DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 62-63, 66-68 & 72-73 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected Group, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 3/27/2025. No further traverse was filed in response to the Office Action mailed 5/30/2025.
The requirement is still deemed proper and is therefore made FINAL.
Status of Claims
Claims 47-49, 51, 53-56, 58-59 & 76 are under examination on the merits.
Claims 62-63, 66-68, & 72-73 are withdrawn as directed to an unelected Group.
The objection to the specification is withdrawn in light of Applicant’s amendments.
The rejection of claim 47 as being unpatentable over claim 1 of U.S. Patent No. US 11,326,177 B2
(Price et al, patented 5/10/2022, hereafter 177) is withdrawn in light of Applicant’s amendments.
The rejection of claims 47 & 53 as being unpatentable over claims 2 & 16 of copending Application No. 18/007,019 is withdrawn in light of Applicant’s amendments.
The rejection of claims 47 & 54 as being unpatentable over claims 1 & 14 of copending Application No. 18/357,624 is withdrawn in light of Applicant’s amendments.
Claim Objections
Claim 49 is objected to because of the following informalities:
Claim 49 (lines 5, 7): “5 or 3” should read --5’ or 3’--.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 49 & 51 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 5/30/2025, as applied to claims 47-49, 51, 53 & 76-77. Applicant' s arguments filed 9/2/2025 have been fully considered but they are not persuasive.
Claims 49 & 51 recite the limitation "the DNA junction polynucleotide" in lines 9-10 & 12 (claim 49) and lines 5 and 7-8 (claim 51). There is insufficient antecedent basis for this limitation in the claims because it is unclear whether this refers to the first DNA junction polynucleotide (claim 49, lines 5 & 8; claim 51, lines 4, 5-6) or the second DNA junction polynucleotide (as in claim 47, line 9).
Applicant urges that amendments to claims 47 and 49 overcome the previous indefiniteness of the claims regarding multiple interpretations of the steps of the method of claim 47 and the list of compounds in claim 49 (Remarks, page 10, paragraph 3-page 11, paragraph 2).
This argument is unpersuasive to the current rejection, because the amendments introduce additional issues regarding indefinite antecedent basis.
Improper Dependency
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 76 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
This is a new rejection necessitated by Applicant' s amendment of the claims
Claim 76 is drawn to the method of claim 48 wherein the original transgenic locus is located in the transgenic plant genome (lines 1-2). Claim 48 depends on independent claim 47, however, which requires “an original transgenic locus of an original transgenic plant genome” (line 4) and that the original transgenic locus of the original transgenic plant genome comprises an originator guide RNA recognition site located in non-transgenic plant genomic DNA (lines 6-8). The original transgenic locus of claim 47 already must be located in the transgenic plant genome in order for the ogRRS (which the original transgenic locus comprises) to be located in plant genomic DNA. Claim 76 therefore does not further limit the method of claims 48 and 47.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 47-48, 53 & 76 are rejected under 35 U.S.C. 103 as being unpatentable over Finnigan et al (2016) G3 Genes|Genomes|Genetics. 6(7): 2147-2156 (published 7/1/2016, hereafter Finnigan) and Cui et al (US 9540655 B2 patented 1/10/2017, hereafter Cui), taken with the evidence of Mason et al (US 2024/0074376 A1, published 3/7/2024, hereafter Mason).
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 5/30/2025, as applied to claims 47-48, 53 & 76-77. Applicant' s arguments filed 9/2/2025 have been fully considered but they are not persuasive.
Claims 47-48, 53 & 76 are drawn to a method comprising introducing into a soybean DAS44406-6 original transgenic locus a CgRRS in a DNA junction polynucleotide in a DNA junction polynucleotide of an original DNA junction polynucleotide to form a modified transgenic locus, wherein the plant genome comprises an OgRRS located in non-transgenic plant genomic DNA of a DNA junction polynucleotide and wherein the CgRRS comprises a nucleotide sequence which is identical to a nucleotide sequence of the OgRRS.
Finnigan teaches a method of genome editing using CRISPR/Cas9 wherein an artificial Cas9 target sequence is introduced into a genome to allow Cas9 gene manipulation with a single sgRNA (page 2148, left column, paragraph 2; figure 1A). In the method of Finnigan, Cas9 target sites were introduced upstream and downstream of endogenous CDC11 and SHS1 genes by creating constructs with flanking target sites via PCR and transforming the constructs into yeast (page 2148, left column, paragraph 3-right column, paragraph 3; figure 1). Finnigan teaches that the inserted PAM-containing sequence was designed not to match any other site in the yeast genome by more than a few nucleotides (page 2149, right column, paragraph 4). Finnigan teaches a method wherein Cas9 is induced in the transformed yeast strains comprising a gene for Cas9 prior to transformation with an sgRNA targeting the introduced target sites and a homologous PCR fragment (page 2150, right column, paragraph 2-page 2151, left column, paragraph 1; figure 4B) and teaches a motivation to have the Cas9expression cassette flanked by a different target site so that additional Cas9-dependent integration or deletion events, including deletion of the Cas9 transgene itself, can be achieved at other loci with the introduction of a plasmid expressing a different sgRNA (page 2151, left column, paragraph 2). Finnigan teaches screening yeast colonies for successful homologous repair of the CDC11 and SHS1 loci with wildtype CDC with a URA3 marker or a LEU2 marker (figure 2, legend).
Finnigan teaches a motivation for using a system with Cas9-sgRNA, because the enzyme allows precise placement of a double-strand break in any desired location within a genome of interest, which can be sealed by homologous recombination to substitute a modification (page 2148, left column, paragraph 2). Finnigan further teaches a motivation for flanking the target genes with identical sites for Cas9-catalyzed DSB formation to force repair of the resulting lesions by homologous recombination with provided PCR fragments, allow replacement of multiple loci using a single sgRNA, allow concomitant self-excision of the Cas9-expressing cassette, and avoid spurious Cas9 multiplex genome editing events (page 2150, left column, paragraph 3-right column, paragraph 1).
