTTCTGCTGGCATC-3’).
Barghetti et al already disclosed a composition comprising a synthetic guide RNA (gRNA) and a CRISPR Cas protein, wherein the synthetic gRNA comprising the spacer sequence of SEQ ID NO: 645 that is 100% identical to SEQ ID NO: 44 of the present application to target human CIITA gene, and wherein the CRISPR Cas protein includes Cpf1 and MAD7; and a CRISPR expression system comprising nucleic acids encoding the above same components (Abstract; Summary of the Invention; particularly col. 1, line 61 continues to line 26 at col. 2; col. 5, lines 3-16 and lines 31-42; col. 46, lines 16-29; Table 2 at col. 47; Table 7 at col. 72; col 91, lines 58-60; col. 147, lines 22-37; col. 154, lines 35-67; and attached sequence search below). Barghetti et al also disclosed an immune cell such as a human T cell comprising the above same composition (col. 5, lines 16-21; col. 151, line 45 continues to line 23 at col. 152). With respect to claim 14, since the composition of Barghetti et al is identical to the composition as claimed, such composition inherently inhibits immunogenicity of stem cells or immune cells.
Accordingly, the teachings of Barghetti et al meet every limitation of the instant claims. Therefore, the reference anticipates the instant claims.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Amended claims 1, 10-12 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Meissner et al (WO 2016/183041) in view of Norville et al (US 11,826,385) and Staudt et al (US 10,607,717). This is a modified rejection necessitated by Applicant’s amendment.
The instant claims are drawn to a composition comprising, as an active ingredient: (a) a first guide RNA (gRNA) which specifically recognizes a nucleotide sequence encoding a class II major histocompatibility complex transactivator (CIITA) protein, or a polynucleotide encoding the first gRNA; and (b) an RNA-guided endonuclease (e.g., Cas9, Cpf1, or MAD7), or a polynucleotide encoding the RNA-guided endonuclease, wherein the first gRNA comprises a guide sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 44 (5’-TGCCCAACTTCTGCTGGCATC-3’); the same composition further comprising a nucleic acid molecule encoding a type I HLA protein (preferably HLA-E protein).
With respect to the elected species, Meissner et al already disclosed a CRISPR system (e.g., a Cas protein such as Cas9 or Cpf1 or a nucleic acid sequence encoding the Cas protein and a pair of guide ribonucleic acids having sequences selected from the group consisting of SEQ ID NOs: 5184-36352) to reduce or knockout MHC-II genes by targeting CIITA gene in human pluripotent stem cells, thereby rendering such cells hypoimmunogenic (Abstract; and Summary of the Invention; particularly lines 12-17 at page 5; lines 12-17 at page 6; lines 12-19 at page 8; lines 8-23 at page 28; line 6 at page 33 continues to line 2 at page 34; page 79, lines 24-30; Figs. 10; 16B and 39; and Table 12). Meissner et al also taught that the CRISPR system is a CRISPR type I system, a CRISPR type II system, or a CRISPR type V system (lines 8-23 at page 28); and the target motif is a 17 to 23 nucleotide DNA sequence, including a 17 to 23-nucleotide DNA sequence having a 5’ T-rich region (e.g., TTTN motif) recognized by Acidaminococcus or Lachnospiraceae Cpf1 protein (line 23 at page 37 continues to line 3 at page 39). Meissner et al further taught tolerogenic factors such as HLA-C, HLA-E, HLA-F, or HLA-G gene/construct to be knock-in/inserted into a safe harbor locus of the above genome-edited stem cell to generate immune-privileged universal donor stem cells (lines 9-16 at page 3; page 62, line 28 continues to line 8 at page 63; lines 9-16 at page 64; and Table 2).
Meissner et al did not teach explicitly selecting the 21-bp guide sequence consisting of the nucleotide sequence of SEQ ID NO: 44 for a gRNA targeting CIITA gene, or selecting MAD7 as an RNA-guided endonuclease.
