Prosecution Insights
Last updated: April 19, 2026
Application No. 18/007,114

POLYNUCLEOTIDE, POLYNUCLEOTIDE SET, METHOD FOR DETECTING PORPHYROMONAS GINGIVALIS, METHOD FOR ASSESSING PERIODONTAL DISEASE SUSCEPTIBILITY, PORPHYROMONAS GINGIVALIS DETECTION KIT, AND PERIODONTAL DISEASE SUSCEPTIBILITY ASSESSMENT KIT

Non-Final OA §101§102
Filed
Jan 27, 2023
Examiner
SWITZER, JULIET CAROLINE
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Mitsui Chemicals Inc.
OA Round
1 (Non-Final)
42%
Grant Probability
Moderate
1-2
OA Rounds
3y 10m
To Grant
95%
With Interview

Examiner Intelligence

Grants 42% of resolved cases
42%
Career Allow Rate
207 granted / 496 resolved
-18.3% vs TC avg
Strong +53% interview lift
Without
With
+53.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
48 currently pending
Career history
544
Total Applications
across all art units

Statute-Specific Performance

§101
18.7%
-21.3% vs TC avg
§103
23.4%
-16.6% vs TC avg
§102
17.9%
-22.1% vs TC avg
§112
29.1%
-10.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 496 resolved cases