Finnigan teaches that Cas9-mediated genome alterations have successfully been achieved in plants (page 2148, left column, paragraph 1).
Finnigan does not teach introducing a cognate guide RNA recognition site in a DNA junction polynucleotide of an original plant transgenic locus such as DAS44406-6 nor a method wherein the CgRRS or OgRRS is located in non-transgenic genomic DNA of the DNA junction polynucleotide.
Cui teaches a transgenic soybean event pDAB8264.4406.1 (abstract). Cui teaches the event comprising a pat selectable marker (column 28, lines 8-16 and figure 1). Cui teaches the sequence of the genomic insertion site including a 5’ flanking border sequence (SEQ ID NO: 1) and a 3’ flanking border sequence (SEQ ID NO: 2) both of which were of soybean origin and could be used for identification of soybean event pDAB8264.44.06.1 (column 30, lines 34-46).
Cui teaches a motivation to excise polynucleotide sequences from a transgenic event to overcome unintended changes to the plant transcriptome or to excise a selectable marker in order to re-use the marker (column 16, lines 1-16). Cui suggests introducing heterologous nucleic acids into a pre-established target site on chromosome 6 in the soybean genome because it is an excellent site for insertion of heterologous nucleic acids (column 6, lines 17-25). Cui suggests that excision could be accomplished by zinc finger nucleases (column 16, lines 3-7).
Mason provides evidence that soybean event DAS-44406-6 is the subject of Cui (US 9,540,655 B2) (paragraph [0080]).
Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of Finnigan of the targeted insertion of artificial Cas9 target sequence into a genome to use a plant genome instead of a yeast genome and to target a transgenic locus instead of an endogenous gene as suggested by Cui. One of ordinary skill in the art would have been motivated to use the method of Finnigan on the DAS44406-6 soybean transgenic locus of Cui because Cui teaches that excising part or all of the transgenic locus would allow re-use of the selectable marker or to replace the locus with another heterologous polynucleotide in what Cui demonstrates is an excellent site for insertion of heterologous nucleic acids. One of ordinary skill in the art would have had reasonable expectation of success because Cui suggests excising the locus and Finnigan teaches that Cas9-mediated genome alterations have successfully been achieved in plants.
The instant specification defines a CgRRS as a DNA polynucleotide comprising a PAM site operably linked to a guide RNA hybridization site, absent from transgenic plant genomes with an original transgenic locus and capable of hybridizing to a single gRNA with an OgRRS (paragraph [0068]). Inserting the CgRRS in the DNA junction polynucleotide of the transgenic event would have allowed excision and replacement of the transgenic locus as suggested by Cui.
In the method taught by Finnigan, the recognition sites are 5’ and 3’ of the targeted endogenous gene locus. In a transgenic plant locus such as DAS44406-6, to have the guide RNA recognition sites 5’ and 3’ of the targeted locus in order to excise and or substitute the full transgenic locus, the guide RNA recognition sites of both the CgRRS and the OgRRS would need to be located in non-transgenic plant genomic DNA of the DNA junction polynucleotide.
That the CgRRS comprises a nucleotide sequence which is identical to a nucleotide sequence of the OgRRS requires as little as 2 consecutive nucleotides to be identical between the CgRRS and OgRRS, which would be highly likely just through random chance or if the OgRRS and CgRRS are designed to be cut by the same Cas endonuclease because the PAM sites would share 2 consecutive nucleotides (e.g. NGG or TTTV). However, Finnigan also teaches a motivation to insert target sites upstream and downstream of the target locus that are identical so that the genome editing can be accomplished with a single guide RNA, which makes CgRRS and OgRRS that are identical across their full polynucleotide sequence obvious.
Thus, a method comprising introducing a PAM site and guide RNA recognition site in a DNA junction polynucleotide of a DAS44406-6 transgenic locus in a DNA junction polynucleotide of the locus (instant claims 47, 48, 53, and 76) would be obvious over Finnigan, Cui, and Mason.
Applicant urges that cited references must teach or suggest the claimed invention or an objective motivation to modify or combine the reference to arrive at the claimed invention, and where the insight underlying difference from the prior art is contrary to the expectations or teachings of the art, elements effectuating it would not have been obvious to those skilled in the art (Remarks, page 13, paragraph 3). Applicant urges that Finnigan teaches away from using target sequences that normally exist in the genome and provides rationales for why the target sequence should not be naturally occurring, which is in contrast to amended claim 47 which requires an identical copy of a pre-existing cleavage site such that one target sequence is present at one end of the gene of interest and the other target sequence is present at the other. Applicant urges that claimed methods involve insertion of a CgRRS that is “(definitionally) an identical copy of an… OgRRS” (Remarks, page 14, paragraph 2) and comprises naturally-occurring non-transgenic DNA present both in the transgenic plant genome and in the non-transgenic plant genome (Remarks, page 14, paragraph 2).
This argument is unpersuasive, because teaching that an alternative is better is not the same as teaching not to do something and does not make a method nonobvious.
Furthermore, the original disclosure (paragraph [0068]) merely defines CgRRS as a DNA polynucleotide comprising a PAM site operably linked to a guide RNA hybridization site, where the CgRRS is absent from transgenic plant genomes comprising a first original transgenic locus. That the CgRRS and OgRRS can hybridize to a single gRNA would not require that the CgRRS and OgRRS are identical, although this is taught by Finnigan’s method. Given that the CgRRS and OgRRS are DNA polynucleotides, if the CgRRS and OgRRS were “definitionally” identical like Applicant argues in Remarks, then the OgRRS must not be found in the non-transgenic or even the transgenic plant genome. If the OgRRS is found in the original transgenic plant genome, a DNA polynucleotide identical to the CgRRS would not be absent from the original transgenic plant genome and so it could not be a CgRRS.