Before the effective filing date of the present application, Norville et al already taught various genetic modification approaches to genetically modify immune cells, including CRISPR/Cas system in which Cas endonuclease is a Cas 9 nuclease or a Cpf1 nuclease (Abstract; particularly col. 93, line 39 continues to line 22 at col. 97). Norville et al disclosed that a target nucleic acid is flanked on the 3’ side or 5’ side by a protospacer adjacent motif (PAM) that may interact with the endonuclease and be further involved in targeting the endonuclease activity to the target nucleic acid (col. 96, lines 64-67). Norville et al also stated “In contrast to Cas9 endonucleases, Cpf1 endonuclease generally do not require a tracrRNA sequence and recognize a PAM sequence located at the 5’ end of the target nucleic acid. For a Cpf1 nuclease, the PAM sequence is TTTN, in some embodiments, the Cas endonuclease is MAD7 (also referred as Cpf1 nuclease from Eubacterium rectale) and the PAM sequence is YTTTN” (col. 97, lines 16-22). Norville et al also noted the advantage of CIITA deletion to remove endogenous MHC class II expression in their disclosed MHC-CAR T cells (col. 70, lines 28-30; top of Table 5).
Additionally, Staudt et al already disclosed the CIITA gene specific reporter probe sequence of SEQ ID NO: 456 (50-nucleotide sequence probe) for the CIITA target sequence of SEQ ID NO: 454, the expression of which is useful in a method for diagnosing and subtyping lymphotypes, and in which the reverse sequence of nucleotides 19-39 in SEQ ID NO: 456 is 100% identical to SEQ ID NO: 44 of the present application (Abstract; particularly col. 8, lines 6-17 and Table 1 at cols. 47-48; and attached sequence search below). The CIITA target sequence of SEQ ID NO: 454 is:
5’-GCCTGAGCAA GGACATTTTC AAGCACATAG GACCAGATGA AGTATGGAGA TGCCAGCAGA AGTTGGGCA GAAAAGTCAG AAAAGACC-3’ (SEQ ID NO: 454).
Upon examination of the CIITA target sequence of SEQ ID NO: 454, it is noted that the reverse strand of its nucleotides 49-70 is 5’-TGCCCAACTTCTGCTGGCATC-3’ which is preceded by the sequence 5’-YTTTN-3’ which is the PALM sequence recognized by MAD7 nuclease, wherein N is any nucleotide and Y represents either a C or a T.
Accordingly, it would have been obvious for an ordinary skilled artisan to modify the teachings of Meissner et by also at least selecting the 21-bp guide sequence consisting of the nucleotide sequence of SEQ ID NO: 44 of the present application for a gRNA targeting CIITA gene, as well as selecting MAD7 as an RNA-guided endonuclease to reduce or knockout MHC-II genes in human pluripotent stem cells, thereby rendering such cells hypoimmunogenic; in light of the teachings of Norville et al and Staudt et al as set forth above.
An ordinary skilled artisan would have been motivated to carry out the above modifications because: (i) Staudt et al already disclosed the CIITA gene specific reporter probe for targeting the CIITA gene sequence of SEQ ID NO: 454 in which the reverse strand of its nucleotides 49-70 is 5’-TGCCCAACTTCTGCTGGCATC-3’ which is preceded by the sequence 5’-YTTTN-3’ which is the PALM sequence recognized by MAD7 nuclease; and (ii) Norville et al already taught using MAD7 for genetically modify immune cells, including the deletion of CIITA gene to remove endogenous MHC class II expression in their disclosed MHC-CAR T cells. Thus, an ordinary skill in the art would have been motivated to select the CIITA target sequence of SEQ ID NO: 454 for designing a CIITA gRNA since it is already accessible for a CIITA gene specific reporter probe and it contains the 5’-YTTTN-3’ PALM sequence recognized by MAD7 that is 5’ to the 21-mer nucleotide sequence of SEQ ID NO: 44 of the present application. Moreover, the primary Meissner et al already taught specifically that the target motif is a 17 to 23 nucleotide DNA sequence, including a 17 to 23-nucleotide DNA sequence having a 5’ T-rich region (e.g., TTTN motif) recognized by Acidaminococcus or Lachnospiraceae Cpf1 protein; as well as using a CRISPR type V system, including Acidaminococcus or Lachnospiraceae Cpf1 protein to knockout CIITA gene in human pluripotent stem cells to create hypoimmunogenic cells.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Meissner et al, Norville et al and Staudt et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Meissner et al, Norville et al and Staudt et al as set forth above is indistinguishable and encompassed by the presently claimed invention.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 02/17/2026 (pages 9-11) have been fully considered, but they are respectfully not found persuasive for the reasons discussed below.
A. Applicant argued that there is no suggestion of the claimed subject matter in the cited prior art, particularly no suggestion that a gRNA having the guide sequence of SEQ ID NO: 44.
