Prosecution Insights
Last updated: August 17, 2026
Application No. 18/006,423

PLANT REGULATORY ELEMENTS AND METHODS OF USE THEREOF

Non-Final OA §103§112
Filed
Jan 23, 2023
Priority
Aug 10, 2020 — provisional 63/063,467 +2 more
Examiner
DELEO, VICTORIA LYNN
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Pioneer Hi-bred International Inc.
OA Round
3 (Non-Final)
37%
Grant Probability
At Risk
3-4
OA Rounds
0m
Est. Remaining
-3%
With Interview

Examiner Intelligence

Grants only 37% of cases
37%
Career Allowance Rate
10 granted / 27 resolved
-23.0% vs TC avg
Minimal -40% lift
Without
With
+-40.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
35 currently pending
Career history
68
Total Applications
across all art units

Statute-Specific Performance

§101
8.6%
-31.4% vs TC avg
§103
29.7%
-10.3% vs TC avg
§102
16.3%
-23.7% vs TC avg
§112
34.8%
-5.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 27 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 6/18/2026 has been entered. Status of Claims Claims 1 & 3-18 are under examination on the merits. The objection to the specification is withdrawn in light of Applicant’s amendments. Claim Objections Claims 1, 3, 10, 11, & 13 are objected to because of the following informalities: Claim 1 (line 7): Option (c) should be re-labeled option (b). Claim 3 (line 9): Option (c) should be re-labeled option (b). Claim 3 (line 10): “of” should be inserted after “consisting”. Claim 3 (line 10): the extra space between “160” and the final comma should be deleted. Claim 10 (line 2): “dicotyledon” should read --dicotyledonous-- or “plant” should be deleted. Claim 11 (line 2): “monocotyledon” should read --monocotyledonous-- or “plant” should be deleted. Claim 13 (line 7 & and 10): option (b) and option (c) should be re-labeled (a) and (b) respectively. Claim 13 (line 10): “the nucleotide sequence” should be replaced with --a nucleotide sequence--. Appropriate correction is required. Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 14 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 14 recites the limitation "the apical meristem" in line 4. There is insufficient antecedent basis for this limitation in the claim, because a plant can comprise more than one apical meristem, including shoot apical meristem(s) and root meristem(s). Editing to “an apical meristem” would fix the antecedent basis issue. Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1 & 3-18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 4/6/2026, as applied to claims 1 & 3-18. Applicant' s arguments filed 6/1/2026 have been fully considered but they are not persuasive. Claims 1 & 3-12 require a polynucleotide that has regulatory activity comprising a polynucleotide having at least 98% sequence identity to the full length of a nucleic acid sequence of SEQ ID NO: 156-160 or a fragment comprising at least 137 contiguous nucleotides of SEQ ID NO: 156-160. Claims 13-18 require a regulatory element capable of increasing expression of a heterologous polynucleotide and comprising a nucleotide sequence at least 98% identical to SEQ ID NOs: 156-160 or a fragment of the nucleotide sequence of SEQ ID NOs: 156-160 comprising at least 137 contiguous nucleotides having regulatory activity in a plant cell. Nucleic acid sequences having 98% identity to SEQ ID NOs: 156-160 encompass polynucleotides with 30 substitutions relative to the 1506 bp long SEQ ID NO: 156, 8 substitutions relative to the 438 bp long SEQ ID NO: 157, 2 substitutions relative to the 137 bp long SEQ ID NO: 158, 17 substitutions relative to the 869 bp long SEQ ID NO: 159, and 11 substitutions relative to the 568 bp long SEQ ID NO: 160. 137 contiguous nucleotides represent 9.1% of SEQ ID NO: 156, 31.3% of SEQ ID NO: 157, 100% of SEQ ID NO: 158, 15.8% of SEQ ID NO: 159, and 24.1% of SEQ ID NO: 160. The instant specification defines a fragment as a portion of a nucleic acid sequence that may or may not retain the biological activity of initiating transcription (page 15 line 27-page 16 line 2). Thus, claims 1 & 3-18 encompass polynucleotides with as few as 137 nucleotides that have regulatory activity in a plant cell. Thus, claims 1 & 3-12 broadly require any polynucleotide sequence with regulatory activity and comprising any 137 contiguous nucleotides found in any of SEQ ID NO: 156-160 or with 98% sequence identity to SEQ ID NO: 156-160 while claims 13-18 broadly require a regulatory element capable of increasing expression of a polynucleotide and comprising a sequence at least 98% identical to SEQ ID NO: 156-160 or comprising 137 contiguous nucleotides of SEQ ID NO: 156-160 that have regulatory activity in a plant cell. The instant specification describes 206 polynucleotide sequences with regulatory activity, but only SEQ ID NOs: 156-160 and 34 are Cicer arietinum UBI promoters (table 1). SEQ ID NOs: 156 and 34 have 99.6% sequence identity, see alignment below. SEQ ID NOs: 157-160 are fragments of SEQ ID NO: 156. See second alignment below. Sequence 34, US/18006423 GENERAL INFORMATION APPLICANT: Pioneer Hi-Bred International, Inc. APPLICANT: Bhyri, Priyanka TITLE OF INVENTION: PLANT REGULATORY ELEMENTS AND METHODS OF USE THEREOF FILE REFERENCE: 7667 CURRENT APPLICATION NUMBER: US/18/006,423 CURRENT FILING DATE: 2023-01-23 NUMBER OF SEQ ID NOS: 206 SEQ ID NO 34 LENGTH: 1500 TYPE: DNA ORGANISM: Cicer arietinum Query Match 99.6%; Score 1500; Length 1500; Best Local Similarity 100.0%; Matches 1500; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATTTGTCTCCATCGAAGAGTCATATCAGATATCTCTCAACATTGTTATTTTTATGATTTA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATTTGTCTCCATCGAAGAGTCATATCAGATATCTCTCAACATTGTTATTTTTATGATTTA 60 Qy 61 AATATTTATTTGATTATATAGATATATTATTTTTTATATTAGTCTATATAAATTTTATTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 AATATTTATTTGATTATATAGATATATTATTTTTTATATTAGTCTATATAAATTTTATTG 120 Qy 121 TTTAAATTTAATTATTATAAAATTAAAGATAATTAATTTTTAGTTTAAAAAAAGAGTTAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTTAAATTTAATTATTATAAAATTAAAGATAATTAATTTTTAGTTTAAAAAAAGAGTTAA 180 Qy 181 TAAATTGCAGGATAAGTGAATTTATAAATACACATAAATATATTTTTTATGAAATATTAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TAAATTGCAGGATAAGTGAATTTATAAATACACATAAATATATTTTTTATGAAATATTAA 240 Qy 241 AAATTAAAACATTTTATAATATTAATTAATTATTTAATAATTAGTATTATTTTATAAAAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AAATTAAAACATTTTATAATATTAATTAATTATTTAATAATTAGTATTATTTTATAAAAA 300 Qy 301 AATACAAATAAAAATTAAAAGAATATTTTAAAAGTGTTTTAAAACTTCGTTATTCTTTTA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AATACAAATAAAAATTAAAAGAATATTTTAAAAGTGTTTTAAAACTTCGTTATTCTTTTA 360 Qy 361 TATTAATTTGATATTAAGAACTAAAACCATTTATAAAATTTAATTCAAAATTTTTTATAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TATTAATTTGATATTAAGAACTAAAACCATTTATAAAATTTAATTCAAAATTTTTTATAG 420 Qy 421 AAACTAAAATAAAAAAATTATATTCATAAAAATTAAATATATATTTTTTAAATATATTTT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AAACTAAAATAAAAAAATTATATTCATAAAAATTAAATATATATTTTTTAAATATATTTT 480 Qy 481 ACTATAAATACAAATTTTGTTTTTTTACTCATAAAACTCGAACTTAATACCATATCGAAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 ACTATAAATACAAATTTTGTTTTTTTACTCATAAAACTCGAACTTAATACCATATCGAAC 