Applicant urges that Finnigan relates to methods of installing synthetic sequences into a genome of interest that have no detectable counterpart in the genome of interest, whereas the instant claims utilize cleavage target sequences that exist within the genome of interest (Remarks page 14, paragraph 3-page 15, paragraph 4). Applicant urges that the specification notes that the CgRRS comprise at least 18 nucleotides of identical DNA sequence (paragraphs [90, 113]) and are thus drawn to a duplication of a naturally occurring sequence, which is not disclosed or suggested by Finnigan (Remarks, page 15, paragraph 4).
This argument is unpersuasive, because a requirement that the CgRRS comprise at least 18 nucleotides of identical DNA sequence to the OgRRS is not found in the claims, merely that the OgRRS and CgRRS can hybridize to one first gRNA. Thus, the CgRRS does not need to be a naturally occurring sequence. Additionally, the definition of the CgRRS in the specification (paragraph [0068]) does not require that the sequence be a “duplication”. Given that the CgRRS and OgRRS are DNA polynucleotides, if the CgRRS and OgRRS were “definitionally” identical like Applicant argues in Remarks, then the OgRRS must not be a naturally occurring sequence in the plant genome. If the OgRRS is naturally occurring in the original transgenic plant genome, a DNA polynucleotide identical to the CgRRS would not be absent from the original transgenic plant genome and so it could not be a CgRRS.
Applicant urges that Finnigan teaches away from using Endogenous Target sequences because non-naturally occurring target sequences reduce or eliminate off-target effects, and that alien target sequences are critical to function and performance of their methods. Applicant urges that a skilled artisan would expect that modifying Finnigan to arrive at the instant claims would lead to off-target effects and limited target site availability (Remarks, page 16, paragraphs 4).
This argument is unpersuasive, because teaching that an alternative is better is not the same as teaching not to do something and does not make a method nonobvious. In order to excise and or substitute a full transgenic locus, as suggested by Cui, the guide RNA recognition sites of both the CgRRS and the OgRRS would need to be located in non-transgenic plant genomic DNA of the DNA junction polynucleotide. Following Finnigan’s method to insert non-naturally occurring target sequences would not cause limited target site availability.
Claims 49, 51, 54-56, & 58-59 are rejected under 35 U.S.C. 103 as being unpatentable over Finnigan, Cui, and Mason as applied to claims 47-48, 53 & 76 above, and further in view of Cermák (US 11,041,172 B2, patented 6/22/2021, filed 6/24/2020 with an inventor not found on the instant application, hereafter Cermak).
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 5/30/2025, as applied to claims 47-49, 51, 53-56, 58-59 & 76-77. Applicant' s arguments filed 9/2/2025 have been fully considered but they are not persuasive.
Claims 49, 51, 54-56, & 58-59 are drawn to a method comprising introducing a CgRRS in a DNA junction polynucleotide wherein the introduction is by contacting the original locus with an RNA dependent DNA endonuclease and guide RNA comprising an RNA equivalent of the DNA located immediately adjacent to an original PAM site located within the DNA junction polynucleotide of the original transgenic locus, or with a ZFN recognizing a DNA junction polynucleotide of the original transgenic locus, and a donor DNA template spanning a double stranded DNA break site in the DNA junction polynucleotide or to a method of excising a modified locus comprising a CgRRS and an OgRRS.
The teachings of Finnigan, Cui, and Mason are presented above. The sequence of the Cui SEQ ID NO: 1 (5’ region flanking the DAS44406-6 event) is provided below with potential PAM sites for Cas endonucleases underlined. They do not teach the introduction of the CgRRS by contacting with an RNA dependent DNA endonuclease and guide RNA Or ZFN.
Cui SEQ ID NO: 1
agcttaacat acaagtaatg taatccacag tacgaaaaat gtgcaggttc ttatttgtgc 60
tccataattg tttcttgatt ccgatcaaag caagagcatc cagtctcaaa attttgtctt 120
ctcaattcac tcattcatca aaatcagcag ttttatgcat caacaagcat ggaatgttga 180
accacccatg attaagcccc atatcgttgt gttgagataa ctatcacctg aagttgtctt 240
ataaaaaaca catctgaata cttttataat catacctttc tcggcctttt ggctaagatc 300
aagtgtagta tctgttctta tcagtttaat atctgatatg tgggtcattg gcccacatga 360
tattaaattt attttttgaa gggtggggcc tgacatagta gcttgctact gggggttctt 420
aagcgtagcc tgtgtcttgc actactgcat gggcctggcg caccctacga ttcagtgtat 480
atttatgtgt gataatgtca tgggttttta ttgttcttgt tgtttcctct ttaggaactt 540
acatgtaaac ggtaaggtca tcatggaggt 570
Cermak teaches a method of genome editing in plants comprising introducing into tomato protoplasts plant expression vectors expressing CAS nucleases and gRNA and carrying a donor DNA template region, along with an exonuclease, SSAP protein and SSB protein, leading to at least one precise insertion of the replacement DNA segment (column 91, line 33- column 92 line 32; claim 2; table 3). Cermak envisions the use of a CRISPR endonuclease with unique PAM recognition site and a guide RNA that form an RNA-guided endonuclease/guide RNA complex to specifically bind the sequence in the gDNA target editing site (column 37, lines 14-24; table 3). Cermak teaches that the PAM site is determined by the RNA-guided endonuclease used, and that Cas12a proteins are used with T-rich 5’-TTTV PAM sites while Cas9 proteins are used with 5’-NGG PAM sites (column 37, lines 24-31). Cermak teaches that guide RNA binds a gDNA target adjacent to the PAM site (column 37, lines 20-24). Cermak teaches that the DNA donor template of the method includes the insertion region flanked on both sides by homology arms about 600-800 bp in length matching gDNA regions flanking the target gDNA insertion site and that the replacement template region comprising the donor DNA was furthermore flanked at each end by DNA sequences identical to the target gDNA recognized by the RNA-guided nuclease (column 91, lines 13-24).