Specifically, Applicant argued that Staudt discloses a reporter probe sequence consisting of 50 nts that is not associated with knockout of a target gene, and thus bearing no relevance to the subject matter of currently amended claim 1.
First, please refer to the above modified 103 rejection for details, including the rationale and motivation provided for combining the cited references and particularly for the new limitation “wherein the first gRNA comprises a guide sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 44”.
Second, since the above rejection was made under 35 U.S.C. 103 none of the cited references have to teach every limitation of the instant claims alone. It appears that Applicant considered each of the cited references in total isolation one from the others, without taking into consideration the specific combination of Meissner et al, Norville et al and Staudt et al.
Third, the Staudt reference was cited primarily for the CIITA target site of SEQ ID NO: 454 for a CIITA gene specific reporter probe. As set forth in the above modified 103 rejection, an ordinary skill in the art would have been motivated to select the CIITA target sequence of SEQ ID NO: 454 for designing a CIITA gRNA since it is already accessible for a CIITA gene specific reporter probe and it contains the 5’-YTTTN-3’ PALM sequence recognized by MAD7 that is 5’ to the 21-mer nucleotide sequence of SEQ ID NO: 44 of the present application. Moreover, the primary Meissner et al already taught specifically that the target motif is a 17 to 23 nucleotide DNA sequence, including a 17 to 23-nucleotide DNA sequence having a 5’ T-rich region (e.g., TTTN motif) recognized by Acidaminococcus or Lachnospiraceae Cpf1 protein; as well as using a CRISPR type V system, including Acidaminococcus or Lachnospiraceae Cpf1 protein to knockout CIITA gene in human pluripotent stem cells to create hypoimmunogenic cells.
B. Unexpected results.
Applicant argued that the present inventors carried out extensive screening to discover the most effective gRNA against CIITA based on the degree of expression of HLA-DR, which is activated by CIIA, in gRNA treated NK cells. As shown in paragraph [0123] and Table 10 of the specification, NK cells treated with #25 gRNA (SEQ ID NO: 44) showed HLA-DR knockout efficiency of 40.1%, indicating that #25 gRNA excel every other candidate among a total of 25 gRNA sequences tested. Specifically, the guide sequence consisting of SEQ ID NO: 44 (5’-TGCCCAACTTCTGCTGGCATC-3’) demonstrates a 3.5-fold higher KO efficiency than #5 gRNA (SEQ ID NO: 24 = 5’-TGCCCAACTTCTGCTGGCATCTC-3’) which contains the full-length sequence of SEQ ID NO: 44 plus two additional nucleotides. Accordingly, a person of skill in the art would have had no reasonable expectation that simply converting Staud’s 50-nt probe sequence, which comprises the full length of SEQ ID NO: 44, into a gRNA would result in a similar KO efficiency. Applicant also argued that since the CIITA gene spans approximately 42 kb on chromosome 16 with the coding region of 3.6kb, a skilled artisan would not have had any reasonable expectation that the claimed gRNA with 21nt-length which correspond to only about 0.6% of the full length CIITA coding region, may have maximized knockout efficiency resulting in effective inhibition of HLA-DR which is activated by CIITA, among numerous possible gRNAs recognizing other portion of CIITA. In the instant case, having a large number of possible choices (countless possible gRNAs having consecutive 21nt target region in 3.6 kb length-CIITA gene), the outcome is not predictable, given that SEQ ID NO: 44 was found to be most effective than other candidate gRNAs targeting other regions within the full CIITA.