540 Qy 541 CAATAGTATGATAGTAGAACCAAAAAATTAATTTATTTAACATTGTAAAAAAAAATACAA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CAATAGTATGATAGTAGAACCAAAAAATTAATTTATTTAACATTGTAAAAAAAAATACAA 600 Qy 601 TTTATTTAACCATTCTAATATTCTCTTTGTTGAATTTAATATAATTTTCATAGCAGTCGG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTTATTTAACCATTCTAATATTCTCTTTGTTGAATTTAATATAATTTTCATAGCAGTCGG 660 Qy 661 CCTTCCAACGGTGGAGTGGAGTTCATATTGTAAAACAGACGACGTGGGCCCATACGAAAT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CCTTCCAACGGTGGAGTGGAGTTCATATTGTAAAACAGACGACGTGGGCCCATACGAAAT 720 Qy 721 AAGTGACCCAATAAAGTAACGCCGTGGTAACGATTAATCCAGATTCCAGTAGAAGGTTGC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 AAGTGACCCAATAAAGTAACGCCGTGGTAACGATTAATCCAGATTCCAGTAGAAGGTTGC 780 Qy 781 ATTCGACTCCGTCAAGATTAAACGCCAACTACCATTTCCCAATTGCAATTAATAATTTCC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 ATTCGACTCCGTCAAGATTAAACGCCAACTACCATTTCCCAATTGCAATTAATAATTTCC 840 Qy 841 GAGAAAGACCGCCCTGAACGCATTGGATACCAAAACTAAGCCAGATACAACAAGCAACCC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GAGAAAGACCGCCCTGAACGCATTGGATACCAAAACTAAGCCAGATACAACAAGCAACCC 900 Qy 901 AACAACTAGCACCGAATGACATATAATCAAGACACGTGTCACAATTCTAGTGGTTACGTT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 AACAACTAGCACCGAATGACATATAATCAAGACACGTGTCACAATTCTAGTGGTTACGTT 960 Qy 961 TTTGACCCTTTTGCTATAAATTAACCCCAATGCTCCCATACAAATCGCAGTTTCATTTCT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 TTTGACCCTTTTGCTATAAATTAACCCCAATGCTCCCATACAAATCGCAGTTTCATTTCT 1020 Qy 1021 ATTGAATTACTTTCTTTGAGCCCTATCTACTTCTCAACAAATCCTCAAGGTATTTTCCAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 ATTGAATTACTTTCTTTGAGCCCTATCTACTTCTCAACAAATCCTCAAGGTATTTTCCAT 1080 Qy 1081 TTCTTTTCTGATTTTCGATTCGGGTTTTCGTCTTTCCTTTCGTAGATCGTTTAGAAATCG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TTCTTTTCTGATTTTCGATTCGGGTTTTCGTCTTTCCTTTCGTAGATCGTTTAGAAATCG 1140 Qy 1141 ATTAGACAGAGTTTATATAAGCTATATTTATTAGAAATGATCTCAGATCGTTTTCTAATA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 ATTAGACAGAGTTTATATAAGCTATATTTATTAGAAATGATCTCAGATCGTTTTCTAATA 1200 Qy 1201 TATATTCTCAATAAATCTGTTTGAATTGCATGATCGTCAATTAGGTTTGTTGTATCTGGT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TATATTCTCAATAAATCTGTTTGAATTGCATGATCGTCAATTAGGTTTGTTGTATCTGGT 1260 Qy 1261 TTATGAACAGGTTTTGCATGAACGGATCTGATAACGTTTAATTTGAAATGCTTCATATTC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 TTATGAACAGGTTTTGCATGAACGGATCTGATAACGTTTAATTTGAAATGCTTCATATTC 1320 Qy 1321 GTTTGTTATACACTGTTTTTAATATGTATTAGAGTCAATTCAATTTCTGGTGTTTGATTT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 GTTTGTTATACACTGTTTTTAATATGTATTAGAGTCAATTCAATTTCTGGTGTTTGATTT 1380 Qy 1381 TAGTTTATTTGTTGTTTTGATCTCAAGCTGTTTTGGTCTGTTGTTATAGATTCATAATCC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 TAGTTTATTTGTTGTTTTGATCTCAAGCTGTTTTGGTCTGTTGTTATAGATTCATAATCC 1440 Qy 1441 AGTTTCTAATTCGATTTCTGGCGTTTGATTCTGATTTATTTGTTGCTGCTACTTCCACAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 AGTTTCTAATTCGATTTCTGGCGTTTGATTCTGATTTATTTGTTGCTGCTACTTCCACAG 1500 160 ------------------------------------------------------------ 156 ATTTGTCTCCATCGAAGAGTCATATCAGATATCTCTCAACATTGTTATTTTTATGATTTA 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 AATATTTATTTGATTATATAGATATATTATTTTTTATATTAGTCTATATAAATTTTATTG 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 TTTAAATTTAATTATTATAAAATTAAAGATAATTAATTTTTAGTTTAAAAAAAGAGTTAA 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 TAAATTGCAGGATAAGTGAATTTATAAATACACATAAATATATTTTTTATGAAATATTAA 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 AAATTAAAACATTTTATAATATTAATTAATTATTTAATAATTAGTATTATTTTATAAAAA 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 AATACAAATAAAAATTAAAAGAATATTTTAAAAGTGTTTTAAAACTTCGTTATTCTTTTA 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 TATTAATTTGATATTAAGAACTAAAACCATTTATAAAATTTAATTCAAAATTTTTTATAG 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 AAACTAAAATAAAAAAATTATATTCATAAAAATTAAATATATATTTTTTAAATATATTTT 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 ACTATAAATACAAATTTTGTTTTTTTACTCATAAAACTCGAACTTAATACCATATCGAAC 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 CAATAGTATGATAGTAGAACCAAAAAATTAATTTATTTAACATTGTAAAAAAAAATACAA 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ------------------------------------------------------------ 160 ------------------------------------------------------------ 156 TTTATTTAACCATTCTAATATTCTCTTTGTTGAATTTAATATAATTTTCATAGCAGTCGG 157 -------------------------------GAATTTAATATAATTTTCATAGCAGTCGG 158 ------------------------------------------------------------ 159 -------------------------------GAATTTAATATAATTTTCATAGCAGTCGG 160 ------------------------------------------------------------ 156 CCTTCCAACGGTGGAGTGGAGTTCATATTGTAAAACAGACGACGTGGGCCCATACGAAAT 157 CCTTCCAACGGTGGAGTGGAGTTCATATTGTAAAACAGACGACGTGGGCCCATACGAAAT 158 ------------------------------------------------------------ 159 CCTTCCAACGGTGGAGTGGAGTTCATATTGTAAAACAGACGACGTGGGCCCATACGAAAT 160 ------------------------------------------------------------ 156 AAGTGACCCAATAAAGTAACGCCGTGGTAACGATTAATCCAGATTCCAGTAGAAGGTTGC 157 AAGTGACCCAATAAAGTAACGCCGTGGTAACGATTAATCCAGATTCCAGTAGAAGGTTGC 158 ------------------------------------------------------------ 159 AAGTGACCCAATAAAGTAACGCCGTGGTAACGATTAATCCAGATTCCAGTAGAAGGTTGC 160 ------------------------------------------------------------ 156 ATTCGACTCCGTCAAGATTAAACGCCAACTACCATTTCCCAATTGCAATTAATAATTTCC 157 ATTCGACTCCGTCAAGATTAAACGCCAACTACCATTTCCCAATTGCAATTAATAATTTCC 158 ------------------------------------------------------------ 159 ATTCGACTCCGTCAAGATTAAACGCCAACTACCATTTCCCAATTGCAATTAATAATTTCC 160 ------------------------------------------------------------ 156 GAGAAAGACCGCCCTGAACGCATTGGATACCAAAACTAAGCCAGATACAACAAGCAACCC 157 GAGAAAGACCGCCCTGAACGCATTGGATACCAAAACTAAGCCAGATACAACAAGCAACCC 158 ------------------------------------------------------------ 159 GAGAAAGACCGCCCTGAACGCATTGGATACCAAAACTAAGCCAGATACAACAAGCAACCC 160 --------------------------------CACGTGTCACAATTCTAGTGGTTACGTT 156 AACAACTAGCACCGAATGACATATAATCAAGACACGTGTCACAATTCTAGTGGTTACGTT 157 AACAACTAGCACCGAATGACATATAATCAAGACACGTGTCACAATTCTAGTGGTTACGTT 158 --------------------------------CACGTGTCACAATTCTAGTGGTTACGTT 159 AACAACTAGCACCGAATGACATATAATCAAGACACGTGTCACAATTCTAGTGGTTACGTT **************************** 160 TTTGACCCTTTTGCTATAAATTAACCCCAATGCTCCCATACAAATCGCAGTTTCATTTCT 156 TTTGACCCTTTTGCTATAAATTAACCCCAATGCTCCCATACAAATCGCAGTTTCATTTCT 157 TTTGACCCTTTTGCTATAAATTAACCCCAATGCTCCCATACAAATCGCAGTTTCATTTCT 158 TTTGACCCTTTTGCTATAAATTAACCCCAATGCTCCCATACAAATCGCAGTTTCATTTCT 159 TTTGACCCTTTTGCTATAAATTAACCCCAATGCTCCCATACAAATCGCAGTTTCATTTCT ************************************************************ 160 ATTGAATTACTTTCTTTGAGCCCTATCTACTTCTCAACAAATCCTCAAGGTATTTTCCAT 156 ATTGAATTACTTTCTTTGAGCCCTATCTACTTCTCAACAAATCCTCAAGGTATTTTCCAT 157 ATTGAATTACTTTCTTTGAGCCCTATCTACTTCTCAACAAATCCTCAAG----------- 158 ATTGAATTACTTTCTTTGAGCCCTATCTACTTCTCAACAAATCCTCAAG----------- 159 ATTGAATTACTTTCTTTGAGCCCTATCTACTTCTCAACAAATCCTCAAGGTATTTTCCAT ************************************************* 160 TTCTTTTCTGATTTTCGATTCGGGTTTTCGTCTTTCCTTTCGTAGATCGTTTAGAAATCG 156 TTCTTTTCTGATTTTCGATTCGGGTTTTCGTCTTTCCTTTCGTAGATCGTTTAGAAATCG 