Cermak teaches zinc finger nucleases (ZFN) as an alternative endonuclease capable of effecting site-specific modification of a target nucleotide sequences of the method (column 39, lines 28-39). Cermak teaches that ZFN can be engineered to specifically recognize any desired target DNA sequence (column 39, lines 37-39) and that using a restriction endonuclease such as Fok1 as the nucleic acid cleavage domain in the ZFN enables more specific targeting of long and potentially unique recognition sites because of the requirement for two adjacent and independent binding events (column 40, lines 14-22).
Cermak teaches a motivation to use homology-directed repair as a genome editing method, because it allows precise replacement of a target genomic site (column 1, lines 28-33). Cermak envisions selecting a cell with the genetic modification of the target editing site by using a selectable marker rather than sequencing the cell (column 52, lines 16-22).
Before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of Finnigan, Cui, and Mason to introduce the CgRRS by homologous recombination as taught by Cermak. One of ordinary skill in the art would have been motivated to use the homology directed repair method of Cermak because it allows precise replacement of a target genomic site, for example with a donor DNA comprising a CgRRS. One of ordinary skill in the art would have had reasonable expectation of success because Cermak demonstrated the method in a dicotyledonous plant and the transgenic locus of Cui is a dicotyledonous plant.
Alternatively, before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of Finnigan, Cui, and Mason to insert a CgRRS into transgenic locus of DAS44406-6 following the method of Cermak and then excise the transgenic locus. One of ordinary skill in the art would have been motivated to insert a CgRRS in a second DNA junction polynucleotide when an OgRRS is in a first DNA junction polynucleotide in order to excise and substitute the transgenic locus because Cui teaches a motivation to replace the transgenic locus with another heterologous nucleic acid sequence, and this would allow excising the full locus. One of ordinary skill in the art would have been motivated to insert a CgRRS that can hybridize to a first guide RNA that also hybridizes with the OgRRS because Finnigan teaches that identical Cas target sites at each side of the target locus can force repair of the resulting lesions by homologous recombination with provided PCR fragments, allow replacement of multiple loci using a single sgRNA, allow concomitant self-excision of the Cas9-expressing cassette, and avoid spurious Cas9 multiplex genome editing events. That the PAM site and guide RNA recognition site are in operable linkage would be obvious to one of ordinary skill in the art because Cermak teaches that the PAM site is adjacent to the gDNA sequence recognized by the gRNA. Likewise, Cermak teaches that the endonuclease would recognize the OgRRS/gRNA and CgRRS/gRNA hybridization complex in Cas endonuclease cutting. One of ordinary skill in the art would have had reasonable expectation of success because both methods could be performed in plants.
Thus, it would have been obvious to introduce the CgRRS by contacting the original transgenic locus with a ZFN recognizing a DNA junction polynucleotide of the original transgenic locus and a donor DNA template spanning a double stranded DNA break site in the DNA junction polynucleotide wherein the donor DNA comprises a guide RNA hybridization site and selecting a transgenic plant cell comprising the CgRRS (claim 51).
Regarding claim 49, the transgenic event taught by Cui comprises many potential PAM sites for Cas endonuclease proteins, see sequence above. A gRNA designed to excise the transgenic locus of DAS44406-06 could be designed to target the regions near these original PAM sites. The exact guide RNA used in the method of Cermak and whether it was immediately 5’ or 3’ of one of the pre-existing PAM sites in the DNA junction polynucleotide of the original transgenic locus would be a design choice for one of ordinary skill in the art. A method wherein the guide RNA comprises an RNA equivalent of the DNA immediately 5’ or 3’ to an original PAM site would be obvious to one of ordinary skill in the art at the time of filing of the instant application. Thus, the method of claim 49 is also obvious over Cermak, Finnigan, Cui, and Mason.
Regarding claims 54, 55, 58 and 59, the method of Cermak envisions selecting a transgenic event wherein the target locus has been substituted, which reads on excised (instant claim 54). Because the instant specification defines a plant to include a tissue and a plant tissue to include a protoplast (paragraph [0060]), and because Cui teaches a motivation to substitute or excise the DAS4406-6 transgenic locus, the modified method of Finnigan, Cui, Mason, and Cermak reads on instant claims 58 and 59. Finally, Cermak teaches the RNA dependent DNA endonuclease and gRNA introduced into the protoplasts through a construct including the gRNA and encoding the endonuclease, which reads on instant claim 55.
Regarding claim 56, Finnigan teaches the method wherein the transgenic yeast comprises a Cas9-expressing cassette and subsequently is transformed with another plasmid comprising a sgRNA (which reads on a gRNA) for the targeting and removal of another locus within the cell, in this example the Cas9 locus itself. In the combined method of Finnigan, Cui, Mason, and Cermak, it would have been obvious to use a similar sequential editing method in a plant transgenic locus.
Thus, claims 47-49, 51, 53-56, 58-59 & 76 are obvious over Finnigan, Cui, Mason, and Cermak.
Applicant urges that cited references must teach or suggest the claimed invention or an objective motivation to modify or combine the reference to arrive at the claimed invention, and where the insight underlying difference from the prior art is contrary to the expectations or teachings of the art, elements effectuating it would not have been obvious to those skilled in the art (Remarks, page 13, paragraph 3). Applicant urges that Finnigan teaches away from using target sequences that normally exist in the genome and provides rationales for why the target sequence should not be naturally occurring, which is in contrast to amended claim 47 which requires an identical copy of a pre-existing cleavage site such that one target sequence is present at one end of the gene of interest and the other target sequence is present at the other. Applicant urges that claimed methods involve insertion of a CgRRS that is “(definitionally) an identical copy of an… OgRRS” (Remarks, page 14, paragraph 2) and comprises naturally-occurring non-transgenic DNA present both in the transgenic plant genome and in the non-transgenic plant genome (Remarks, page 14, paragraph 2).
