Prosecution Insights
Last updated: April 19, 2026
Application No. 18/005,514

COMPOSITIONS FOR TREATMENT OF SPINAL MUSCULAR ATROPHY

Non-Final OA §103
Filed
Jan 13, 2023
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Cold Spring Harbor Laboratory
OA Round
1 (Non-Final)
43%
Grant Probability
Moderate
1-2
OA Rounds
4y 2m
To Grant
98%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allow Rate
19 granted / 44 resolved
-16.8% vs TC avg
Strong +54% interview lift
Without
With
+54.4%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
55 currently pending
Career history
99
Total Applications
across all art units

Statute-Specific Performance

§101
6.5%
-33.5% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
35.3%
-4.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 44 resolved cases

Office Action

§103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's preliminary amendment filed on August 24, 2023 is acknowledged. Claims 3-6, 16, 18-21, 23, 26, 28, 30, 31, 33, 36, and 37 have been canceled. Claims 1, 2, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 22, 24, 25, 27, 29, 32, and 34 were amended. Claims 1, 2, 7-15, 17, 22, 24, 25, 27, 29, 32, 34, and 35 are pending and are examined on the merits herein. Priority This application claims priority to PCT/US2021/041466 filed on July 13, 2021 which claims priority to U.S. provisional application 63/051,279, filed on July 13, 2020. Information Disclosure Statement The information disclosure statement (IDS) submitted on August 24, 2023 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Drawings The drawings were received on January 13, 2023. These drawings are found acceptable by the examiner. Specification Applicant is reminded of the proper language and format for an abstract of the disclosure. The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details. The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided. The abstract of the disclosure is objected to because of the use of legal phraseology ("e.g." stands for "exempli gratia", and should be removed or replaced with a non-Latin version, such as "for example"). A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b). The disclosure is objected to because of the following informalities: The last sentence of paragraph [0029] is missing a period. Paragraph [0032] reads “FIGS. 11F and 11FG” and should read “11G” instead of “11FG”. The last sentence in paragraph [0032] refers to “grey and red vertical dotted lines”; however, color drawings were not submitted with the instant application. Appropriate correction is required. Claim Objections Claims 7, 9, 10, 11, 12, 13, 14, 15, and 29 are objected to because of the following informalities: Claim 7 is missing a period at the end of the claim. Claim 9: there are two (2) instances of the recitation “lower than about 15 mg/kg”. Claim 9: “or” is missing before the recitation “lower than about 1 mg/kg per dose.”. Claim 10: there are two (2) instances of the recitation “lower than about 550 mg/dose, lower than about 500 mg/dose”. Claim 11: there are two (2) instances of the recitation “lower than about 550 mg/dose/day, lower than about 500 mg/dose/day”. Claim 12: there are two (2) instances of the recitation “about 15 mg/kg”. Claim 12, last line: “or” is missing before the recitation “about 1 mg/kg per dose.”. Claim 13: there are two (2) instances of the recitation “about 550 mg/dose, about 500 mg/dose”. Claim 14: there are two (2) instances of the recitation “about 550 mg/dose/day, about 500 mg/dose/day”. Claim 15 recites “histone deacetylate inhibitor” and should recite “histone deacetylase inhibitor”. Claim 29 part (iii) recites “nucleotide analogs” and should recite “nucleoside analogs”. Appropriate correction is required. Applicant is advised that should claim 1 be found allowable, claim 2 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m). The specification does not define the term “co-administering”; therefore, given the broadest reasonable interpretation, the term “co-administering” in claim 2 means to administer the ASO and the histone deacetylase inhibitor. Thus, the scope of claims 1 and 2 are the same. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 2, 7-15, 17, 22, 24, 25, 27, 29, 32, 34, and 35 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (US 2021/0228615) in view of Pagliarini et al. (Journal of Neurochemistry 2020; reference cited by Applicant) and Cummings et al. (US 2006/0004041). Regarding claims 1, 2, 7, 8, 15, and 17, Zhang et al. teaches SMN2 oligonucleotides, compositions, and methods thereof [abstract]. Further, Zhang et al. teaches a method of treating a SMN2-related condition, disorder, or disease (e.g., SMA – spinal muscular atrophy) in a subject, comprising administering a therapeutically effective amount of a chirally controlled SMN2 oligonucleotide composition to a subject suffering therefrom or susceptible thereto [0061]. Zhang et al. teaches SEQ ID NO: 27 (designated as Db) which matches to instant SEQ ID NO: 1 (designated as Qy) as shown in the alignment below. PNG media_image1.png 170 884 media_image1.png Greyscale Zhang et al. does not explicitly indicate what SEQ ID NO: 27 is; however, Zhang et al. teaches that the disclosure pertains to an oligonucleotide composition (e.g., a chirally controlled oligonucleotide composition, a SMN2 oligonucleotide composition, etc.), which oligonucleotide composition comprises oligonucleotides of a base sequence which is at least 80% complementary to