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 TTCTTTTCTGATTTTCGATTCGGGTTTTCGTCTTTCCTTTCGTAGATCGTTTAGAAATCG 160 ATTAGACAGAGTTTATATAAGCTATATTTATTAGAAATGATCTCAGATCGTTTTCTAATA 156 ATTAGACAGAGTTTATATAAGCTATATTTATTAGAAATGATCTCAGATCGTTTTCTAATA 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 ATTAGACAGAGTTTATATAAGCTATATTTATTAGAAATGATCTCAGATCGTTTTCTAATA 160 TATATTCTCAATAAATCTGTTTGAATTGCATGATCGTCAATTAGGTTTGTTGTATCTGGT 156 TATATTCTCAATAAATCTGTTTGAATTGCATGATCGTCAATTAGGTTTGTTGTATCTGGT 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 TATATTCTCAATAAATCTGTTTGAATTGCATGATCGTCAATTAGGTTTGTTGTATCTGGT 160 TTATGAACAGGTTTTGCATGAACGGATCTGATAACGTTTAATTTGAAATGCTTCATATTC 156 TTATGAACAGGTTTTGCATGAACGGATCTGATAACGTTTAATTTGAAATGCTTCATATTC 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 TTATGAACAGGTTTTGCATGAACGGATCTGATAACGTTTAATTTGAAATGCTTCATATTC 160 GTTTGTTATACACTGTTTTTAATATGTATTAGAGTCAATTCAATTTCTGGTGTTTGATTT 156 GTTTGTTATACACTGTTTTTAATATGTATTAGAGTCAATTCAATTTCTGGTGTTTGATTT 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 GTTTGTTATACACTGTTTTTAATATGTATTAGAGTCAATTCAATTTCTGGTGTTTGATTT 160 TAGTTTATTTGTTGTTTTGATCTCAAGCTGTTTTGGTCTGTTGTTATAGATTCATAATCC 156 TAGTTTATTTGTTGTTTTGATCTCAAGCTGTTTTGGTCTGTTGTTATAGATTCATAATCC 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 TAGTTTATTTGTTGTTTTGATCTCAAGCTGTTTTGGTCTGTTGTTATAGATTCATAATCC 160 AGTTTCTAATTCGATTTCTGGCGTTTGATTCTGATTTATTTGTTGCTGCTACTTCCACAG 156 AGTTTCTAATTCGATTTCTGGCGTTTGATTCTGATTTATTTGTTGCTGCTACTTCCACAG 157 ------------------------------------------------------------ 158 ------------------------------------------------------------ 159 AGTTTCTAATTCGATTTCTGGCGTTTGATTCTGATTTATTTGTTGCTGCTACTTCCACAG 160 ------ 156 GGATCC 157 ------ 158 ------ 159 ------ The instant specification describes that motifs for transcription factor binding such as a TATA-box may be present in regulatory elements and describes how sequence motifs in regulatory elements may be found in the PLACE database (page 12, lines 14-21). Regulatory elements are known in the art, including ubiquitin promoters. Peykari et al (2019) Crop Biotech. 25: 35-45 (published 2019, hereafter Peykari) analyzed the features present in the sequence of a Cicer arietinum Ubiquitin 10 promoter and found TATA-boxes, CAAT-boxes, GATA-boxes, Inr elements, and other known regulatory element features (table 2). Hernandez-Garcia et al (2014) Plant Science. 217-218: 109-119 (published 12/14/2013, hereafter Hernandez Garcia) also describes promoters of Ubiquitin genes as highly active in almost all organs and tissues throughout most of a plant’s life cycle (page 112, left column, paragraph 2). Strong polyubiquitin promoters comprise a well-conserved G-box like motif (figure 3) and often also contain leading introns in the 5’UTR that may be included as part of the promoter to enhance transgene expression (page 114, left column, paragraph 3). However, Hernandez-Garcia describes how polyubiquitin promoters may have contrasting expression levels in different plants, and transgene expression may not be fully predictable as factors to regulate promoters may not exist in heterologous systems (page 116, right column, paragraph 5). Structural features responsible for promoter activity, including promoter activity of constitutive ubiquitin genes are known in the art and familiar to one of ordinary skill. However, the polynucleotides required by the claims of the instant specification are not limited to promoters or to ubiquitin promoters specifically but encompass polynucleotides of as little as 137 nucleotides found within SEQ ID NOs: 156-160. Claims 13-18 require that the regulatory element is capable of increasing expression of a heterologous polynucleotide, but claims 1 & 3-12 encompass sequences with any regulatory activity. One of skill in the art would not recognize that Applicant was in possession of the necessary common attributes or features of this broad genus in view of the disclosed species. Hence, Applicant has not, in fact, described polynucleotides that have regulatory activity comprising any 137 contiguous nucleotides found in any of SEQ ID NO: 156-160 or with 98% sequence identity to SEQ ID NOs: 156-160; or a regulatory element capable of increasing expression of a polynucleotide and comprising 137 contiguous nucleotides or SEQ ID NOs: 156-160 that have regulatory activity in a plant cell or with 98% sequence identity to SEQ ID NOs: 156-160 over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed. Applicant urges that amended claims recite a polynucleotide having at least 98% identity to the full length of SEQ ID NOs: 156-160 and a fragment comprising 137 contiguous nucleotides of a sequence selected from SEQ ID NO: 156-160. Applicant urges that Table 5 of the specification shows truncations and describes claimed sequences and their expression score, so one of ordinary skill in the art would recognize that Applicant was in possession of the claimed invention at the time of filing (Remarks, page 6, paragraphs 3-7). This argument is unpersuasive, because Table 5 describes only truncations of the disclosed polynucleotide sequences, and only SEQ ID NOs: 156-161 in table 5 are sequences associated with the Cicer arietinum UBI. Table 5 does not describe any truncations to 137 contiguous nucleotides of SEQ ID NO: 156 other than SEQ ID NO: 158. Table 5 does not describe regulatory elements that are truncations of SEQ ID NO: 156 that do not comprise SEQ ID NO: 158. The specification does not teach regulatory elements comprising nucleotide substitutions or indels over the full scope of the claimed nucleotide sequences with 98% identity to SEQ ID NOs: 156-160. Thus, the instant disclosure does not describe the full scope of the claimed invention through either examples or description of a shared structural feature. New Matter Claims 1 & 3-18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a New Matter rejection. Claims 1 & 3-12 recite a polynucleotide that has regulatory activity comprising a fragment comprising at least 137 contiguous nucleotides of SEQ ID NO: 156-160. Claims 13-18 recite a regulatory element capable of increasing expression of a heterologous polynucleotide and comprising a fragment of the nucleotide sequences of SEQ ID NOs: 156-160 comprising at least 137 contiguous nucleotides having regulatory activity in a plant cell. The originally filed disclosure describes fragments of a regulatory element comprising or consisting of about 50, 95, 150, 250, 500, or about 750 or more contiguous nucleotides of a polynucleotide (page 12, lines 4-6) and nucleic acid molecules that are fragments of a regulatory polynucleotide sequence comprising at least about 16, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700 or 800 nucleotides or up to the number of nucleotides present in a full-length regulatory sequence disclosed (page 16, lines 3-7). The originally filed claims recite a "fragment", but not one of a specific length of 137 contiguous nucleotides. SEQ ID NO: 158 is 137 nucleotides long, but this single example does not provide support for the full genus of 137 bp-long fragments found within the 1506 bp long SEQ ID NO: 156. Thus, support for the new limitation of a fragment comprising 137 contiguous nucleotides of a sequence selected from SEQ ID NO: 156-160 is not found in the original disclosure. In response to this rejection, Applicant is required to point specifically to support for the concept in the specification or originally filed claims or to cancel the new matter. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 1, 3, 5, 7, 9-10, 12-13 & 16-17 are rejected under 35 U.S.C. 103 as being unpatentable over Chakraborty et al (2016) Plant Cell Tiss Organ Cult. 125(3), 521-535 (published 3/25/2016, hereafter Chakraborty) in view of NCBI reference NW_004515387.1 (bases 3691155 to 3695226, available 12/27/2018) taken with the evidence of NCBI reference XM_004496716.1 (available 6/8/2015). Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 4/6/2026, as applied to claims 1,3, 5, 7, 9-10, 12-13 & 16-17. Applicant's arguments filed 6/1/2026 have been fully considered but they are not persuasive. Claims 1,3, 5, 7, 9-10, 12-13 & 16-17 are drawn to a recombinant polynucleotide comprising a polynucleotide with at least 98% sequence identity to SEQ ID NOs: 156-160, or a fragment comprising at least 137 contiguous nucleotides of SEQ ID NOs: 156-160, a DNA construct comprising the regulatory element polynucleotide, or a heterologous cell or transgenic plant or seed comprising the DNA construct or nucleic acid molecule, and a method for expressing a polynucleotide in a plant comprising introducing into a plant cell a recombinant polynucleotide comprising a regulatory element comprising a sequence that is at least 98% identical to SEQ ID NO: 156-160 or a fragment of 137 contiguous nucleotides of SEQ ID NOs: 156-160 that has regulatory activity in a plant cell. Claims 13 & 16-17 do not require expression of a heterologous polynucleotide, only that the regulatory element is capable of increasing expression of one. Chakraborty teaches that chickpea is the third most important grain legume worldwide but is affected by damage from Helicoverpa armigera (page 521, right column, paragraph 2). Chakraborty teaches cry1Ac as a Bt gene beneficial for pyramiding of insect resistance traits (page 522, left column, paragraph 4). Chakraborty teaches the isolation of a ubiquitin promoter from C. arietinum DNA of the sequence found in Accession number KC505186 (page 523, left column, paragraphs 1-2). Chakraborty teaches cloning the isolated promoters into a pUC18 vector upstream of a cry1Ac gene and a chloroplast transit sequence, which were then cloned into the plant expression vector pCAMBIA2301 carrying a nptII gene as a selectable marker and uidA (gus) gene as a reporter system and transformed into Agrobacterium (page 523, left column, paragraph 3-right column paragraph 1; figure 1). Chickpea was transformed with the vectors (page 523, right column, paragraph 3). T1 seeds were obtained from primary transformants and segregation pattern for the cry1Ac transgene was calculated in T2 progeny (page 524, left column, paragraph 3). T1 progeny carrying the Ubi-cry1Ac construct were found (figure 6d). Transgenic plants carrying the Ubi-cry1Ac construct led to higher larval mortality when fed to insects (figure 9d). Chakraborty teaches a motivation to generate transgenic plants carrying the Cry protein to mitigate synthetic pesticide use but that high expression of a cry1Ac gene often negatively affects plant regeneration. However, expression in chickpeas using homologous promoters led to normal plant growth and development (page 531, left column, paragraph 2-right column, paragraph 1). Chakraborty also teaches a motivation to use a ubi promoter rather than a CaMV35S promoter for expression because CaMV35S expression has variable efficacy in different plant species and parts and multiple transformations with a single promoter can lead to silencing of genes in successive generations (page 522, right column, paragraph 2). Chakraborty does not teach a nucleotide sequence that is at least 98% identical to SEQ ID NO: 156. NCBI reference NW_004515387.1 (bases 3691155 to 3695226) teaches a nucleotide sequence complementary to a sequence with 99% sequence identity to 1500 bp found in instant SEQ ID NO: 156. A polynucleotide sequence with 1492 identical nucleotides represents a sequence with 99% identity to a full length sequence of 1506 nucleotides (1492/1506 ==.99). Furthermore, the nucleotide sequence of NCBI reference NW_004515387.1 comprises fragments of at least 137 contiguous nucleotides with 100% identity to SEQ ID NO: 156. See first alignment below, SEQ ID NO: 156 is on top. Nucleotides 1192 to 1500, for example, comprise at least 137 identical contiguous nucleotides. Additionally, NCBI reference NW_004515387.1 comprises a sequence with 99% sequence identity to the full length of SEQ ID NO: 158 (see second alignment below; SEQ ID NO: 158 is on top) and to the full length of SEQ ID NO: 159 (see third alignment below). Score Expect Identities Gaps Strand 2726 bits(1476) 0.0 1492/1500(99%) 0/1500(0%) Plus/Minus Query 1 ATTTGTCTCCATCGAAGAGTCATATCAGATATCTCTCAACATTGttatttttatgattta 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3346 ATTTGTCTCCATCGAAGAGTCATATCAGATATCTCTCAACATTGTTATTTTTATGATTTA 3287 Query 61 aatatttatttgattatatagatatattattttttatattagtctatataaattttattg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3286 AATATTTATTTGATTATATAGATATATTATTTTTTATATTAGTCTATATAAATTTTATTG 3227 Query 121 tttaaatttaattattataaaattaaagataattaatttttagtttaaaaaaagagttaa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3226 TTTAAATTTAATTATTATAAAATTAAAGATAATTAATTTTTAGTTTAAAAAAAGAGTTAA 3167 Query 181 taaattGCAGGATAAGTGaatttataaatacacataaatatattttttatgaaatattaa 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3166 TAAATTGCAGGATAAGTGAATTTATAAATACACATAAATATATTTTTTATGAAATATTAA 3107 Query 241 aaattaaaacattttataatattaattaattatttaataattagtattattttataaaaa 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3106 AAATTAAAACATTTTATAATATTAATTAATTATTTAATAATTAGTATTATTTTATAAAAA 3047 Query 301 aatacaaataaaaattaaaagaatattttaaaagtgttttaaaaCTTCGTTATTCTTTTA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3046 AATACAAATAAAAATTAAAAGAATATTTTAAAAGTGTTTTAAAACTTCGTTATTCTTTTA 2987 Query 361 TATTAATTTGatattaagaactaaaaccatttataaaatttaattcaaaattttttatag 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2986 TATTAATTTGATATTAAGAACTAAAACCATTTATAAAATTTAATTCAAAATTTTTTATAG 2927 Query 421 aaactaaaataaaaaaattatattcataaaaattaaatatatattttttaaatatatttt 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2926 AAACTAAAATAAAAAAATTATATTCATAAAAATTAAATATATATTTTTTAAATATATTTT 2867 Query 481 actataaatacaaattttgtttttttaCTCATAAAACTCGAACTTAATACCATATCGAAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2866 ACTATAAATACAAATTTTGTTTTTTTACTCATAAAACTCGAACTTAATACCATATCGAAC 2807 Query 541 CAATAGTATGATAGTAGAACCAAAAAATTAATTTATTTAACATTGTaaaaaaaaaTACAA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2806 CAATAGTATGATAGTAGAACCAAAAAATTAATTTATTTAACATTGTAAAAAAAAATACAA 2747 Query 601 TTTATTTAACCATTCTAATATTCTCTTTGTTGAATTTAATATAATTTTCATAGCAGTCGG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2746 