Office Action

§101 §102
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. In Figure 1, the shorter polynucleotides represented by arrows are identified by SEQ ID NO, but the longer “top line” disclosure of the fimA type II gene is not identified with a proper sequence identifier. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-15 are rejected under 35 U.S.C. 101 because the claimed invention is directed to nature-based products without significantly more. The claim(s) recite(s) a polynucleotide and sets of polynucleotides that are fragments of naturally occurring Porphyromonas gingivalis (specification para 11 and which teaches that the claimed polynucleotides are portions of the fimbrial gene fimA type II of P. gingivalis). Thus, the claims set forth product of nature limitations. The claimed polynucleotides encompass full length chromosomes which are naturally occurring products (see claims drawn using “comprising” language with no upper length limitation). Further even insofar as shorter polynucleotides are encompassed, the shorter nucleic acids may have a different structural characteristic than the naturally occurring genes because the chemical bonds at each end are severed to produce shorter “polynucleotide” molecules, but the claims encompass molecules with the same nucleotide sequence as the naturally occurring genes. The claimed nucleic acids have no different functional characteristics from the naturally occurring counterparts. Under the holding of Myriad, isolated but otherwise unchanged nucleic acids are not different enough from what exists in nature. In other words, the claimed probes and primers may be different from, but are not markedly different from the naturally gene they are a fragment of. Claims 11 and 12 are process claims that are drafted in such a way that there is no difference in substance from the product claim as they focus on the product rather than the process steps (MPEP 21-6.04(c)(I)(C)). Under the broadest reasonable interpretation, the method of claims 11-12 are focused on the primers themselves, which are nature-based products. Claims 5-13 require an additional element which can also be a naturally occurring product (a second polynucleotide). The claims do not require any non-nature-based product limitation. The inclusion of the polynucleotides in the kit does not change their characteristics. Thus, the primers are not mixed together, and in the kit the primers do not have markedly different characteristics from their natural counterparts in their natural state and are “product of nature” exceptions. Accordingly, the claims are directed to a judicial exception. This judicial exception is not integrated into a practical application because there are no additional elements in the claims. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because there are no additional elements in the claims. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 1-2, 5-6, 10-15 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Moon et al. FEMS Immunol Med Microbiol 64 (2012) 425–428. Moon teaches a primer pair which consists of forward primer GCATGATGGTACTCCTTTGA and reverse primer CTGACCAACGAGAACCCACT. The forward primer comprises nucleotides 12-18 of instant SEQ ID NO: 1, see the portion of the forward primer underlined in bold above. The forward primer also contains a portion of instant SEQ ID NO: 2 and SEQ ID NO: 3. The forward primer taught by Moon reads on claim 1, part 1b, 1c, and 1d. The forward primer taught by moon is a polynucleotide that hybridizes with a polynucleotide comprising a base sequence complementary to a base sequence of SEQ ID NO: 1. A polynucleotide “comprising a base sequence complementary to a base sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 9” is a very broad recitation. First the use of the indefinite article “a” is very broad “a base sequence of SEQ ID NO: 1,” encompasses any fragment of SEQ ID NO: 1. Second, a polynucleotide which hybridizes to polynucleotide that comprises a base sequence complementary to a base sequence of SEQ ID NO: 1 can hybridize anywhere on the polynucleotide that comprises the base sequence complementary to SEQ ID NO: 1. For example, consider a sequence graphically illustrated as: NNNNNNNNNNNNNNNNNNNNNCOMPLEMENTSEQIDNO:1NNNNNNNNNNNNN. This is a sequence comprising a base sequence complementary to SEQ ID NO: 1. Part 1(b) of claim 1 requires that the claimed polynucleotide hybridize with this sequence but does not say where it hybridizes. Therefore, the polynucleotide of the instant invention could be the complement of any NNNNNNN portion of the illustration. That molecule would hybridize to a polynucleotide that comprises a base sequence complementary to SEQ ID NO: 1. The polynucleotide taught by Moon comprises a base sequence having 100% identity to a base sequence of SEQ ID NO: 1, see the portion in bold and underlined above. Additionally, the reverse primer taught by Moon reads on 1(b), 1(c), and 1(d). The reverse primer reverse primer comprises nucleotides CTGACCAACGAGAACCCACT. For example, regarding 1(b) the primer taught by Moon is a polynucleotide that hybridizes with the FimA gene of HW2D1 (see Fig S1, p. 428). The FimA gene of HW2D1 is a polynucleotide comprising a base sequence complementary to a base sequence of SEQ ID NO: 9, as evidenced by the GenBank Record AE015924. Therefore, the reverse primer hybridizes to a polynucleotide comprising SEQ ID NO: 9 (i.e. it hybridizes to the FimA gene of HW2D1. The claim does not require that the claimed polynucleotide hybridize to SEQ ID NO: 9 or have any identity with SEQ ID NO: 9. The polynucleotide taught by Moon comprises “a” base sequence that is the same as “a” base sequence of SEQ ID NO: 1. It also comprises the base sequence of SEQ ID NO: 1 except that several bases are deleted. Here there is no special definition of “several.” With regard to claim 2, the forward primer taught by Moon is 20 bases. With regard to claim 5, as discussed above, the primer set taught by Moon reads on at least (2b) and 3(b). With