This argument is unpersuasive, because teaching that an alternative is better is not the same as teaching not to do something and does not make a method nonobvious.
Furthermore, the original disclosure (paragraph [0068]) merely defines CgRRS as a DNA polynucleotide comprising a PAM site operably linked to a guide RNA hybridization site, where the CgRRS is absent from transgenic plant genomes comprising a first original transgenic locus. That the CgRRS and OgRRS can hybridize to a single gRNA would not require that the CgRRS and OgRRS are identical, although this is taught by Finnigan’s method. Given that the CgRRS and OgRRS are DNA polynucleotides, if the CgRRS and OgRRS were “definitionally” identical like Applicant argues in Remarks, then the OgRRS must not be found in the non-transgenic or even the transgenic plant genome. If the OgRRS is found in the original transgenic plant genome, a DNA polynucleotide identical to the CgRRS would not be absent from the original transgenic plant genome and so it could not be a CgRRS.
Finally, claims 54-56 & 58-59 encompass methods wherein the OgRRS is located in transgenic DNA and does not require OgRRS or CgRRS DNA present in the non-transgenic plant genome (claim 54, line 6).
Applicant urges that Finnigan relates to methods of installing synthetic sequences into a genome of interest that have no detectable counterpart in the genome of interest, whereas the instant claims utilize cleavage target sequences that exist within the genome of interest (Remarks page 14, paragraph 3-page 15, paragraph 4). Applicant urges that the specification notes that the CgRRS comprise at least 18 nucleotides of identical DNA sequence (paragraphs [90, 113]) and are thus drawn to a duplication of a naturally occurring sequence, which is not disclosed or suggested by Finnigan (Remarks, page 15, paragraph 4).
This argument is unpersuasive, because a requirement that the CgRRS comprise at least 18 nucleotides of identical DNA sequence to the OgRRS is not found in the claims, merely that the OgRRS and CgRRS can hybridize to one first gRNA. Thus, the CgRRS does not need to be a naturally occurring sequence. Additionally, the definition of the CgRRS in the specification (paragraph [0068]) does not require that the sequence be a “duplication”. Given that the CgRRS and OgRRS are DNA polynucleotides, if the CgRRS and OgRRS were “definitionally” identical like Applicant argues in Remarks, then the OgRRS must not be a naturally occurring sequence in the plant genome. If the OgRRS is naturally occurring in the original transgenic plant genome, a DNA polynucleotide identical to the CgRRS would not be absent from the original transgenic plant genome and so it could not be a CgRRS.
Claims 54-56 & 58-59 encompass methods wherein the OgRRS is located in transgenic DNA and does not require OgRRS or CgRRS DNA present in the non-transgenic plant genome (claim 54, line 6).
Applicant urges that Finnigan teaches away from using Endogenous Target sequences because non-naturally occurring target sequences reduce or eliminate off-target effects, and that alien target sequences are critical to function and performance of their methods. Applicant urges that a skilled artisan would expect that modifying Finnigan to arrive at the instant claims would lead to off-target effects and limited target site availability (Remarks, page 16, paragraphs 4).
This argument is unpersuasive, because teaching that an alternative is better is not the same as teaching not to do something and does not make a method nonobvious. In order to excise and or substitute a full transgenic locus, as suggested by Cui, the guide RNA recognition sites of both the CgRRS and the OgRRS would need to be located in non-transgenic plant genomic DNA of the DNA junction polynucleotide. Following Finnigan’s method to insert non-naturally occurring target sequences would not cause limited target site availability.
In addition, claims 54-56 & 58-59 do not require that the OgRRS be found in an unmodified transgenic locus, just that the OgRRS be located in a first modified transgenic locus (claim 54, lines 6-8, paragraph [0067]). Thus, one of skill reading Finnegan could arrive at an encompassed method using an OgRRS and CgRRS sequence not found naturally.
Applicant urges that Cermak, Cui, and Finnigan do not teach duplicating an endogenous flanking sequence and using the same to excise a transgenic locus (Remarks, page 17, paragraph 1).
This argument is unpersuasive, because, as outlined above, the methods of claims 54-56 & 58-59 do not require duplicating an endogenous flanking sequence.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
The rejections below are modified from the rejections as set forth in the Office action mailed 5/30/2025, as applied to claims 47, 53, 54, 55, & 59. Applicant' s arguments filed 9/2/2025 have been fully considered but they are not persuasive. Arguments are addressed in aggregate for all Double Patenting rejections below the rejections.
Claims 47 & 53 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 14 of copending Application No. 18/040,110 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because claim 14 of ‘110 makes obvious the method of claims 47 & 53.
This is modified from the rejection set forth in the Office action mailed 5/30/2025, as applied to claims 54 & 59. Applicant’s arguments have been considered but are not found persuasive and are addressed below the final Double Patenting rejection.
‘110 Claim 14 is drawn to a method of excising an INHT26 transgenic locus from the genome of a soybean plant. The method comprising the INHT26 plant in ‘110 claim 14 makes obvious the method of making said plant in instant claims 47 & 53, because the INHT26 transgenic locus recited in ‘110 claim 14 has an OgRRS present in non-transgenic plant genomic DNA and a CgRRS (‘110 figure 2) that share a nucleotide sequence (‘110 figure 1), and INHT26 refers to a locus that includes any or all of the DAS44406-6 transgenic soybean locus that has been modified (see ‘110 paragraph [0036]).
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 47 & 53 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 10 of copending Application No. 18/799,936 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of ‘936 make obvious the methods of instant claims 47 & 53.
‘936 claim 10 is drawn to a transgenic soybean plant comprising a DNA molecule of SEQ ID NO: 69, 70, 71, or 72. ‘936 SEQ ID NO: 69 is a sequence of an INHT26 event transgenic locus with PAM sites linked to a DNA junction sequence. An INHT26 transgenic locus comprises an OgRRS and a CgRRS in the DNA junction of a DAS44406-6 transgenic locus. The OgRRS is located in genomic DNA of the 5’ junction sequence and shares a nucleotide sequence with the CgRRS.