TTTATTTAACCATTCTAATATTCTCTTTGTTGAATTTAATATAATTTTCATAGCAGTCGG 2687 Query 661 CCTTCCAACGGTGGAGTGGAGTTCATATTGTAAAACAGACGACGTGGGCCCATACGAAAT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2686 CCTTCCAACGGTGGAGTGGAGTTCATATTGTAAAACAGACGACGTGGGCCCATACGAAAT 2627 Query 721 AAGTGACCCAATAAAGTAACGCCGTGGTAACGATTAATCCAGATTCCAGTAGAAGGTTGC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2626 AAGTGACCCAATAAAGTAACGCCGTGGTAACGATTAATCCAGATTCCAGTAGAAGGTTGC 2567 Query 781 ATTCGACTCCGTCAAGATTAAACGCCAACTACCATTTCCCAATTGCAATTAATAATTTCC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2566 ATTCGACTCCGTCAAGATTAAACGCCAACTACCATTTCCCAATTGCAATTAATAATTTCC 2507 Query 841 GAGAAAGACCGCCCTGAACGCATTGGATACCAAAACTAAGCCAGATACAACAAGCAACCC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2506 GAGAAAGACCGCCCTGAACGCATTGGATACCAAAACTAAGCCAGATACAACAAGCAACCC 2447 Query 901 AACAACTAGCACCGAATGACATATAATCAAGACACGTGTCACAATTCTAGTGGTTACGTT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2446 AACAACTAGCACCGAATGACATATAATCAAGACACGTGTCACAATTCTAGTGGTTACGTT 2387 Query 961 TTTGACCCTTTTGCTATAAATTAACCCCAATGCTCCCATACAAATCGCAGTTTCATTTCT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2386 TTTGACCCTTTTGCTATAAATTAACCCCAATGCTCCCATACAAATCGCAGTTTCATTTCT 2327 Query 1021 ATTGAATTACTTTCTTTGAGCCCTATCTACTTCTCAACAAATCCTCAAGGTattttccat 1080 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2326 ATTGAATTCATTTCTTTGAGCCCTATCTACTTCTCAACAAATCCTCAAGGTATTTTCCAT 2267 Query 1081 ttcttttctgattttcgattcgggttttcgtctttcctttcgTAGATCGTTTAGAAATCG 1140 |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct 2266 TTCTTTTCTGATTTTCGATTCGGGTTTTCGTCTTTCCTTTCGTAGATCTGTTAGAAATCG 2207 Query 1141 ATTAGACAGAGTTTATATAAGCTATATTTATTAGAAATGATCTCAGATCGTTTTCTAATA 1200 ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| Sbjct 2206 ATTAGACAGAGTTTATATAAGCTTAATTTATTAGAAATGATCTCAGATCTGTTTCTAATA 2147 Query 1201 TATATTCTCAATAAATCTGTTTGAATTGCATGATCGTCAATTAGGTTTGTTGTATCTGGT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2146 TATATTCTCAATAAATCTGTTTGAATTGCATGATCGTCAATTAGGTTTGTTGTATCTGGT 2087 Query 1261 TTATGAACAGGTTTTGCATGAACGGATCTGATAACGTTTAATTTGAAATGCTTCATATTC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2086 TTATGAACAGGTTTTGCATGAACGGATCTGATAACGTTTAATTTGAAATGCTTCATATTC 2027 Query 1321 GTTTGTTATACACTGTTTTTAATATGTATTAGAGTCAATTCAATTTCTGGTGTTTGATTT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2026 GTTTGTTATACACTGTTTTTAATATGTATTAGAGTCAATTCAATTTCTGGTGTTTGATTT 1967 Query 1381 TAGTTTATTTGTTGTTTTGATCTCAAGCTGTTTTGGTCTGTTGTTATAGATTCATAATCC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1966 TAGTTTATTTGTTGTTTTGATCTCAAGCTGTTTTGGTCTGTTGTTATAGATTCATAATCC 1907 Query 1441 AGTTTCTAATTCGATTTCTGGCGTTTGATTCTGATTTATTTGTTGCTGCTACTTCCACAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1906 AGTTTCTAATTCGATTTCTGGCGTTTGATTCTGATTTATTTGTTGCTGCTACTTCCACAG 1847 Score Expect Identities Gaps Strand 243 bits(131) 4e-68 135/137(99%) 0/137(0%) Plus/Minus Query 1 CACGTGTCACAATTCTAGTGGTTACGTTTTTGACCCTTTTGCTATAAATTAACCCCAATG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2414 CACGTGTCACAATTCTAGTGGTTACGTTTTTGACCCTTTTGCTATAAATTAACCCCAATG 2355 Query 61 CTCCCATACAAATCGCAGTTTCATTTCTATTGAATTACTTTCTTTGAGCCCTATCTACTT 120 |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 2354 CTCCCATACAAATCGCAGTTTCATTTCTATTGAATTCATTTCTTTGAGCCCTATCTACTT 2295 Query 121 CTCAACAAATCCTCAAG 137 ||||||||||||||||| Sbjct 2294 CTCAACAAATCCTCAAG 2278 Score Expect Identities Gaps Strand 1561 bits(845) 0.0 861/869(99%) 0/869(0%) Plus/Minus Query 1 GAATTTAATATAATTTTCATAGCAGTCGGCCTTCCAACGGTGGAGTGGAGTTCATATTGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2715 GAATTTAATATAATTTTCATAGCAGTCGGCCTTCCAACGGTGGAGTGGAGTTCATATTGT 2656 Query 61 AAAACAGACGACGTGGGCCCATACGAAATAAGTGACCCAATAAAGTAACGCCGTGGTAAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2655 AAAACAGACGACGTGGGCCCATACGAAATAAGTGACCCAATAAAGTAACGCCGTGGTAAC 2596 Query 121 GATTAATCCAGATTCCAGTAGAAGGTTGCATTCGACTCCGTCAAGATTAAACGCCAACTA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2595 GATTAATCCAGATTCCAGTAGAAGGTTGCATTCGACTCCGTCAAGATTAAACGCCAACTA 2536 Query 181 CCATTTCCCAATTGCAATTAATAATTTCCGAGAAAGACCGCCCTGAACGCATTGGATACC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2535 CCATTTCCCAATTGCAATTAATAATTTCCGAGAAAGACCGCCCTGAACGCATTGGATACC 2476 Query 241 AAAACTAAGCCAGATACAACAAGCAACCCAACAACTAGCACCGAATGACATATAATCAAG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2475 AAAACTAAGCCAGATACAACAAGCAACCCAACAACTAGCACCGAATGACATATAATCAAG 2416 Query 301 ACACGTGTCACAATTCTAGTGGTTACGTTTTTGACCCTTTTGCTATAAATTAACCCCAAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2415 ACACGTGTCACAATTCTAGTGGTTACGTTTTTGACCCTTTTGCTATAAATTAACCCCAAT 2356 Query 361 GCTCCCATACAAATCGCAGTTTCATTTCTATTGAATTACTTTCTTTGAGCCCTATCTACT 420 ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 2355 GCTCCCATACAAATCGCAGTTTCATTTCTATTGAATTCATTTCTTTGAGCCCTATCTACT 2296 Query 421 TCTCAACAAATCCTCAAGGTattttccatttcttttctgattttcgattcgggttttcgt 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2295 TCTCAACAAATCCTCAAGGTATTTTCCATTTCTTTTCTGATTTTCGATTCGGGTTTTCGT 2236 Query 481 ctttcctttcgTAGATCGTTTAGAAATCGATTAGACAGAGTTTATATAAGCTATATTTAT 540 ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| Sbjct 2235 CTTTCCTTTCGTAGATCTGTTAGAAATCGATTAGACAGAGTTTATATAAGCTTAATTTAT 2176 Query 541 TAGAAATGATCTCAGATCGTTTTCTAATATATATTCTCAATAAATCTGTTTGAATTGCAT 600 |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct 2175 TAGAAATGATCTCAGATCTGTTTCTAATATATATTCTCAATAAATCTGTTTGAATTGCAT 2116 Query 601 GATCGTCAATTAGGTTTGTTGTATCTGGTTTATGAACAGGTTTTGCATGAACGGATCTGA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2115 GATCGTCAATTAGGTTTGTTGTATCTGGTTTATGAACAGGTTTTGCATGAACGGATCTGA 2056 Query 661 TAACGTTTAATTTGAAATGCTTCATATTCGTTTGTTATACACTGTTTTTAATATGTATTA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2055 TAACGTTTAATTTGAAATGCTTCATATTCGTTTGTTATACACTGTTTTTAATATGTATTA 1996 Query 721 GAGTCAATTCAATTTCTGGTGTTTGATTTTAGTTTATTTGTTGTTTTGATCTCAAGCTGT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1995 GAGTCAATTCAATTTCTGGTGTTTGATTTTAGTTTATTTGTTGTTTTGATCTCAAGCTGT 1936 Query 781 TTTGGTCTGTTGTTATAGATTCATAATCCAGTTTCTAATTCGATTTCTGGCGTTTGATTC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1935 TTTGGTCTGTTGTTATAGATTCATAATCCAGTTTCTAATTCGATTTCTGGCGTTTGATTC 1876 Query 841 TGATTTATTTGTTGCTGCTACTTCCACAG 869 ||||||||||||||||||||||||||||| Sbjct 1875 TGATTTATTTGTTGCTGCTACTTCCACAG 1847 NCBI reference XM_004496716.1 provides evidence that the sequence of NCBI NW_004515387.1 (bases 3691155 to 3695226) encompasses a sequence predicted to encode a Cicer arietinum polyubiquitin mRNA. See alignment of the two sequences below, mRNA sequence on top. Score Expect Identities Gaps Strand 2490 bits(1348) 0.0 1348/1348(100%) 0/1348(0%) Plus/Minus Query 294 AGATGCAAATCTTCGTGAAAACCCTCACCGGCAAGACAATCACTCTCGAGGTAGAGAGTT 353 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1848 AGATGCAAATCTTCGTGAAAACCCTCACCGGCAAGACAATCACTCTCGAGGTAGAGAGTT 1789 Query 354 CTGATACTATCGATAACGTAAAGGCCAAGATCCAGGACAAGGAAGGAATTCCTCCGGACC 413 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1788 CTGATACTATCGATAACGTAAAGGCCAAGATCCAGGACAAGGAAGGAATTCCTCCGGACC 1729 Query 414 AGCAACGTCTCATCTTCGCCGGAAAGCAGCTTGAGGACGGCCGTACCCTTGCCGACTACA 473 