intron 7 of the SMN2 gene over the entire length of the oligonucleotide composition and at least 85% identical to the sequence of ATTCACTTTCATAATGCTGG wherein the oligonucleotide composition is capable of mediating an increase in the level, expression and/or activity of exon 7-containing SMN2 mRNA or its gene product in a cell or organism and wherein each T can be independently replaced by U and vice versa [0238]. Zhang et al. also teaches that one or more additional therapeutic agents may be administered together with provided oligonucleotides wherein the additional therapeutic agent is a histone deacetylase (HDAC) inhibitor or valproic acid [1226]. Regarding claims 9 and 12, Zhang et al. teaches that the oligonucleotide is administered at a dose from 0.01 to 10 milligrams of oligonucleotide per kilogram of body weight of the subject [1135]. Regarding claims 10 and 13, Zhang et al. teaches administering a 5 mg to 20 mg dose of an oligonucleotide [1127]. Regarding claims 11 and 14, Zhang et al. teaches that in the treatment of adult humans, dosages from about 0.01 to about 1000 mg, from about 0.5 to about 100 mg, from about 1 to about 50 mg per day, and from about 5 to about 100 mg per day are examples of dosages that may be used [1207]. Regarding claim 22, Zhang et al. teaches that oligonucleotides and compositions are delivered to an animal/subject by intrathecal administration [1213]. Regarding claim 24, Zhang et al. teaches a chirally controlled SMN2 oligonucleotide having the sequence of any oligonucleotide disclosed wherein the oligonucleotide is a gapmer [0793]. Regarding claims 25, 27, and 29, Zhang et al. teaches that the oligonucleotides comprise one or more sugar modifications selected from: LNA, alpha-L-LNA, and cEt [0086]. Regarding claim 32, Zhang et al. teaches oligonucleotides and compositions comprising oligonucleotides that have a particular base sequence and/or pattern or base modifications (e.g., 5-methylcytosine) [0054]. Regarding claims 34 and 35, Zhang et al. teaches in some embodiments, an internucleotidic linkage is a phosphorothioate [0077]. However, Zhang et al. does not teach administering a subclinical dose of a histone deacetylase inhibitor or the dosage of the histone deacetylase inhibitor. Zhang et al. also does not teach the route of administration of the histone deacetylase inhibitor. Pagliarini et al. teaches that TSA (trichostatin A), LBH589, SAHA and VPA (valproic acid) were compared for their ability to positively modulate SMN2 expression and splicing in a SMA context. LBH589 exerted a slightly stronger effect than the other HDACi on exon 7 splicing and was thus selected for further studies [page 268, left column, Section 3.1]. Pagliarini et al. demonstrated that SMA cells treated with LBH589 alone did not significantly affect the splicing of exon 7 nor the expression of SMN protein. However, when the LBH589 treatment was combined with ASO_ISSN1 administration, a significant increase in exon 7 splicing with respect to ASO_ISSN1 was observed [page 269, right column]. Cummings et al. teaches hydroxamic acid compounds that are antagonists of histone deacetylases (HDACs) which are capable of providing therapeutic benefit when administered to treat HDAC mediated symptoms such as those found in neurodegenerative diseases including spinal muscular atrophy [0007]. Further, Cummings et al. teaches pharmaceutical compositions comprising a therapeutically effective amount of an HDAC inhibitor wherein the HDAC inhibitor is administered orally or intravenously [0094]. Cummings et al. also teaches that a suitable dose will be in the range of 0.01 to 100 mg per kilogram body weight of the recipient per day [0102]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to incorporate a histone deacetylase inhibitor as taught by Pagliarini et al. in an amount as taught by Cummings et al. in the composition of Zhang et al. with a reasonable expectation of success. One would have been motivated to do so because Zhang et al. taught a method of treating spinal muscular atrophy and Pagliarini et al. taught that combining a histone deacetylase inhibitor with an antisense oligonucleotide increases exon 7 splicing. Although Pagliarini et al. demonstrated the combinatorial effect with LBH589, it would have been obvious to try to use TSA or VPA because Pagliarini et al. taught that these are other examples of a histone deacetylase inhibitor. Furthermore, one would have been motivated to determine the optimal dose of the antisense oligonucleotide and histone deacetylase inhibitor in the process of routine optimization to treat spinal muscular atrophy because Zhang et al. taught dosages of antisense oligonucleotide within the instantly claimed range and Cummings et al. taught dosages of HDAC inhibitor within the instantly claimed range. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Jan 13, 2023
Application Filed
Nov 30, 2025
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
2y 5m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
2y 5m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
2y 5m to grant Granted Feb 10, 2026
Patent 12529057
THERAPEUTICS FOR SYNGAP HAPLOINSUFFICIENCY
2y 5m to grant Granted Jan 20, 2026
Patent 12522818
METHOD FOR INDUCING DELETION IN GENOMIC DNA
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
43%
Grant Probability
98%
With Interview (+54.4%)
4y 2m
Median Time to Grant
Low
PTA Risk
Based on 44 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month