regard to claim 6, primers in the reference are in this size range. With regard to claims 10-11, the polynucleotide set is for detecting P. gingivalis and for evaluating susceptibility to periodontal disease. The statements in these claims are statements of intended use and do not distinguish the claimed set from the set taught by Moon. With regard to claims 12 and 13, the reference teaches a nucleic acid amplification reaction step using the polynucleotide set. Regarding claim 12, the reference teaches detection P. gingivalis via the amplification method, and regarding claim 13, the method could be used for evaluating susceptibility to periodontal disease. The statement regarding disease in the claim isa statement of intended use and do not distinguish the claimed method from the method taught by Moon. With regard to the kits in claims 14 and 15, the kits do not require any structural elements in addition the primer set, which is taught by Moon. Claim(s) 1-10 and 14-15 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by GenBank Record having accession D17797 (Porphyromonas gingivalis (strain HW24D1) fimA gene for fimbrilin, complete cds.), 20 Feb 1999. The GenBank record discloses a polynucleotide that comprises at least SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 9 in their entirety. SEQ ID NO: 3 is identical to nucleotides 931-948 of the disclosed sequence and SEQ ID NO: 4 is the complement of nucleotides 1072-1095 and SEQ ID NO: 9 is the complement of nucleotides 1075-1095 of the sequence. As the gene is inherently double stranded in nature, the reference inherently discloses a polynucleotide that comprises SEQ ID NO: 3 and the complement which comprises SEQ ID NO: 9 as well as SEQ ID NO: 3 and SEQ ID NO: 4. The two together are a “set” of polynucleotides that comprise SEQ ID NO: 3 and 9. With regard to claims 2 and 5, the polynucleotide taught in the reference has (i.e. comprises) 15 bases. Amending the claim to recite “consisting of” as the transitional phrase will overcome this rejection. Here “having” and “have” are not specifically defined and are construed as being equivalent to “comprising.” Claims 1-11 and 14-15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by NEB catalog (1996/1997), pp. 111. The claims are directed to a polynucleotide and a set of polynucleotides that are defined with great breadth in terms of the molecules encompassed. Attention here is paid to claims 3, 4, 7, 8, and 9, which of the claims have the most well-defined structural requirements. Claims 3 and 4 read on a polynucleotide that comprises a base sequence of not less than 15 consecutive bases of SEQ ID NO: 3, SEQ ID NO: 7, or SEQ ID NO: 9. Claims 7, 8, and 9 require pairs of these. The polynucleotides must “comprise” the 15, but can be of any length. The NEB catalog offered for sale a random primer mix of 24mer nucleotide primers. As the calculation below shows, about 9 molecules of every single 24mer are present in each tube of the 24 nucleotide mixtures. That means the composition taught by NEB inherently included many polynucleotide comprising at least 15 consecutive nucleotides of SEQ ID NO: 3, SEQ ID NO: 7, and SEQ ID NO: 9, and also the entire composition is a set that comprises these. Thus, the sets of polynucleotides taught by NEB, in the kit provided by NEB anticipate all of the instant claims. a. Molecular weight of 12-mer: 12 x 325 daltons/nucleotide = 3,900 daltons = 3,900 g/mol b. Total number of possible 12-mers: 412 = 1.6 x 107 molecules c. How many molecules of 12-mer in a vial sold by NEB: 1 A260 unit = 33 mg = 3.3 x 10-5 g 3.3 x 10-5 g / 3,900 g/mol = 8.4 x 10-9 mol (8.4 x 10-9 mol) x (6.02 x 1023 molecules/mol) = 5 x 1015 molecules d. How many molecules of each 12-mer in a single vial: 5 x1015 molecules / 1.6 x 107 molecules = 3.2 x 108 molecules of each 12-mer per vial e. Molecular weight of 24-mer: 24 x 325 daltons/nucleotide = 7,800 daltons = 7,800 g/mol f. Total number of possible 24-mers: 424 = 2.8 x 1014 molecules g. How many molecules of 24-mer in a vial sold by NEB: 1 A260 unit = 33 mg = 3.3 x 10-5 g 3.3 x 10-5 g / 7,800 g/mol = 4.2 x 10-9 mol (4.2 x 10-9 mol) x (6.02 x 1023 molecules/mol) = 2.5 x 1015 molecules h. How many molecules of each 24-mer in a single vial: 2.5 x1015 molecules / 2.8 x 1014 molecules = 9 molecules/vial Claim Objections Applicant is advised that should claims 12 and 14 be found allowable, claims 13 and 15 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m). The body of the claims is identical; the claims only differ in the recitation of an intended use which does not breath life and meaning into the claims. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Juliet Switzer whose telephone number is (571)272-0753. The examiner can normally be reached Monday to Thursday, 8:00 AM-3:30 PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at (571)-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Juliet Switzer Primary Examiner Art Unit 1682 /JULIET C SWITZER/ Primary Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Jan 27, 2023
Application Filed
Sep 19, 2025
Non-Final Rejection — §101, §102 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584181
Detection of Mycobacterium species
2y 5m to grant Granted Mar 24, 2026
Patent 12559789
A METHOD OF TARGETING PATIENT-SPECIFIC ONCOGENES IN EXTRACHROMOSOMAL DNA TO TREAT GLIOBLASTOMA
2y 5m to grant Granted Feb 24, 2026
Patent 12559804
LOOP-MEDIATED ISOTHERMAL AMPLIFICATION PRIMERS FOR VIBRIO PARAHAEMOLYTICUS DETECTION AND USES THEREOF
2y 5m to grant Granted Feb 24, 2026
Patent 12545954
MULTIPLEXED ASSAY FOR QUANTITATING AND ASSESSING INTEGRITY OF CELL-FREE DNA IN BIOLOGICAL FLUIDS FOR CANCER DIAGNOSIS, PROGNOSIS AND SURVEILLANCE
2y 5m to grant Granted Feb 10, 2026
Patent 12522873
NOVEL ALK AND NTRK1 FUSION MOLECULES AND USES THEREOF
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
42%
Grant Probability
95%
With Interview (+53.0%)
3y 10m
Median Time to Grant
Low
PTA Risk
Based on 496 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month