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1728 AGCAACGTCTCATCTTCGCCGGAAAGCAGCTTGAGGACGGCCGTACCCTTGCCGACTACA 1669 Query 474 ACATCCAGAAGGAGTCAACTCTCCATCTCGTCCTCCGTCTTCGTGGAGGCATGCAGATCT 533 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1668 ACATCCAGAAGGAGTCAACTCTCCATCTCGTCCTCCGTCTTCGTGGAGGCATGCAGATCT 1609 Query 534 TCGTCAAGACCCTCACAGGCAAGACCATCACTCTTGAGGTCGAAAGCTCCGACACCATCG 593 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1608 TCGTCAAGACCCTCACAGGCAAGACCATCACTCTTGAGGTCGAAAGCTCCGACACCATCG 1549 Query 594 ATAACGTTAAAGCCAAGATCCAAGACAAGGAAGGAATTCCCCCGGACCAGCAGAGACTTA 653 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1548 ATAACGTTAAAGCCAAGATCCAAGACAAGGAAGGAATTCCCCCGGACCAGCAGAGACTTA 1489 Query 654 TCTTCGCCGGAAAGCAACTTGAGGACGGTCGTACCCTCGCCGACTACAATATCCAGAAGG 713 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1488 TCTTCGCCGGAAAGCAACTTGAGGACGGTCGTACCCTCGCCGACTACAATATCCAGAAGG 1429 Query 714 AATCTACCCTTCATCTCGTCCTCCGTCTTCGTGGAGGTATGCAGATCTTTGTGAAGACCC 773 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1428 AATCTACCCTTCATCTCGTCCTCCGTCTTCGTGGAGGTATGCAGATCTTTGTGAAGACCC 1369 Query 774 TCACCGGTAAGACCATCACTCTCGAAGTTGAAAGCTCTGACACCATCGACAACGTGAAGG 833 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1368 TCACCGGTAAGACCATCACTCTCGAAGTTGAAAGCTCTGACACCATCGACAACGTGAAGG 1309 Query 834 CTAAGATCCAAGACAAGGAAGGAATCCCACCAGACCAGCAGAGACTCATCTTCGCCGGAA 893 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1308 CTAAGATCCAAGACAAGGAAGGAATCCCACCAGACCAGCAGAGACTCATCTTCGCCGGAA 1249 Query 894 AGCAGCTTGAAGATGGCCGCACCTTAGCTGACTACAACATCCAGAAGGAGTCAACCCTTC 953 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1248 AGCAGCTTGAAGATGGCCGCACCTTAGCTGACTACAACATCCAGAAGGAGTCAACCCTTC 1189 Query 954 ACCTTGTGTTGCGTCTTCGTGGTGGTATGCAAATCTTCGTGAAGACCCTCACTGGTAAAA 1013 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1188 ACCTTGTGTTGCGTCTTCGTGGTGGTATGCAAATCTTCGTGAAGACCCTCACTGGTAAAA 1129 Query 1014 CTATTACCCTTGAGGTGGAGAGTTCTGACACAATCGACAACGTTAAGGCCAAGATCCAGG 1073 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1128 CTATTACCCTTGAGGTGGAGAGTTCTGACACAATCGACAACGTTAAGGCCAAGATCCAGG 1069 Query 1074 ATAAGGAAGGTATTCCCCCAGATCAGCAGAGGTTGATCTTCGCCGGAAAGCAGCTGGAAG 1133 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1068 ATAAGGAAGGTATTCCCCCAGATCAGCAGAGGTTGATCTTCGCCGGAAAGCAGCTGGAAG 1009 Query 1134 ATGGAAGGACCCTCGCTGATTACAACATCCAGAAGGAGTCTACCCTTCACCTTGTGTTGC 1193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1008 ATGGAAGGACCCTCGCTGATTACAACATCCAGAAGGAGTCTACCCTTCACCTTGTGTTGC 949 Query 1194 GTCTTCGTGGTGGTATGCAGATTTTTGTGAAGACCTTGACTGGGAAGACAATTACCCTTG 1253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 948 GTCTTCGTGGTGGTATGCAGATTTTTGTGAAGACCTTGACTGGGAAGACAATTACCCTTG 889 Query 1254 AGGTGGAGAGCTCTGATACCATTGATAATGTGAAGGCAAAAATTCAGGATAAAGAAGGTA 1313 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 888 AGGTGGAGAGCTCTGATACCATTGATAATGTGAAGGCAAAAATTCAGGATAAAGAAGGTA 829 Query 1314 TCCCACCGGACCAGCAGAGGTTGATCTTTGCAGGGAAGCAGTTGGAGGATGGAAGGACCC 1373 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 828 TCCCACCGGACCAGCAGAGGTTGATCTTTGCAGGGAAGCAGTTGGAGGATGGAAGGACCC 769 Query 1374 TTGCTGATTACAATATTCAGAAGGAGTCCACCCTTCACCTTGTGCTCCGTCTTCGTGGTG 1433 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 768 TTGCTGATTACAATATTCAGAAGGAGTCCACCCTTCACCTTGTGCTCCGTCTTCGTGGTG 709 Query 1434 GTTTCTAATCTGTGGCTGTGGGATTAATATCTGTCTGATGTTTCTTTTACTTGTTGTGGA 1493 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 708 GTTTCTAATCTGTGGCTGTGGGATTAATATCTGTCTGATGTTTCTTTTACTTGTTGTGGA 649 Query 1494 AGTGATAGGGCCTGTGTTGGCCCAGTAGAATAAGTTTACGATGTTATGAATTTTATGGTT 1553 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 648 AGTGATAGGGCCTGTGTTGGCCCAGTAGAATAAGTTTACGATGTTATGAATTTTATGGTT 589 Query 1554 CTTTGTGAATAATGAATTAATCAGTACTTTTGCTTATGTAATTTGTGTATTATGTTTACT 1613 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 588 CTTTGTGAATAATGAATTAATCAGTACTTTTGCTTATGTAATTTGTGTATTATGTTTACT 529 Query 1614 TTTTATGACATGATTATGTTGTCAATTT 1641 |||||||||||||||||||||||||||| Sbjct 528 TTTTATGACATGATTATGTTGTCAATTT 501 Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to substitute the promoter of a ubiquitin gene from C. arietinum taught by Chakraborty for the upstream region another polyubiquitin gene in C. arietinum. One of ordinary skill in the art would have been motivated to substitute one ubi promoter for another, especially when transforming with more than one transgene, because using a single promoter can lead to silencing of genes in successive generations. One of ordinary skill in the art would have had reasonable expectation of success, because upstream regions of genes often comprise promoters, and ubiquitin promoters from the same species would be expected to successfully increase expression in the same species. The Ubi promoter of NCBI reference NW_004515387.1 reads on a recombinant polynucleotide comprising a fragment of at least 137 contiguous nucleotides of SEQ ID NO: 156 with regulatory activity, as well as a sequence that is at least 98% identical to the full length of a nucleic acid sequence of SEQ ID NO: 156. Vectors comprising the Ubi promoter and a Cry1Ac transgene read on the recombinant polynucleotide comprising a heterologous polynucleotide (claim 1) as well as a DNA construct comprising a heterologous transcribable polynucleotide molecule which is a gene of agronomic interest capable of providing plant pest control operably linked to the regulatory element polynucleotide (claims 3, 5 & 7). The transformed chickpea plants comprise and therefore read on a heterologous cell and a dicot plant cell stably transformed with the molecule or the construct (claims 8-10). The T1 & T2 progeny read on seeds of the transgenic plant (claim 12). Finally, the method of Chakraborty to transform chickpea modified by the promoter sequence found in NCBI reference NW_004515387.1 reads on increasing expression and thus reads on claims 13, 16, & 17. Applicant urges that claims 1, 3 and 13 are amended to recite a polynucleotide having at least 98% identity to the full length of SEQ ID NOs: 156-160 and a fragment comprising 137 contiguous nucleotides of a sequence selected from SEQ ID NO: 156-160. Applicant urges that the amended claims are patentable over the cited references (Remarks page 7, paragraph 2). This argument is unpersuasive, because NCBI Accession number NW_004515387.1 teaches a sequence that comprises at least a fragment comprising 137 contiguous nucleotides of SEQ ID NO: 156. Moreover, NCBI Accession number NW_004515387.1 teaches a sequence that comprises 1492 nucleotides identical to the full-length, 1506 nucleotide-long SEQ ID NO: 156. A sequence comprising 1492 identical nucleotides represents a sequence with at least 98% sequence identity to SEQ ID NO: 156 (1492/1506 ==.99). Claim(s) 4, 6, 8, 11, 14, 15 & 18 are rejected under 35 U.S.C. 103 as being unpatentable over Chakraborty, NCBI reference NW_004515387.1, and NCBI reference XM_004496716.1 as applied to claims 1, 3, 5, 7, 9-10, 12-13 & 16-17 above, and further in view of Abbitt et al US 2017/0218384 A1 (published 8/3/2017, hereafter Abbitt). Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 4/6/2026, as applied to claims 1 & 3-18. Applicant' s arguments filed 6/1/2026 have been fully considered but they are not persuasive. Claims 4, 6, 8, 11, 14, 15 & 18 are drawn to a DNA construct comprising a regulatory element polynucleotide further comprising a heterologous polynucleotide or a gene capable of providing herbicide resistance, a monocotyledon plant or heterologous cell stably transformed with the DNA construct, and a method for expressing a polynucleotide in a monocot plant comprising introducing a recombinant polynucleotide comprising a regulatory element capable of increasing expression of a polynucleotide encoding a gene product involved in organ development or an endogenous gene of the plant. Claim 14 requires the gene product be involved in organ development, stem cell development, cell growth stimulation, organogenesis, somatic embryogenesis initiation, and development of the apical meristem. Claims 13-18 do not require expression of a heterologous polynucleotide, only that the regulatory element is capable of increasing expression of one. The teachings of Chakraborty, NCBI reference NW_004515387.1, and NCBI reference XM_004496716.1 are presented above. They do not teach the DNA construct introduced into a monocot or the heterologous polynucleotide molecule as a gene providing herbicide resistance, encoding a gene producing involved in organ development, or an endogenous gene. Abbitt teaches ubiquitin promoters from sorghum, maize, and foxtail millet that allow transcription initiation in a plant (table 1, table 2). Abbitt teaches that isolation of ubiquitin promoters can serve as regulatory elements for constitutive expression of sequences of interest (paragraph [0004]). Abbitt teaches that the promoters were identified from sequences with coding sequences of related proteins and contain TATA boxes (paragraph [0167]). Abbitt teaches transformation of plants expressing GUS under one of the Ubi promoters, and seeds were grown to evaluate T1 expression (paragraph [0168]). All transformants produced a positive GUS stain. Abbitt also teaches chimeric synthetic promoters including the Ubi regulatory elements and elements from other promoters, and teaches a motivation to include regulatory elements from various promoters to create promoters that are stronger or have a different expression pattern (paragraph [0172] table 4). Abbitt envisions the transformation of other plants with these sequences, such as chickpea and other legumes in addition to monocots (paragraph [0056 & 0053]). Abbitt also envisions methods of increasing expression of an endogenous polynucleotide sequence encoding a polypeptide involved in abiotic stress tolerance by inserting a heterologous regulatory polynucleotide fragment of an ubi promoter into the maize genome (Abbitt claims 30-31). Abbitt teaches methods of expressing polynucleotides in a plant by introducing recombinant polynucleotides comprising a regulatory element comprising a fragment or variant of the ubi promoters of Abbitt SEQ ID NO: 1-6, wherein the heterologous polynucleotide of interest encodes a gene product involved in organ development, stem cell development, cell growth stimulation, organogenesis, somatic embryogenesis initiation, and development of the apical meristem, or wherein the gene product confers herbicide tolerance, or is an endogenous gene of the plant (paragraphs [0017-0018]). Abbitt teaches that Bacillus thuringiensis proteins are one example of insect resistance genes that can be used with the regulatory sequences (paragraphs [0068-0070]). Before the effective filing date of the instant application, it would have been obvious to one of ordinary skill in the art to modify the chickpea transformation method of Chakraborty to transform a monocot such as maize, as taught by Abbitt. One of ordinary skill in the art would have been motivated to transform a maize plant with a Bt gene such as cry1Ac to provide insect resistance. One of ordinary skill in the art would have had reasonable expectation of success to substitute one ubiquitin promoter for another, because ubiquitin promoters were known as constitutive promoters suitable for expression of transgenes. Thus, a monocot plant stably transformed with the DNA construct comprising the Cicer arietinum promoter reads on the monocotyledon plant cell of instant claim 11, the heterologous cell of claim 8, and the method of increasing expression of a heterologous polynucleotide of instant claim 18. Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to modify the Cicer arietinum ubi promoter taught by NCBI reference NW_004515387.1 to also comprise heterologous polynucleotide sequence comprising regulatory element regions of other promoter regions, as taught by Abbitt. One of ordinary skill in the art would have been motivated to do so in order to strengthen or modify the expression pattern of the promoter. One of ordinary skill in the art would have had reasonable expectation of success, because Abbitt created such chimeric synthetic promoters using ubi promoters from sorghum and foxtail millet. Thus, instant claim 4 requiring the regulatory element polynucleotide further comprising a heterologous polynucleotide is obvious. Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to substitute an herbicide tolerance gene, a gene encoding a product involved in organ development, or an endogenous polynucleotide sequence encoding a polypeptide involved in abiotic stress tolerance for the cry1Ac insect resistance gene in the method taught by Chakraborty. One of ordinary skill in the art would have been motivated to do so, because Abbitt suggests that such genes would appropriate to place under regulatory control of a ubi promoter and that ubi promoters provide constitutive expression of transgenes. One of ordinary skill in the art would have had reasonable expectation of success, because ubiquitin promoters were known to serve as regulatory elements for constitutive expression of heterologous nucleotide sequences of interest. Thus, a DNA construct comprising the regulatory element polynucleotide operably linked to a gene capable of providing herbicide resistance (instant claim 6) and a method for expressing a heterologous polynucleotide encoding a gene product involved in organ development, stem cell development, cell growth stimulation, organogenesis, somatic embryogenesis initiation, and development of the apical meristem, a gene product that confers herbicide tolerance, or an endogenous gene of the plant (instant claims 14-16) are obvious. Claims 1, 3, 5, 7, 9-10, 12-13 & 16-17 are mapped to the teachings of Chakraborty, NCBI reference NW_004515387.1, and NCBI reference XM_004496716.1 above. Therefore, claims 1 & 3-18 are obvious over Chakraborty, NCBI reference NW_004515387.1, NCBI reference XM_004496716.1, and Abbitt. Applicant urges that claims 1, 3 and 13 are amended to recite a polynucleotide having at least 98% identity to the full length of SEQ ID NOs: 156-160 and a fragment comprising 137 contiguous nucleotides of a sequence selected from SEQ ID NO: 156-160. Applicant urges that the amended claims are patentable over the cited references (Remarks page 7, paragraph 4 & 6). This argument is unpersuasive, because NCBI Accession number NW_004515387.1 teaches a sequence that comprises a fragment comprising 137 contiguous nucleotides of SEQ ID NO: 156 as well as a sequence that comprises 1492 nucleotides identical to the 1506 nucleotide-long SEQ ID NO: 156, which represents a sequence with at least 98% sequence identity to the full length of SEQ ID NO: 156. Claim(s) 1, 3, 8-10, 13 & 17 are rejected under 35 U.S.C. 103 as being unpatentable over Peykari et al (2019) Crop Biotech. 