Although ‘936 does not claim the method of making the plant of ‘936 claim 10, the transgenic soybean plant comprising a DNA molecule that is a transgenic locus comprising a CgRRS in a DNA junction of a DAS44406-6 transgenic locus and an OgRRS in an non-transgenic plant genome of DAS44406-6 makes obvious the method of instant claims 47 & 53.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 54, 55 & 59 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 5, 6 & 17 of copending Application No. 19/081,811 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of ‘811 are specific to the methods of instant claims 54, 55 & 59.
‘811 claim 5 is drawn to a method of excising transgenic DNA from a transgenic soybean plant cell, plant part, or plant comprising contacting a genome comprising a modified DAS44406-6 transgenic locus flanked by an OgRRS and a CgRRS that are identical with a Cas12a and selecting a transgenic soybean plant wherein the locus has been excised. ‘811 claim 6 is further drawn to the method where the locus comprises a deletion. ‘811 Claim 17 is further drawn to the method wherein contacting occurs by containing with polynucleotide, polypeptide, or RNP containing composition comprising a Cas12a RNA dependent RNA endonuclease and gRNA.
This method is specific to the method of instant claims 54, 55, and 59, drawn to a method of excising a modified transgenic locus comprising contacting the genome comprising a transgenic locus comprising an OgRRS and a CgRRS with an RNA dependent DNA endonuclease and a guide RNA and selecting a transgenic plant cell wherein the portion flanked by the OgRRS and CgRRS has been excised, wherein the contacting is by introducing one or more compositions comprising the RNA dependent DNA endonuclease and the gRNA into the transgenic plant cell, and wherein the transgenic locus comprisies a modification of a DAS44406-6 transgenic locus.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claim 54 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Patent No. US 11,788,096 B2 (Nuccio et al, patented 10/17/2023, hereafter 096). Although the claims at issue are not identical, they are not patentably distinct from each other because the claim of 096 is specific to the method of instant claim 54.
096 claim 7 is drawn to a method of excising a transgenic locus from the genome of a soybean plant cell comprising contacting the genome comprising 096 SEQ ID NO: 14 with an RNA dependent DNA endonuclease and a guide RNA capable of hybridizing to the guide RNA hybridization site of 096 SEQ ID NO: 19 and selecting a transgenic plant cell wherein the transgenic locus has been excised. 096 SEQ ID NO: 14 comprises an OgRRS and CgRRS (both of which are 096 SEQ ID NO: 19. See 096 figure 2 and paragraph 0041).
This reads on a method of excising a modified transgenic locus or portion thereof from an edited transgenic plant genome comprising contacting the genome, which has an OgRRS present in non-transgenic plant genomic DNA and a CgRRS, with an RNA dependent DNA endonuclease and a guide RNA capable of hybridizing to the OgRRS and CgRRS and selecting a transgenic plant cell wherein the locus flanked by the OgRRS and CgRRS has been excised (instant claim 54).
Claim 47 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. US 11,369,073 B2 (Price et al, patented 6/28/2022, hereafter 073). Although the claims at issue are not identical, they are not patentably distinct from each other because the claim of 073 makes obvious the method of instant claim 47.
073 claim 1 is drawn to a transgenic maize plant cell comprising the sequence of 073 SEQ ID NO: 47. 073 SEQ ID NO: 47 is a INIR12 transgenic locus obtained by insertion of a CgRRS in the 5’ DNA junction of an MIR 162 transgenic locus. An OgRRS sequence is located in endogenous plant non-transgenic DNA of the 3’ junction sequence of MIR162 locus (see 073 figure 5C and column 5 lines 34-45 as evidence, endogenous DNA is provided in uppercase). The inserted CgRRS is in the 5’ junction polynucleotide (column 5, 57-59). The OgRRS and CgRRS share multiple consecutive nucleotides, which represent a nucleotide sequence which is identical to a nucleotide sequence of the OgRRS (instant claim 47, lines 11-12). Thus, although 073 does not claim the method of making such a maize plant cell, the transgenic maize plant cell of 073 claim 1 makes obvious a method wherein a CgRRS is introduced into a junction polynucleotide of an original transgenic locus comprising an OgRRS located in non-transgenic plant genomic DNA of a first DNA junction polynucleotide and wherein the CgRRS is operably linked to a second DNA junction, because these features are found in 073 SEQ ID NO: 47 required by 073 claim 1.
Claim 47 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. US 11,214,811 B1 (Nuccio et al, patented 1/4/2022, hereafter 811). Although the claims at issue are not identical, they are not patentably distinct from each other because the claim of 811 makes obvious the method of instant claim 47.
811 claim 1 is drawn to a transgenic maize plant cell comprising a transgenic locus comprising the sequence of SEQ ID NO: 20. 811 SEQ ID NO: 20 is the sequence of an INIR6 transgenic locus containing a CgRRS insertion in the 3’ junction. 811 SEQ ID NO: 20 also comprises an OgRRS (811 SEQ ID NO: 7, see alignment below between 811 SEQ ID NO: 7 and 20), which is located in the 5’ flanking genomic region of the maize plant. The OgRRS and CgRRS share a nucleotide sequence of 811 SEQ ID NO: 7 (instant claim 47, lines 11-12).