First, with respect to the issue that the guide sequence consisting of SEQ ID NO: 44 (5’-TGCCCAACTTCTGCTGGCATC-3’) demonstrates a 3.5-fold higher KO efficiency than #5 gRNA (SEQ ID NO: 24 = 5’-TGCCCAACTTCTGCTGGCATCTC-3’) which contains the full-length sequence of SEQ ID NO: 44 plus two additional nucleotides, it is noted that #5 gRNA was used in combination of Cpf1 nuclease, whereas the guide sequence consisting of SEQ ID NO: 44 was used in combination with MAD7 nuclease which shares only 31% homology to Cpf1 nuclease (Table 10 of the specification). Additionally, it is also unclear whether Cpf1 nuclease and MAD7 nuclease were used at the same concentration in their respective reaction solutions. Particularly, the specification simply stated “mixed with 3.32 uL of 40 uM Cpf1 nuclease (Feldan Therapeutics) in 26.84 uL of 1 X PBS or with 4 uL of MAD7 nuclease (Feldan Therapeutic) in 26 uL of 1 X PBS, and then allowed to react at room temperature for 5 minutes or more to obtain an RNP reaction solution (paragraphs [00100] and [00172]). Thus, it is unclear whether the observed difference in KO efficiency could be attributed solely to the difference in the length of SEQ ID NO: 44 (a 21-mer) and #5 gRNA guide sequence (a 23-mer). Moreover, the low KO efficiency mediated by #5 gRNA could be due to its specific 23-base pair guide sequence. This is because there is no evidence of record indicating that the KO efficiency mediated by the guide sequence consisting of SEQ ID NO: 44 is also higher than that mediated by a guide sequence targeting the same CTIIA site with 19-, or 20 base pair in length. With respect to the higher efficiency of the guide sequence consisting of SEQ ID NO: 44 to other guide sequences listed in Table 10, it is noted that other guide sequences target different CIITA target sequences and different RFXANK gene target sequences (like comparing oranges and apples).
Second, since the modified composition resulting from the combined teachings of Meissner et al, Norville et al and Staudt et al as set forth in the above modified 103 rejection is indistinguishable and encompassed by the presently claimed invention, it necessarily flows that the modified composition would possess a higher KO efficiency in comparison with other gRNAs listed in Table 10 of the present application. Please, also note that where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke. Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
Third, even assuming that there is an “unexpected” result, the unexpected result must be commensurate with the scope of the instant claims. In this instance, at least the claims encompass a gRNA comprising a guide sequence consisting of the nucleotide sequence of SEQ ID NO: 44 in combination with any RNA-guided endonuclease, not necessarily limited to MAD7.
Fourth, there is no countless possible gRNAs having consecutive 21nt target region in 3.6 kb length-CIITA gene based on the combined teachings of Meissner et al, Norville et al and Staudt et al. Once again, it would have been obvious and an ordinary skill in the art would have been motivated to select the CIITA target sequence of SEQ ID NO: 454 disclosed by Staudt as a starting point for designing a CIITA gRNA since it is already accessible for a CIITA gene specific reporter probe and it contains the 5’-YTTTN-3’ PALM sequence recognized by MAD7 that is 5’ to the 21-mer nucleotide sequence of SEQ ID NO: 44 of the present application. Particularly, the primary Meissner et al already taught specifically that the target motif is a 17 to 23 nucleotide DNA sequence, including a 17 to 23-nucleotide DNA sequence having a 5’ T-rich region (e.g., TTTN motif) recognized by Acidaminococcus or Lachnospiraceae Cpf1 protein; as well as using a CRISPR type V system, including Acidaminococcus or Lachnospiraceae Cpf1 protein to knockout CIITA gene in human pluripotent stem cells to create hypoimmunogenic cells. Accordingly, there is nothing that is unpredictable in selecting a gRNA comprising a guide sequence consisting of the nucleotide sequence of SEQ ID NO: 44.
Fifth, please note that the standard under 35 U.S.C. 103 is a “reasonable” expectation of success.
Examiner’s Comment
Harrington et al (WO 2021/247924) only disclosed the spacer sequence R5208 having the sequence 5’-TGCCCAACTTCTGCTGGCAT-3’ that targets human CIITA (Table D at page 94) in the International Application Number PCT/US2021/035781, filed on 03 June 2021. The spacer sequence R5208 (20-mer) differs from the guide sequence consisting of the nucleotide of SEQ ID NO: 44 (21-mer 5’-TGCCCAACTTCTGCTGGCATC-3’) of the present application is the lack of an extra C at its 3’ end.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763.
To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300.
Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public.
/QUANG NGUYEN/Primary Examiner, Art Unit 1631
Sequence 645,
Patent No. 12319932
Query Match 100.0%; Score 21; Length 21;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGCCCAACTTCTGCTGGCATC 21
|||||||||||||||||||||
Db 1 TGCCCAACTTCTGCTGGCATC 21
Patent No. 10607717
SEQ ID NO 456
Query Match 100.0%; Score 21; Length 50;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGCCCAACTTCTGCTGGCATC 21
|||||||||||||||||||||
Db 19 TGCCCAACTTCTGCTGGCATC 39