25: 35-45 (published 2019, hereafter Peykari; uploaded with English machine translation appended to end of the file) in view of NCBI reference NW_004515387.1 (bases 3691155 to 3695226, available 12/27/2018) taken with the evidence of NCBI reference XM_004496716 (available 6/8/2015). Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 4/6/2026, as applied to claims 1-3, 9-10, 13 & 17. Applicant' s arguments filed 6/1/2026 have been fully considered but they are not persuasive. Claim(s) 1, 3, 8-10, 13 & 17 are drawn to a recombinant polynucleotide comprising a polynucleotide with at least 98% sequence identity to SEQ ID NO: 156-160 or 137 contiguous nucleotides of SEQ ID NO: 156-160, a DNA construct comprising the regulatory element polynucleotide, or a heterologous cell or transgenic plant comprising the DNA construct or nucleic acid molecule and a method for expressing a polynucleotide in a plant comprising introducing into a plant cell a recombinant polynucleotide comprising a regulatory element comprising a nucleotide sequence at least 98% identical to SEQ ID NO: 156-160 or a fragment of at least 137 contiguous nucleotides with regulatory activity in a plant cell. Claims 13 & 16-17 do not require expression of a heterologous polynucleotide, only that the regulatory element is capable of increasing expression of one. Peykari teaches a polyubiquitin promoter for the Cicer arietinum CaUBQ10 gene to express a β-glucoronidase reporter gene in tobacco (abstract). Peykari teaches that using the natural promoter of a plant for gene expression in the same plant is more efficient compared to gene expression from a promoter of human origin (page 36, right column; see page 1 of machine translation appended to original document). Peykari teaches that housekeeping genes, including ubiquitins, are excellent candidates for isolating high-expression, persistent promoters (page 36, left column; page 2 of machine translation). Peykari teaches amplifying the CaUBQ10 promoter by PCR from genomic DNA, cloning the promoter into plant vector pBI121, and transferring the construct into Agrobacterium strain AGL1 (page 37, left column; page 4 of machine translation). Peykari teaches that cleavage sites of MspI and Xba1 were selected for the primers for cloning (page 37, left column; page 4 of machine translation). Tobacco plants were transformed with the construct comprising the CaUBQ10 promoter and transgenic plants were transferred to soil after 4 months and confirmed with PCR (page 41, left column; page 12 of machine translation). Plants transfected with the CaUBQ10 promoter construct had staining (figure 3), showing that CaUBQ10 functions as a promoter in dicotyledonous plants (page 41 left column; page 12 of machine translation). Figure 1 depicts the DNA construct comprising the CaUBQ10 promoter and a gusA gene. Peykari teaches that the genomic sequence used for the design of the primers comes from GenBank reference NC_021163.1 (page 37, left column, paragraph 1; page 4 of machine translation). Peykari teaches that the CaUBQ10 promoter has a large number of TATA-box and CAAT box elements as well as other known motifs but no DPE promoter element downstream of the promoter (table 2, page 39, right column; page 7 of machine translation). Peykari does not teach the sequence of the CaUBQ10 promoter. The teachings of NCBI reference NW_004515387.1 and NCBI reference XM_004496716.1 are presented above. Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of Peykari to substitute the undisclosed sequence of the CaUBQ10 promoter for the sequence taught by NCBI reference NW_004515387.1. One of ordinary skill in the art would have been motivated to substitute one ubiquitin promoter for another promoter of a homologous gene of the same species through routine optimization of the ubi promoter sequence. One of ordinary skill in the art would have had reasonable expectation of success, because Peykari teaches that promoters of ubiquitins are excellent candidates for isolating high-expression, persistent promoters. Thus, the construct comprising a GUS reporter gene linked to a polynucleotide comprising a CaUBQ10 regulatory element makes obvious the recombinant polynucleotides of claim 1, the DNA construct of claim 3, the stably transformed heterologous cell and transgenic plants of claims 8-10, and the method for expressing a polynucleotide in a plant of claims 13 & 17. Applicant urges that claims 1, 3 and 13 are amended to recite a polynucleotide having at least 98% identity to the full length of SEQ ID NOs: 156-160 and a fragment comprising 137 contiguous nucleotides of a sequence selected from SEQ ID NO: 156-160. Applicant urges that the amended claims are patentable over the cited references (Remarks page 8, paragraph 2). This argument is unpersuasive, because NCBI Accession number NW_004515387.1 teaches a sequence that comprises a fragment comprising 137 contiguous nucleotides of SEQ ID NO: 156 as well as a sequence that comprises 1492 nucleotides identical to the 1506 nucleotide-long SEQ ID NO: 156, which represents a sequence with at least 98% sequence identity to the full length of SEQ ID NO: 156. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-4pm EDT. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /VICTORIA L DELEO/Examiner, Art Unit 1662 /Anne Kubelik/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Jan 23, 2023
Application Filed
Sep 18, 2025
Non-Final Rejection mailed — §103, §112
Jan 20, 2026
Response Filed
Apr 06, 2026
Final Rejection mailed — §103, §112
Jun 01, 2026
Response after Non-Final Action
Jun 18, 2026
Request for Continued Examination
Jun 22, 2026
Response after Non-Final Action
Jul 14, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12698509
COMPOSITIONS AND METHODS FOR CONTROLLING COLEOPTERAN INSECTS
2y 5m to grant Granted Aug 04, 2026
Patent 12668614
USE OF GLYCINE MAX GmSAMMT GENE IN REGULATION OF PROTEIN CONTENT AND/OR YIELD OF PLANT
2y 2m to grant Granted Jun 30, 2026
Patent 12584117
Use of Gene Encoding Gibberellin 3Beta-Hydroxylase of Glycine Max, GmGA3ox1
2y 11m to grant Granted Mar 24, 2026
Patent 12577577
COMPOSITIONS AND METHODS TO INCREASE RESISTANCE TO PHYTOPHTHORA SOJAE IN SOYBEAN
2y 9m to grant Granted Mar 17, 2026
Patent 12545926
NUCLEIC ACID MOLECULES FOR CONFERRING INSECTICIDAL PROPERTIES IN PLANTS
2y 3m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
37%
Grant Probability
-3%
With Interview (-40.0%)
2y 6m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 27 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month