Alignment statistics for match #1
Score
Expect
Identities
Gaps
Strand
54.0 bits(27)
2e-11
27/27(100%)
0/27(0%)
Plus/Plus
Query 1 TTTGTAGCACTTGCACGTAGTTACCCG 27
|||||||||||||||||||||||||||
Sbjct 2375 TTTGTAGCACTTGCACGTAGTTACCCG 2401
Alignment statistics for match #2
Score
Expect
Identities
Gaps
Strand
54.0 bits(27)
2e-11
27/27(100%)
0/27(0%)
Plus/Plus
Query 1 TTTGTAGCACTTGCACGTAGTTACCCG 27
|||||||||||||||||||||||||||
Sbjct 14283 TTTGTAGCACTTGCACGTAGTTACCCG 14309
Although 811 does not claim the method of making such a maize plant cell, the transgenic maize plant cell of 811 claim 1 makes obvious a method wherein a CgRRS is introduced into a junction polynucleotide of an original transgenic locus comprising an OgRRS located in non-transgenic plant genomic DNA of a first DNA junction polynucleotide and wherein the CgRRS is operably linked to a second DNA junction, because these features are found in 811 SEQ ID NO: 20.
Claims 54 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 12 of U.S. Patent No. US 11,814,632 B2 (Nuccio et al, patented 11/14/2023, hereafter 632). Although the claims at issue are not identical, they are not patentably distinct from each other because the claim of 632 makes obvious the method of instant claim 54.
This is modified from the rejection set forth in the Office action mailed 5/30/2025, as applied to claims 47 & 54. Applicant’s arguments have been considered but are not found persuasive and are addressed below.
632 claim 12 is drawn to a method of excising the INIR20 transgenic locus from the genome of the soybean plant cell comprising contacting the genome with an RNA dependent DNA endonuclease and a guide RNA capable of hybridizing to the OgRRS and the CgRRS and selecting a plant cell, part, or plant wherein the INIR20 transgenic locus has been excised. This claim is specific to instant claim 54, drawn to a method of excising a modified transgenic locus or portion comprising contacting the transgenic plant genomic comprising the modified transgenic locus with an RNA dependent DNA endonuclease and a guide RNA and selecting a transgenic plant cell, part, or plant wherein the locus or portion flanked by the OgRRS and CgRRS has been excised.
Claims 47 & 54 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 and 11 of U.S. Patent No. US 12,305,175 B2 (Kock et al, patented 5/20/2025, hereafter 175). Although the claims at issue are not identical, they are not patentably distinct from each other because claims 1 and 11 of 175 make obvious or are specific to the methods of instant claim 47 and 54.
175 claim 1 is drawn to a transgenic soybean plant cell comprising an INHT27 transgenic locus comprising the DNA molecule set forth in 175 SEQ ID NO: 3. 175 SEQ ID NO: 3 comprises an INIR19 transgenic locus containing a CgRRS insertion of 175 SEQ ID NO: 9 in a 5’ junction polynucleotide (175 table 1). 175 SEQ ID NO: 3 also comprises an OgRRS of 175 SEQ ID NO: 7 found in a 3’ junction polynucleotide of an original DAS68416-4 transgenic locus (175 table 2); moreover, SEQ ID NO: 7 is found in the plant genome (non-transgenic DNA) of the 3’ junction polynucleotide (see 175 figure 1 and alignment below between OgRRS SEQ ID NO: 7 and DAS68416-4 sequence SEQ ID NO: 1 as evidence for location of the OgRRS). The OgRRS and CgRRS share a sequence of consecutive nucleotides, which represent a nucleotide sequence which is identical to a nucleotide sequence of the OgRRS (instant claim 47, lines 11-12). See alignments below.
SEQ ID NO: 3 vs SEQ ID NO: 7
Alignment statistics for match #1
Score
Expect
Identities
Gaps
Strand
54.0 bits(27)
4e-11
27/27(100%)
0/27(0%)
Plus/Plus
Query 2729 TTTCCATTGAAATATGTTAGCAAGTTC 2755
|||||||||||||||||||||||||||
Sbjct 1 TTTCCATTGAAATATGTTAGCAAGTTC 27
SEQ ID NO: 9 vs SEQ ID NO: 7
Alignment statistics for match #1
Score
Expect
Identities
Gaps
Strand
54.0 bits(27)
7e-14
27/27(100%)
0/27(0%)
Plus/Plus
Query 32 TTTCCATTGAAATATGTTAGCAAGTTC 58
|||||||||||||||||||||||||||
Sbjct 1 TTTCCATTGAAATATGTTAGCAAGTTC 27
SEQ ID NO: 7 vs SEQ ID NO: 1
Score
Expect
Identities
Gaps
Strand
54.0 bits(27)
1e-11
27/27(100%)
0/27(0%)
Plus/Plus
Query 1 TTTCCATTGAAATATGTTAGCAAGTTC 27
|||||||||||||||||||||||||||
Sbjct 9288 TTTCCATTGAAATATGTTAGCAAGTTC 9314
Although 175 does not claim the method of making the plant cell of 175 claim 1, a transgenic soybean plant cell comprising an INHT27 transgenic locus comprising the DNA molecule set forth in 175 SEQ ID NO: 3 makes obvious a method of instant claim 47 wherein a CgRRS is introduced into a junction polynucleotide of an original transgenic locus comprising an OgRRS located in non-transgenic plant genomic DNA of a first DNA junction polynucleotide and wherein the CgRRS is operably linked to a second DNA junction, because these features are found in 175 SEQ ID NO: 3.
175 claim 11 is drawn to a method of excising the INHT27 transgenic locus from the genome of the soybean plant cell comprising contacting the transgenic locus with a Cas12a RNA dependent DNA endonuclease and a guide RNA and selecting a transgenic plant cell, part or plant wherein the transgenic locus has been excised. This claim is specific to instant claim 54, drawn to a method of excising a modified transgenic locus or portion comprising contacting the transgenic plant genomic comprising the modified transgenic locus with an RNA dependent DNA endonuclease and a guide RNA and selecting a transgenic plant cell, part, or plant wherein the locus or portion flanked by the OgRRS and CgRRS has been excised.
Claims 47 & 54 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 & 12 of U.S. Patent No. US 11,773,398 B2 (Price et al, patented 10/3/2023, hereafter 398). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of 398 make obvious or are specific to the methods of instant claims 47 & 54.
398 claim 1 is drawn to a transgenic maize plant cell comprising an INIR17 transgenic locus comprising a CgRRS in a 5’ junction polynucleotide of a 5307 maize event transgenic locus, and a OgRRS in a 3’ junction polynucleotide wherein said INIR17 transgenic locus comprises the DNA molecule set forth as SEQ ID NO: 33. The INIR17 locus, and SEQ ID NO: 33, comprise the OgRRS in nontransgenic plant genome of the 3’ flanking junction polynucleotide (see 398 figure 5; column 4, lines 52-63 and figure 9). The OgRRS and CgRRS in 398 SEQ ID NO: 33 share the nucleotide sequence TTTACACCACAATATA (see figure 9).
Although 398 does not claim the method of making the plant of 398 claim 1, a transgenic plant cell comprising a DNA molecule that is a transgenic locus comprising a CgRRS and OgRRS in two different DNA junctions of a maize transgenic locus comprising 398 SEQ ID NO: 33 makes obvious a method of instant claim 47 wherein a CgRRS is introduced into a junction polynucleotide of an original transgenic locus comprising an OgRRS located in non-transgenic plant genomic DNA of a first DNA junction polynucleotide and wherein the CgRRS is operably linked to a second DNA junction, because these features are found in 398 SEQ ID NO: 33.
398 claim 12 is drawn to a method of excising the INIR17 transgenic locus comprising contacting the genome of the maize plant cell with a Cas12 RNA dependent DNA endonuclease and a guide RNA and selecting a transgenic plant cell, part, or plant wherein the locus flanked by the OgRRS and CgRRS has been excised. This claim is specific to instant claim 54, drawn to a method of excising a modified transgenic locus or portion comprising contacting the transgenic plant genomic comprising the modified transgenic locus with an RNA dependent DNA endonuclease and a guide RNA and selecting a transgenic plant cell, part, or plant wherein the locus or portion flanked by the OgRRS and CgRRS has been excised.
Claim 54 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 12 of U.S. Patent No. US 11,773,397 B2 (Kock et al, patented 10/3/2023, hereafter 397). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of 397 make obvious or are specific to the methods of instant claim 54.
This is modified from the rejection set forth in the Office action mailed 5/30/2025, as applied to claims 47 & 54. Applicant’s arguments have been considered but are not found persuasive and are addressed below the final Double Patenting rejection.
397 claim 12 is drawn to a method of excising the INIR4 transgenic locus from the genome of the maize plant cell comprising contacting the transgenic locus with a Cas12 RNA dependent DNA endonuclease and a guide RNA capable of hybridizing to the OgRRS and CgRRS and selecting a transgenic plant cell, part, or plant wherein the transgenic locus flanked by the OgRRS and the CgRRS has been excised. This claim is specific to instant claim 54, drawn to a method of excising a modified transgenic locus or portion comprising contacting the transgenic plant genomic comprising the modified transgenic locus with an RNA dependent DNA endonuclease and a guide RNA and selecting a transgenic plant cell, part, or plant wherein the locus or portion flanked by the OgRRS and CgRRS has been excised.
Claim 54 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 & 16 of U.S. Patent No. US 11,814,630 B2 (Price et al, patented 11/14/2023, hereafter 630). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of 630 make obvious or are specific to the methods of instant claim 54.
This is modified from the rejection set forth in the Office action mailed 5/30/2025, as applied to claims 47 & 54. Applicant’s arguments have been considered but are not found persuasive and are addressed below the final Double Patenting rejection.
630 claim 16 is drawn to a method of excising the INIR19 transgenic locus from the genome of the soybean plant cell comprising contacting the INIR19 trangenic locus with a Cas12 RNA dependent DNA endonuclease and a guide RNA capable of hybridizing to the OgRRS and CgRRS and selectin ga transgenic plant cell, part, or plant wherein the INIR19 transgenic locus has been excised. This claim is specific to instant claim 54, drawn to a method of excising a modified transgenic locus or portion comprising contacting the transgenic plant genomic comprising the modified transgenic locus with an RNA dependent DNA endonuclease and a guide RNA and selecting a transgenic plant cell, part, or plant wherein the locus or portion flanked by the OgRRS and CgRRS has been excised.
Applicant urges that nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical and at least one examined application claim is not patentably distinct from the reference claim (Remarks, page 19, paragraph 1). Applicant urges that the standard for obvious-type nonstatutory double patenting is not the same standard as 35 U.S.C. 103 and argues that inventions may be considered distinct if the inventions are not connected in design, operation, or effect, citing MPEP 802.01 (Remarks, page 19, paragraph 2). Applicant urges that the rejections are improper because the pending claims differ from the cited patent documents in one or more of design, operation, or effect (Remarks, page 19, paragraph 2).
This argument is unpersuasive, because the standard for distinctness of MPEP 802.01 regarding design, operation, or effect pertains to requirements for restriction under 35 U.S.C. 121. The instant application is not a Divisional application of the referenced patents and patent applications in the above double patenting rejections, so the criteria for distinctiveness for restriction is not relevant. A nonstatutory double patenting rejection, if not based on an anticipation rationale or an "unjustified timewise extension" rationale, is "analogous to [a failure to meet] the nonobviousness requirement of 35 U.S.C. 103 " except that the patent disclosure principally underlying the double patenting rejection is not considered prior art. In re Braithwaite, 379 F.2d 594, 154 USPQ 29 (CCPA 1967). See MPEP 806(II)(B)(3).
Applicant reserves the right to file a terminal disclaimer over any of the cited patent documents (Remarks, page 19, paragraph 3).
This argument is unpersuasive, because a complete reply to the nonstatutory double patenting rejection requires a terminal disclaimer accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to final Office action, see 37 CFR 1.113(c).
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-12pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/VICTORIA L DELEO/Examiner, Art Unit 1662
/Anne Kubelik/Primary Examiner, Art Unit 1663